Application of Eilukui homologous box family gene IRX3 in diagnosis, prognosis and treatment of liver cancer

Abstract

The invention discloses application of a Yilukui homologous box family gene IRX3 in diagnosis, prognosis and treatment of liver cancer, and particularly relates to application of a reagent for detecting expression of a biomarker Yilukui homologous box family gene IRX3 in preparation of a product for auxiliary diagnosis or diagnosis or prognosis of a liver cancer object. The invention discloses application of IRX3 as a target in screening of drugs for treating liver cancer. The invention discloses application of an IRX3 expression inhibitor in preparation of a medicine for treating liver cancer. According to the research, the expression of IRX3 in liver cancer tissues is obviously increased, and the high expression of IRX3 is closely related to the lifetime of clinical hepatocellular carcinoma patients; the specific knock-down IRX3 can significantly reduce the proliferation ability of liver cancer cells, provides a new diagnosis / prognosis marker and a new treatment target for treatment of liver cancer, provides a new treatment strategy and direction, and has important scientific significance in subsequent drug research and development, clinical treatment and other aspects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of Iroquois homeobox family gene IRX3 in the diagnosis, prognosis and treatment of liver cancer. Background Art

[0002] Hepatocellular carcinoma (HCC) accounts for 75% to 85% of primary liver cancer and is the main histological type of liver cancer. It is also the sixth most common malignant tumor and the third leading cause of cancer-related death in the world. HCC has the characteristics of high mortality, multiple risk factors, and poor prognosis. To date, the molecular mechanism of HCC occurrence and development has not been fully elucidated. Therefore, in-depth research on the molecular mechanism of HCC occurrence and development and finding new potential therapeutic targets are of great practical significance for the treatment of HCC.

[0003] IRX3 Iroquois homeobox 3 (IRX3) belongs to the Iroquois homeobox gene family. It is highly expressed in multiple tissues of the body and has multiple biological effects. Currently, the functional research of IRX3 gene mainly focuses on the development of organs such as brain, nerves, bones and internal organs, stem cell proliferation and differentiation, energy metabolism homeostasis and body composition regulation. However, at present, the research on IRX3 gene in liver cancer is relatively small. Summary of the invention

[0004] The purpose of the present invention is to address the above problems and provide an application of an Iroquois homeobox family gene IRX3 in the diagnosis, prognosis and treatment of liver cancer.

[0005] In order to achieve its purpose, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of a reagent for detecting the expression of the biomarker Iroquois homeobox family gene IRX3 in the preparation of a product for auxiliary diagnosis, diagnosis or prognosis of liver cancer subjects.

[0007] The diagnostic method comprises: obtaining a test sample from a subject suspected of having liver cancer, determining the expression level of IRX3 in the test sample, and if IRX3 is highly expressed compared to a normal control, it indicates that the subject is a high-risk group for liver cancer or a liver cancer patient.

[0008] The prognosis method comprises: obtaining a test sample from a subject suffering from liver cancer, and determining the expression level of IRX3 in the test sample. High expression of IRX3 indicates a poor prognosis for the patient. The higher the expression of IRX3, the shorter the survival time of the patient.

[0009] The second aspect of the present invention provides the use of IRX3 as a target in screening drugs for treating liver cancer.

[0010] The drug inhibits the expression of IRX3, thereby inhibiting the viability, proliferation, invasion and migration of liver cancer cells.

[0011] The third aspect of the present invention provides the use of an IRX3 expression inhibitor in the preparation of a medicament for treating liver cancer.

[0012] The expression inhibitors include nucleic acid molecules, proteins, and compounds.

[0013] The nucleic acid molecules include siRNA and shRNA.

[0014] Preferably, the shRNA is shIRX3-1 or shIRX3-2;

[0015] The sense strand sequence of shIRX3-1 is:

[0016] CCGGGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCGCTTTTT G;

[0017] The antisense sequence of shIRX3-1 is:

[0018] AATTCAAAAAGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCG C;

[0019] The sense strand sequence of shIRX3-2 is:

[0020] CCGGGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCTCTTTTTT G;

[0021] The antisense sequence of shIRX3-2 is:

[0022] AATTCAAAAAGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCT C.

[0023] Preferably, in any of the above-mentioned application technology solutions, the liver cancer is hepatocellular carcinoma.

[0024] The beneficial effects of the present invention are: utilizing molecular cell biology and bioinformatics techniques, through an in vitro cell model combined with a comprehensive research method of clinical samples, on the basis of good preliminary work, the molecular mechanism by which IRX3 promotes the proliferation of hepatocellular carcinoma is explored, and it is clarified that the expression of IRX3 in liver cancer tissue is significantly increased, and the high expression of IRX3 is closely related to the survival of clinical hepatocellular carcinoma patients; specific knockdown of IRX3 can significantly reduce the proliferation ability of liver cancer cells, providing new diagnostic / prognostic markers and new therapeutic targets for the treatment of liver cancer, providing new treatment strategies and directions, and having important scientific significance for subsequent drug development, clinical treatment, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It was shown that IRX3 is highly expressed in clinical liver cancer tissues.

[0026] Figure 2 The RNA and protein expression levels of IRX3 in different hepatocellular carcinoma tissues are shown.

[0027] Figure 3 This is a graph showing the experimental results of the effect of specific knockdown of IRX3 on the proliferation ability of liver cancer cells.

[0028] Figure 4 This is a graph showing the experimental results of the effect of overexpression of IRX3 on the proliferation ability of liver cancer cells.

[0029] Figure 5 This figure shows the experimental results of the effect of specific knockdown of IRX3 on the occurrence of tumors in mice.

[0030] Figure 6 This is the experimental result showing the effect of knocking down IRX3 on the expression of F2-like trypsin receptor 1 F2RL1 and the effect of overexpressing F2RL1 and partially complementing IRX3 on the proliferation ability of liver cancer. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0033] Example 1

[0034] 1. Experimental Materials

[0035] 1.1 Cells

[0036] HepG2 and 293T cells were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and Huh-7 cells were donated by Professor Lin Yong of Chongqing Medical University.

[0037] 1.2 Liver cancer and adjacent tissues

[0038] Liver cancer and adjacent liver tissues were obtained from patients who underwent surgical resection in the First Affiliated Hospital of Chongqing Medical University, and the specimens were immediately stored in liquid nitrogen after collection.

[0039] 1.3 Nude mice

[0040] Four-week-old BALB / c male nude mice were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. and raised by the Animal Experiment Center of Chongqing Medical University.

[0041] 1.4 Main Reagents

[0042]

[0043] 1.5qRT-PCR primer sequences:

[0044]

[0045] 1.6 shRNA primer sequences:

[0046]

[0047] 1.7 Primer sequences for overexpression cloning:

[0048]

[0049] 2 Experimental methods

[0050] 2.1 Differential expression analysis

[0051] Study expression differences: Analyze the relationship between IRX3 and clinical pathological characteristics and its value as an auxiliary diagnosis and biomarker, divided into the study of expression levels in liver cancer cells and the study of expression levels in liver cancer sample tissues.

[0052] Study on the expression level in liver cancer sample tissue: liver cancer tissue samples were selected from the biological sample bank, and the expression level of IRX3 in liver cancer tissue and adjacent normal tissue was detected to clarify the expression of IRX3 in clinical hepatocellular carcinoma and its relationship with liver cancer staging.

[0053] 2.2 Cell culture

[0054] HepG2 and Huh-7 cells were cultured in DMEM medium containing 10% fetal bovine serum, 1% penicillin-streptomycin, and 1% non-essential amino acids; 293T cells were cultured in DMEM medium containing 10% fetal bovine serum, 1% penicillin-streptomycin, and 1% GlutaMAX, and the cells were placed in an incubator with 5% CO2 and 37°C.

[0055] 2.2 Knockdown plasmid construction

[0056] (1) Design of shRNA sequence: Search the target sequence of the target gene on the website https: / / portals.broadinstitute.org / gpp / public / . The short hairpin sequence is 21 bp and the total length is 58 bp.

[0057] (2) Oligonucleotide annealing: Dissolve the primers to a concentration of 50 μM and then anneal them. Turn on the water bath and heat to 95°C. Take 20 μl of each forward and reverse primer, mix well and place in the water bath for 5 min. Then turn off the power and let it cool down overnight. Take out the annealing product and spin it off immediately. Then place it at -20°C for later use.

[0058] (3) Double digestion of vector: Double digestion of template plasmid pLKO.1 was performed with AgeI and EcoRI. 3 μg template, 50 μl reaction system, 0.5 μl of each enzyme were used, and the digestion time was 5 h. The sample was loaded on a 1% gel for electrophoresis. When the electrophoresis bands were uniform, the next step was performed.

[0059] (4) Rubber tapping and recovery were performed according to the instructions of the QIAGEN kit.

[0060] (5) Connect and add samples according to the following system:

[0061]

[0062] After the sample addition is completed, the sample is placed at 22°C for 30 minutes. After completion, it is placed at -20°C for use; (6) Transformation and clone selection: Take 100μl TOP10 competent cells, add 10μl of the above-mentioned recombinant product, mix well, and place on ice for 30 minutes; heat shock in a 42°C water bath for 30 seconds, and immediately cool on ice for 3 minutes; add 450μl LB medium without ampicillin resistance, and shake at 37°C for 1 hour; centrifuge at 5000rpm for 3 minutes, discard the remaining supernatant of about 70μl, mix well, add to the LB plate with ampicillin resistance, spread the plate with a triangular glass rod, and incubate in a constant temperature box at 37°C for 8 hours; add 3ml of culture medium to a screw-cap tube, pick a single clone with a gun tip and transfer it to the screw-cap tube, and incubate on a shaker at 37°C for 16 hours.

[0063] (7) Clone identification: After the plasmid is extracted, use AgeI for restriction digestion identification. If the plasmid before and after digestion is exactly the same in the electrophoresis diagram, it indicates that this clone has been connected to the shRNA sequence, which means that the clone is successful.

[0064] (8) Perform plasmid extraction according to the instructions and send it for sequencing. Successful sequencing indicates that shIRX3-1 and shIRX3-2 are successfully constructed. Then use lentivirus 293T to package, infect liver cancer cells, and perform cell proliferation experiments.

[0065] 2.3 Overexpression plasmid construction

[0066] (1) Design primers; after the primers are dissolved, add samples according to the following system:

[0067]

[0068] After the sample addition is completed, set the following conditions for PCR amplification:

[0069]

[0070] After PCR, the product is electrophoresed. If there is only one band, proceed to the next step.

[0071] (2) Purification of fragments (PCR reaction solution recovery) 1) If the sample volume is less than 100 μl, add sterile water to 100 μl; 2) Add 5 times the volume of Buffer GDP and vortex to mix; 3) Put the adsorption column into the collection tube and centrifuge at 12000g for 60 seconds; 4) Discard the filtrate, place the adsorption column in the collection tube, add 700 μl Buffer GW (with anhydrous ethanol added) to the adsorption column, and centrifuge at 12000g for 60 seconds; 5) Repeat the previous step; 6) Discard the filtrate, put the adsorption column back into the collection tube, and centrifuge at 12000g for 2 minutes; 7) Place the adsorption column in a 1.5 ml centrifuge tube, add an appropriate amount of 20 μl ddH2O to the center of the adsorption column, leave it for 2 minutes, and centrifuge at 12000g for 60 seconds; 8) Store DNA at -20℃.

[0072] (3) Enzyme digestion of vector: 3 μg CDH backbone plasmid was digested and loaded according to the following system, and then incubated in a water bath at 37°C for 5 h;

[0073]

[0074] (4) Ligation: Ligate the 3×Flag-IRX3 fragment and the pCDH vector, add the sample according to the following system, and then place it in a 37°C water bath for 30 min. After completion, the product is immediately placed on ice;

[0075]

[0076] (5) Transformation: 1) Take 50 μl of TOP10 competent cells, add 2 μl of the above recombinant product, mix well and place on ice for 30 min; 2) Heat shock in a 42°C water bath for 30 s, and immediately cool on ice for 3 min; 3) Add 450 μl of LB medium without ampicillin resistance and incubate at 37°C on a shaker for 50 min; 4) Centrifuge at 5000 rpm for 3 min, discard the remaining supernatant of about 70 μl, mix well with a pipette tip and add to an LB plate with ampicillin resistance, spread the plate with a triangular glass rod, and incubate in a 37°C incubator for 8 h;

[0077] (6) Pick a single clone for colony PCR identification: Add 100 μl of LB with ampicillin resistance to a sterile centrifuge tube, pick a single clone with a gun tip and transfer it to the centrifuge tube, incubate on a shaker at 37°C for 2 h, and then add samples according to the following system:

[0078]

[0079] (6) If the target band of electrophoresis is single, it is sent for sequencing, and then the plasmid is extracted and sent for sequencing. Successful sequencing indicates that the pCDH-3×Flag-IRX3 and pCDH-3×Flag-F2RL1 plasmids are successfully constructed.

[0080] 2.4CCK8, EdU, and colony formation assay

[0081] After constructing cell lines with specific knockdown or overexpression of IRX3 in HepG2 and Huh7 cells, the constructed liver cancer cell model was used to detect the effect of knockdown or overexpression of IRX3 on cell proliferation using CCK8, EdU, and clone formation experiments to clarify the biological role of IRX3 in hepatocellular carcinoma.

[0082] CCK-8 experiment to detect cell growth: take cells with good growth condition, digest and count them, prepare cell suspension, add lentiviral solution packaged with shctrl / shIRX3-1 / shIRX3-2, inoculate 100μl, 3000 cells per well of 96-well plate, mix well and place in 37℃ incubator for culture; when the cells have grown for 24h, 48h, 72h, 96h, and 120h, take out the 96-well plate, add 10μl CCK-8 solution, mix gently, and place in 37℃ incubator for 2h30min; detect OD value with microplate reader and record the results.

[0083] EdU experiment to detect cell proliferation: (1) Take the cells in the twelve-well plate, aspirate 500 μL of culture medium, leaving 500 μL in the six-well plate culture dish, add 1 ml of 2× EdU working solution (20 μM) preheated at 37°C, and incubate at 37°C for 2 h; after EdU labeling, remove the culture medium, add 1 ml of fixative solution (4% paraformaldehyde), and let it stand at room temperature for 15 min; remove the fixative solution, add 1 ml of PBS, place it on a shaker at room temperature for 5 min, and wash 3 times; remove the washing solution, add 1 ml of permeabilization solution (0.3% Triton), and incubate it at room temperature for 10 min; remove the permeabilization solution, add 1 ml of PBS, place it on a shaker at room temperature for 5 min, and wash 2 times; prepare the Click additive Solution according to the instructions of the Bio-Tech kit; remove the washing solution, add 0.5 ml Click reaction solution was added and incubated at room temperature in the dark for 30 minutes; the Click reaction solution was removed and the cells were washed with PBS three times, each time for 5 minutes; 1×Hoechst solution was prepared; the washing solution was removed and 1 ml of 1×Hoechst solution was added and incubated at room temperature in the dark for 10 minutes; after aspirating the 1×Hoechst solution, the cells were washed with PBS three times, each time for 5 minutes; the cells were detected with a fluorescent inverted microscope; and the images were analyzed with the software Image J.

[0084] Plate cloning experiment: Use trypsin to digest the well-growing cells in a 37°C cell incubator, and quickly blow away the adherent cells with a gun; after adding 2 ml of fresh culture medium, use a gun to gently blow away the cells and mix them, try to make the cells in a single state, and centrifuge at 1000g for 3 minutes; discard the supernatant, add 1 ml of fresh culture medium and mix them, take 10 μl of the cell suspension and dilute it with culture medium, then take 10 μl to flush one side of the abalone counting plate and count under a microscope; prepare a six-well plate in advance, add 2 ml of fresh culture medium to each well, and six wells. 1500 cells were inoculated into each well of the well plate, and the lentivirus solution was added and marked; the cell growth was observed every day, and after the cells grew for 10-15 days, the culture medium was removed, and 1 ml of 4% paraformaldehyde was added from the edge of the six-well plate to fix for 10 minutes; the 4% paraformaldehyde fixative was removed, and the cells were gently washed twice with PBS liquid; 1 ml of crystal violet solution was added to each well and incubated at room temperature for 20 minutes; the crystal violet solution was removed, and the cells were washed three times with PBS solution, the washing solution was removed, and the cells were inverted on filter paper to dry; pictures were collected, saved and counted.

[0085] 2.5 Animal experiments

[0086] Using the nude mouse tumor formation experiment, the knockdown liver cancer cells were subjected to a nude mouse subcutaneous tumor formation experiment to clarify whether the knockdown of IRX3 inhibits the occurrence of tumors.

[0087] (1) Inoculation of nude mice with liver cancer cells 1) Digest the Huh-7 cells infected with lentivirus in good growth state, transfer them into a screw-cap tube after digestion, and centrifuge at 1000g for 3 minutes; 2) Discard the supernatant, add 1ml of fresh culture medium and mix well, and count under a microscope after dilution; 3) Prepare alcohol cotton balls, syringes, tweezers, etc.; 4) Subcutaneously inoculate nude mice in a clean bench, with 3×10^6 cells inoculated per mouse, mark and record, and continue to feed after inoculation; 5) Observe the growth status and tumor size of nude mice every week; (2) Obtain tumor tissue from nude mice 1) 14 days after inoculation, anesthetize and kill the nude mice to obtain tumor tissue; 2) Collect tumor tissue pictures and measure tumor tissue volume and weight; 3) Some tissues are fixed with formaldehyde and stored in a 4℃ refrigerator, and the rest are stored in a -80℃ refrigerator.

[0088] 3 Results

[0089] 3.1 IRX3 is highly expressed in liver cancer tissues

[0090] (1) By analyzing the HCC data in the TCGA database (including 371 liver cancer tissues and 50 normal or adjacent tissues), we found that IRX3 was significantly overexpressed in liver cancer tissues ( Figure 1 A). Kaplan-Meier survival curve showed that the higher the IRX3 expression, the shorter the patient's survival time (P=0.041) ( Figure 1 B). Further research found that as liver cancer progressed, the expression of IRX3 became higher and higher (*P<0.05) ( Figure 1 C), indicating that IRX3 is highly expressed in HCC and positively correlated with the malignancy of HCC.

[0091] (2) Then, a certain number of paired liver cancer tissue and adjacent normal tissue samples were collected, and qRT-PCR was used to perform PCR amplification with specific primers to detect the RNA level of IRX3 in liver cancer tissue and adjacent normal tissue. The experimental results are shown in Figure 2 A. The results showed that the RNA expression of IRX3 was significantly upregulated in liver cancer tissues compared with the corresponding non-tumor tissue samples.

[0092] (3) Using the Western blot method, RIPA buffer was used to extract liver cancer tissue proteins. The protein extract was subjected to immunoblotting using a specific IRX3 primary antibody. The HRP-conjugated secondary antibody and chemiluminescence system were used to detect the protein expression of IRX3 in liver cancer tissue. The experimental results are shown in Figure 2 B. The results showed that IRX3 was significantly upregulated in HCC tissues compared with the corresponding non-tumor tissue samples.

[0093] 3.2 Downregulation of IRX3 expression inhibits the proliferation of liver cancer cells in in vitro cell experiments

[0094] The above analysis showed that IRX3 expression in liver cancer tissues increased significantly and was associated with the malignant progression of liver cancer. This part explored the biological function of IRX3 in HCC through in vitro cell culture experiments and verified the in vitro experiments with nude mouse subcutaneous tumor bearing experiments.

[0095] To clarify the proliferation effect of IRX3, it is necessary to first establish a cell line, then use the constructed liver cancer cell model, and finally use the nude mouse tumor formation experiment to test the model. Cell line construction requires specific knockdown or overexpression of IRX3 in HepG2 and Huh7 cells.

[0096] The results are as follows Figure 3 As shown in the figure, specific knockdown of IRX3 can significantly reduce the proliferation ability of hepatocellular carcinoma cells. Since IRX3 is a high-risk gene for hepatocellular carcinoma, in order to study the relationship between IRX3 and hepatocellular carcinoma, we selected two liver tumor cell lines HepG2 and Huh7 as cell models. By transfecting short hairpin RNA plasmids specific to IRX3 mRNA and screening with Puromycin antibiotics, we obtained the corresponding shIRX3 stable transfected cell lines, and detected its knockdown efficiency by RT-qPCR and Western Blot ( Figure 3 AB), β-actin was used as the internal reference. It can be seen that we successfully constructed HepG2 and Huh7 cell lines with stable knockdown of shIRX3.

[0097] The cell growth was detected by CCK-8 assay. Figure 3 As shown in D and F, compared with shctrl, the growth rate of the shIRX3 group slowed down after 48 h, and there was a significant difference in cell growth at 120 h (****P<0.001), indicating that downregulation of IRX3 expression inhibited the proliferation activity of HCC.

[0098] EdU assay to detect cell proliferation results Figure 3 As shown in C and E, the DNA synthesis rate of liver cancer cells after downregulation of IRX3 expression was significantly lower than that of control cells (**P<0.01).

[0099] The results of the plate cloning experiment showed that the number of clones in the shIRX3 group of liver cancer cells was reduced compared with that in the control group (****P<0.001), indicating that the clone formation ability and proliferation activity of cells were inhibited after the downregulation of IRX3 expression ( Figure 3 G).

[0100] 3.3 IRX3 overexpression promotes liver cancer cell proliferation in in vitro cell experiments

[0101] The sequence information of IRX3 was obtained through NCBI and cloned into the corresponding plasmid vector. The target plasmid was transfected into hepatocellular carcinoma HepG2 or Huh7 by transfection. HepG2 or Huh7 cell lines overexpressing IRX3 were constructed in vitro, and the expression level of IRX3 was identified. CCK8, EdU, and clone formation experiments were performed using the constructed hepatocellular carcinoma cell model to compare the proliferation ability of the treated cells. The experimental results are shown in Figure 2. Figure 4 As shown in AE, it is shown that up-regulated IRX3 expression can promote the cell cloning ability and proliferation vitality, and further related mechanism research is carried out to apply the method of IRX3 promoting the proliferation of hepatocellular carcinoma cells in the field of adjuvant treatment of liver cancer.

[0102] 3.4 In vivo experiments verified that downregulation of IRX3 expression inhibited the proliferation of liver cancer cells

[0103] To further verify whether IRX3 plays a similar role in vivo as in in vitro cell experiments, we established a nude mouse subcutaneous tumor model to verify the effect of IRX3 on the proliferation of HCC cells in vivo. First, we subcutaneously injected HuH-7 cells that downregulated IRX3 expression based on lentiviral infection into nude mice and successfully established a nude mouse subcutaneous tumor model. Two weeks after the model was established, we killed the nude mice and took the tumor tissue to measure its volume and weight. The results are as follows: Figure 5 As shown in A, B, and C, the volume and weight of tumor tissue in the IRX3 knockdown group were significantly smaller than those in the control group (**P<0.01). The Ki67 staining results of nude mouse tumor tissue also showed that the proliferation ability of liver cancer cells was weakened after IRX3 knockdown ( Figure 5 D). In conclusion, the above results indicate that downregulating IRX3 expression level inhibits HCC proliferation.

[0104] 3.5 Knockdown of IRX3 leads to downregulation of F2-like trypsin receptor 1 (F2RL1) expression, and overexpression of F2RL1 partially compensates for the reduced proliferation of hepatocellular carcinoma cells caused by IRX3 knockdown

[0105] In order to further explore the mechanism of IRX3 promoting the proliferation of liver cancer cells, we consulted the literature and performed transcriptomic sequencing on HepG2 cells treated with shIRX3 and found that knocking down IRX3 led to downregulation of F2-like trypsin receptor 1 F2RL1 expression ( Figure 6 A), and RT-qPCR was used to further verify their interaction ( Figure 6B). We further constructed a stable transfection system of F2RL1 overexpression in HepG2 cells by packaging with lentivirus 293T, and then infected the stable transfection cells with IRX3 knockdown lentivirus. We used CCK-8 assay, EdU infiltration kit and clone formation assay to detect the proliferation ability of HCC cells. The results showed that F2RL1 overexpression could partially compensate for the decrease in cell proliferation caused by IRX3 knockdown ( Figure 6 C, D, E). Preliminary determination of the possible pathways by which IRX3 affects cell proliferation in liver cancer cells.

Claims

1. Use of a reagent for detecting the expression of the biomarker Iroquois homeobox family gene IRX3 in the preparation of a product for auxiliary diagnosis, diagnosis or prognosis of liver cancer subjects.

2. The use according to claim 1, characterized in that: The diagnostic method comprises: obtaining a test sample from a subject suspected of having liver cancer, determining the expression level of IRX3 in the test sample, and if IRX3 is highly expressed compared to a normal control, it indicates that the subject is a high-risk group for liver cancer or a liver cancer patient.

3. The use according to claim 1, characterized in that: The prognosis method comprises: obtaining a test sample from a subject suffering from liver cancer, and determining the expression level of IRX3 in the test sample. High expression of IRX3 indicates a poor prognosis for the patient. The higher the expression of IRX3, the shorter the survival time of the patient.

4. Application of IRX3 as a target in screening drugs for the treatment of liver cancer.

5. The use according to claim 4, characterized in that: The drug inhibits the expression of IRX3, thereby inhibiting the viability, proliferation, invasion and migration of liver cancer cells.

6. Application of IRX3 expression inhibitors in the preparation of drugs for the treatment of liver cancer.

7. The use according to claim 6, characterized in that: The expression inhibitors include nucleic acid molecules, proteins, and compounds.

8. The use according to claim 7, characterized in that: The nucleic acid molecules include siRNA and shRNA.

9. The use according to claim 8, characterized in that: The shRNA is shIRX3-1 or shIRX3-2; The sense strand sequence of shIRX3-1 is: CCGGGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCGCTTTTT G; The antisense sequence of shIRX3-1 is: AATTCAAAAAGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCG C; The sense strand sequence of shIRX3-2 is: CCGGGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCTCTTTTT G; The antisense sequence of shIRX3-2 is: AATTCAAAAAGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCT C.

10. The use according to any one of claims 1 to 9, characterized in that: The liver cancer is hepatocellular carcinoma.

Images