A plant expression method for type III human collagen, an intron-containing coding gene and its application

Abstract

The present invention provides a plant expression method of type III human collagen, an intron-containing coding gene and its application. The method comprises: step A: adding intron fragments to 16 gene fragments of collagen to construct the collagen COL3A1 gene; step B: connecting and synthesizing, and at the same time, achieving type III human collagen targeting to the apoplast by adding a signal peptide to achieve extracellular expression of type III human collagen; step C: transgenic expression of collagen; step D: culturing and purifying the best expressing plant seeds in step C. The present invention expresses type III human collagen in the apoplast, simplifies the purification steps, reduces costs, and the optimization of adding introns significantly enhances the stability of collagen expression.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical recombinant proteins, and specifically relates to a plant-derived recombinant type III collagen, and in particular to a plant expression method of type III human collagen, an intron-containing coding gene and an application thereof. Background Art

[0002] Collagen has high tensile strength, biodegradability, low antigenic activity, low irritation and low toxicity, as well as properties that promote cell growth, cell adhesion and coordinate new cell reconstruction. At present, it is used in dressings, artificial regenerative organs, tissue engineering, skin care and other fields. Collagen can be divided into traditional animal extraction methods and collagen recombinant methods, depending on the different sources. With the development of human civilization, environmental pollution on land has become more and more serious, and serious infectious diseases such as mad cow disease, avian influenza and foot-and-mouth disease have gradually emerged. Therefore, collagen products made from terrestrial animals have huge potential safety risks. Compared with natural collagen extracted from animal tissues, recombinant collagen has better control capabilities (such as water solubility and emulsification) and better controls the risk of pathogen transmission. Recombinant collagen can be divided into plant-derived collagen, animal-derived collagen, yeast collagen, Escherichia coli collagen, and insect baculovirus collagen according to its source. With the proposal of the national dual-carbon policy, plant-derived collagen has attracted attention from all walks of life with its advantages of being cheaper and more environmentally friendly.

[0003] In genome-wide analyses, mRNA stability was positively correlated with the number of introns in human, mouse, and Arabidopsis genes. Insertion of introns into cDNA constructs containing instability determinants increased their stability in human cells. Introns can also enhance 3′ end processing and polyadenylation of the initial RNA transcript. This effect is mediated by the splicing regulator polypyrimidine tract binding protein (PTB) and leads to a significant increase in the half-life of the affected transcripts. In addition, U1 snRNA binding to the 5′ SS inhibits premature cleavage and polyadenylation and determines mRNA length, which may also affect transcript stability.

[0004] At present, the expression system of recombinant collagen is mainly based on E. coli and yeast. Although the recombinant collagen produced by E. coli and yeast has high yield, most of them do not have a triple helix structure and cannot be used for medical beauty and filling. The animal and insect expression systems have low yields and high costs. Using plants to produce high-yield recombinant human collagen with a triple helix structure is in line with the national "dual carbon" strategy and has significant advantages.

[0005] Researchers have long reported on the expression of collagen in plants. CollPlant, an Israeli regenerative medicine company, has successfully expressed the type I collagen α1 chain, α2 chain genes, prolyl 4-hydroxylase (P4H) gene, and lysyl hydroxylase (PLOD3) gene in plant vacuoles. However, its technology lacks the optimization of adding introns, and the separation and purification of intracellular expression is complex and costly. Although plant-derived collagen technology can express a complete triple helix structure, compared with other expression systems, plant-derived expressed collagen still has the defects of low content and difficult purification. Summary of the invention

[0006] Based on this, it is necessary to provide a plant expression method of type III human collagen, a coding gene containing introns and its application.

[0007] A type III human collagen, the nucleotide sequence of which is shown as SEQ ID NO.1.

[0008] Correspondingly, the present invention also provides a gene COL3A1 encoding type III human collagen.

[0009] Preferably, the intron fragments of the type III human collagen: intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 15, and the nucleotide sequences of intron 15 are shown in SEQ ID NOs. 8-22, respectively.

[0010] Preferably, an expression cassette of type III human collagen includes: COL3A1 gene, prolyl 4-hydroxylase β subunit gene, prolyl 4-hydroxylase α subunit gene, PLOD3 gene, collagen N-terminase gene, and collagen C-terminase gene.

[0011] Preferably, the present invention also provides a method for expressing type III human collagen transgene, comprising the following steps:

[0012] Step A: adding intron fragments intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 15, and intron 15 to 16 gene fragments of collagen COL3A1 to construct the collagen COL3A1 gene;

[0013] Step B: connecting and synthesizing the prolyl 4-hydroxylase β subunit gene, the prolyl 4-hydroxylase α subunit gene, the PLOD3 gene, the collagen N-terminase gene, the collagen C-terminase gene, and the COL3A1 gene, and at the same time, by adding a signal peptide to the constructed gene, the type III collagen is targeted to the apoplast to achieve the extracellular expression of type III human collagen;

[0014] Step C: transgenic expression of type III human collagen;

[0015] Step D: Cultivate and purify the seeds of the plant with the best expression in step C.

[0016] Preferably, in step B, the signal peptide targeting the extracellular plastid is potato PinII signal peptide, and its nucleotide sequence is shown in SEQ ID NO.7.

[0017] Preferably, in step B, the primers of the type III human collagen carrier are Coll forward primer and Coll reverse primer, and the Coll forward primer and Coll reverse primer are respectively:

[0018] Coll forward primer: CTGGACCTAGAGGACAACCT

[0019] Coll reverse primer: CTCTATCTCCAGACTTTCCAG.

[0020] The present invention also provides application of the type III human collagen in skin repair.

[0021] The beneficial effects of the present invention are as follows:

[0022] The present invention increases the mRNA stability by adding multiple introns and signal peptides to express the type III human collagen gene in the apoplast, thereby increasing the expression amount of plant-derived type III human collagen and reducing the risk of purifying collagen.

[0023] The present invention expresses type III human collagen in the apoplast, simplifies the purification steps, reduces the cost, and adds intron optimization to significantly enhance the stability of collagen expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is a diagram of the connection mode of related genes, which is used to reveal the specific connection mode of related genes.

[0025] Figure 2 The figures are PCR identification diagrams of transformants, wherein a shows the PCR identification diagram of pYLTAC380H-nTU transformation, and b shows the PCR identification diagram of pYLTAC380H-iTU transformation.

[0026] Figure 3 This is a growth diagram of transgenic tobacco, wherein part A represents tobacco seedlings transformed with the pYLTAC380H-iTU vector, and part B represents tobacco seedlings transformed with the pYLTAC380H-nTU vector.

[0027] Figure 4 Comparison of leaf bands of transgenic plants, where part A represents leaves transformed with the pYLTAC380H-iTU vector, part B represents tobacco leaves transformed with the pYLTAC380H-nTU vector, part P represents wild-type leaves, and T0 represents the first generation of transgenic plants.

[0028] Figure 5 It is a growth diagram of transgenic seeds, wherein part A represents the offspring of tobacco transformed with the pYLTAC380H-iTU vector, and part B represents the offspring of tobacco transformed with the pYLTAC380H-nTU vector.

[0029] Figure 6 It is a protein blotting image of type III human collagen, wherein part A represents leaves transformed with pYLTAC380H-iTU vector, part B represents tobacco leaves transformed with pYLTAC380H-nTU vector, and T1 represents the first generation of transgenic plants.

[0030] Figure 7 It is a collagen activity test, wherein part A is the collagen cell activity test produced by the present invention, and part B is the collagen cell activity test produced by a foreign company.

[0031] Figure 8 It is a collagen skin effect test, wherein part A is the skin effect test of the collagen produced by the present invention, and part B is the skin effect test of physiological saline. DETAILED DESCRIPTION

[0032] Example 1: Construction of plant-derived human type III collagen expression frame

[0033] The specific construction idea of ​​type III human collagen containing introns is to add the intron fragments intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 15, intron 15 (SEQ ID NO: 8-22) to the type III human collagen gene COL3A1 through the intron insertion site GU-AG rule (i.e., insert an intron into the GU-AG site within an average of 400bp. If there is no GU-AG site within 400bp, other base sites can be replaced with GU-AG sites through the base complementarity principle) to build the type III human collagen COL3A1 gene. Similarly, the construction of the type III human collagen NCOL3A1 gene without introns is completed.

[0034] The prolyl 4-hydroxylase β subunit (P4H-β) gene, the prolyl 4-hydroxylase α subunit (P4H-α) gene, the PLOD3 gene, the collagen N-terminase gene (ADAMTS2), the collagen C-terminase gene (BMP1), and the COL3A1 gene were connected and synthesized. The specific connection method is shown in Figure 1 .

[0035] Table 1 Description of related genes

[0036] name Amino Acids Abbreviation SEQ ID NO code Collagen α1(III) chain (including introns) 2095 COL3A1 1 Prolyl 4-hydroxylase β subunit 534 Mouse P4H β 2 Prolyl 4-hydroxylase alpha subunit 572 Mouse P4Hα 3 Procollagen III C-proteinase 986 Proteinase C 4 Procollagen III N-proteinase 1211 Proteinase N 5 Lysyl hydroxylase 767 Pig PLOD3 6 Collagen α1(III) chain (without introns) 2095 NCOL3A1 23

[0037] Among them, the prolyl 4-hydroxylase (P4H) enzyme in Table 1 refers to mouse prolyl 4-hydroxylase (P4H) enzyme, and the lysyl hydroxylase (PLOD3) refers to porcine lysyl hydroxylase. The human procollagen C-proteinase synthetic sequence and the human procollagen N-proteinase synthetic sequence correspond to the procollagen III C-proteinase and the procollagen III N-proteinase in Table 1, respectively.

[0038] At the same time, the related genes successfully achieved the targeting of type III human collagen (including introns and excluding introns) to the apoplast by adding signal peptide genes at the front end, and achieved the extracellular expression of type III human collagen (including introns and excluding introns). The constructed vectors were named pYLTAC380H-iTU (including introns) and pYLTAC380H-nTU (excluding introns).

[0039] The signal peptide selected for targeting the extracellular plastid is potato PinII signal peptide SEQ ID NO.7 for plasmid construction.

[0040] The plant-derived type III human collagen carrier (containing introns and excluding introns) was identified by PCR using primers designed to amplify a 2000 bp fragment of type III human collagen containing introns and a 1400 bp fragment without introns (Table 2). Figure 2 The PCR identification results are illustrated as follows: 1 μL of Coll forward primer, 1 μL of Coll reverse primer, 3 μL of identification vector, 5 μL of Taq amplification enzyme, and ddH2O to make up to 10 μL.

[0041] Table 2 PCR identification primers

[0042] Coll forward primer: CTGGACCTAGAGGACAACCT (as shown in SEQ ID No.24) Coll reverse primer: CTCTATCTCCAGACTTTCCAG (as shown in SEQ ID No.25)

[0043] Example 2: Transgenic expression of plant-derived human type III collagen

[0044] The transgenic expression of human type III collagen was achieved by infecting tobacco seeds with Agrobacterium tumefaciens.

[0045] Seeds: Select tobacco seeds of Xiangyan No. 7 with smooth skin and no disease spots.

[0046] Matrix: Select Xiangzheng Agricultural Science Seedling Matrix.

[0047] Nutrient solution: Use Hoagland culture medium.

[0048] Agrobacterium: Dilute the LB solid medium with Rif (rifampicin) (dilution factor 1 / 2000) and spread the Agrobacterium with the target vectors pYLTAC380H-iTU and pYLTAC380H-nTU, and culture in a 28℃ constant temperature incubator in the dark (1-2 days). Pick the single colony with the best growth to transfer to 3 mL LB liquid medium (with Rif antibiotics), and culture at 28℃ and 220rpm for 1 day. Transfer the bacterial liquid to a 2L conical flask (200mL culture medium), and culture at 28℃ and 180r for 1 day (diluted 100 times, OD600>0.5).

[0049] Transfection: Agrobacterium containing vectors pYLTAC380H-iTU and pYLTAC380H-nTU was used to transform tobacco using the leaf disc method to regenerate the tobacco and obtain transgenic seedlings (T0). It can be seen that the tobacco grew well, indicating that the transgenic method did not affect the growth of tobacco ( Figure 3). For the method, please refer to the literature: STEIN H, WILENSKY M, TSAFRIR Y, et al. Production of Bioactive, Post-Translationally Modified, Heterotrimeric, Human Recombinant Type-I Collagen in Transgenic Tobacco [J]. Biomacromolecules, 2009, 10(9): 2640-5. Cut an appropriate amount of leaves from the positive tobacco seedlings, cut the leaves of both into pieces and put them into 1.5 ml centrifuge tubes respectively, use a stick to poke the leaves down, add 500 μL of protein extract to the two centrifuge tubes, put them on ice, and ice bath for 10 minutes. Then, pass the two centrifuge tubes through a 4℃ high-speed centrifuge at a speed of 15000g for 10 minutes to obtain two supernatants expressing type III collagen proteins. Take 5 μL of the supernatant of the pYLTAC380H-iTU vector transgenic plants and the pYLTAC380H-nTU transgenic plants, add 30 μL of protein loading buffer, and heat in a metal bath at 100°C for 5 min; then immediately put the heated samples on ice to cool; and perform the standard WB experiment. Figure 4 ) confirmed that the leaves of transgenic crops with both vectors expressed type III human collagen, but the content of type III human collagen expressed by pYLTAC380H-iTU transgenic plants was higher than that expressed by pYLTAC380H-nTU transgenic plants, and the expression molecular weight was 130 kDa, which was in line with the expected expression level. WB experiments verified that transgenic tobacco with both vectors was obtained.

[0050] Subculture: The identified transgenic tobacco containing vectors pYLTAC380H-nTU and pYLTAC380H-iTU were cultured on MS medium, subcultured every 3-4 weeks, and the culture condition was 25°C. After hardening, some transgenic seedlings and control seedlings were transplanted into a substrate with a volume ratio of peat: vermiculite of 1:1, cultivated in a greenhouse, and harvested in bags.

[0051] Seed sowing; mix the seedling medium with moisture according to the volume ratio of nutrient solution to soil of 1:6, preferably to squeeze out water, put the moistened medium soil into the foam board, and gently shake the foam board to compact the soil. Use a straw to absorb the seeds and sow them into the medium, 2-3 seeds per grid. Add nutrient solution to the tray in advance, which is two-thirds of the volume of the tray, and put the foam board with moistened medium soil into the tray. Cultivate the transgenic seeds for 14 days under the conditions of ambient temperature of 25℃, humidity of 80%, 16 h light / 8 h dark, color temperature of 6500 K, and light intensity of 200 candela, so that they grow seedlings (T1) with good growth status.

[0052] Expression verification of T1 transgenic plants: (1) Prepare 1 L of 10×PBS buffer and dilute it to 10 L with water to obtain 1×PBS buffer; (2) Weigh 2 g of leaves with expression-type tobacco transformants and add 1×PBS buffer to form a preliminary extract; (3) Centrifuge the preliminary extract in a 0.5 MPa freeze-drying centrifuge and use a water spinner to dry the water on the surface of the leaves, and collect the crude apoplast solution (Tris-HCl (pH7.5) 50 mM, NaCl 150 mM, NP40 0.1%, Urea 4 M, PMSF 1 mM); (4) Collect the crude apoplast solution and place it on ice, and add 2% volume 0.5 M EDTA (final concentration 10 mM pH8.0). (5) Centrifuge at 10,000 r / min and 4 °C for 25 min, and retain the supernatant; (6) Add glycerol to the supernatant and mix until the glycerol concentration is 10%, and store at -80 °C. (7) Load 20 μL of the supernatant onto a 10% polyacrylamide gel and test with monoclonal anti-collagen, type III mouse antibody (C7805 from Sigma-Aldrich Inc.) and goat anti-mouse secondary antibody (HS201 from Quanshijin Co., Ltd.) in a standard protein blotting procedure. Figure 6 ), the positive control band of 500ng type III collagen from human placenta (#CC054 from Chemicon Inc.) represents about 5% of the total soluble protein in the sample from the transgenic plant (about 500mg / kg fresh leaves). At the same time, it can be confirmed by Western blotting that the T1-4 plants of the pYLTAC380H-iTU gene plant express the highest content of type III human collagen (molecular size is 130kDa); while the wild type does not express collagen. This shows that the primary transgenic containing intron III human collagen expression can achieve the highest expression level. At the same time, it can be found that the expression level of type III human collagen in pYLTAC380H-iTU transgenic plants is much greater than that in pYLTAC380H-nTU transgenic plants, indicating that the addition of introns can indeed increase the expression level of type III human collagen to a certain extent.

[0053] Finally, the plant with the best expression of type III human collagen (pYLTAC380-iTU-T1-i4) was selected for artificial pollination to preserve the excellent variety.

[0054] Example 3: Extraction and purification of transgenic collagen

[0055] The seeds of the best expressing plant (pYLTAC380-iTU-T1-i4) were cultured to obtain mature tobacco leaves, which were purified. The purification steps are as follows:

[0056] Crude extract extraction: Tobacco leaves (1 kg) were mixed in chilled extraction buffer (1800 mL 100 mM Tris-HCl, pH 7.5, containing 4.5 mM potassium methylsulfite and 7.5 mM EDTA), and 15 g polyvinylpyridone (PVPP) and 6 g activated carbon were added. Mixing was performed in 5 times, 1 min each time, while the temperature was kept below 15 °C. The crude extract was filtered through a gauze pad and centrifuged for 30 min, 26000g, 5 °C. The supernatant was collected and CaCl2 was added to a final concentration of 10 mM and activated carbon concentration was 1 g / L. 5 mg / L of ficin (Sigma #F4125; 15 °C, stirring for 3 h) was added. Insoluble contaminants were then removed by centrifugation (30 min, 22000g, 15 °C). Type III human collagen in the recovered supernatant was gradually added to crystalline NaCl and precipitated to a final concentration of 3.13 M (25 min, rt, continuous stirring). The solution was incubated in a refrigerator without stirring for 8 h. The pellet containing type III human collagen (rhCOL III) was collected after centrifugation (26,000 g, 2 h, 5 °C).

[0057] The microspheres were resuspended in 200 mL of 250 mM acetic acid + 2 m NaCl solution, magnetically stirred for 5 min, and then centrifuged (26000 g, 40 min, 5°C). The supernatant was discarded and the microspheres were resuspended in 200 mL of 0.5 M acetic acid (1 h, rt).

[0058] Insoluble material was removed by centrifugation (16000 g, 30 min, 15°C). The supernatant was passed through 12 gauze pads. NaCl was slowly added to a final concentration of 3 M at room temperature with continuous stirring for 20 min to precipitate rhCOL III.

[0059] The solution was incubated (8 h, ON, 4°C) and rhCOL III was collected after centrifugation (26000g, 2 h, 5°C). All traces of supernatant were removed. The pellet resolubilization and rhCOL III precipitation steps were repeated in acetic acid and NaCl solutions, respectively.

[0060] Dialysis: After incubation and collection of microspheres containing type III human collagen, the sample was redissolved in 80 mL of 10 mM HCl by vigorous pipetting and rotation at room temperature for 5 min. The solution was transferred to a dialysis bag (MWCO 13000 Da) and dialyzed against 4 L of 10 mM HCl for 4 h at 4°C. Additional dialysis was performed immediately.

[0061] Filtration: Type III human collagen was sterilized by filtration through a 0.2 µm filter using a 30 mL syringe. Type III human collagen was then concentrated using a Vivaspin PES 20 mL filter tube (Vivascience, #VS2041, MWCO 100000). Centrifugation was performed until the volume was reduced to 0.75 mL (45 min, 5000 g, 5°C). The activity of the purified type III human collagen was analyzed as shown in Table 3 below.

[0062] Table 3 Comparison of purified active ingredients

[0063] Amino Acids The present invention A foreign company Human collagen Hydroxyproline 9.86 7.55 10.3 Threonine 1.68 1.86 1.7 Serine 3.32 3.27 3.3 Proline 12.4 15.03 12.0 Glycine 33.2 32.32 33.5 Alanine 10.46 11.36 11.1 Valine 2.53 2.29 2.6 Isoleucine 0.9 0.92 0.9 Leucine 2.43 2.55 2.3 Tyrosine 0.24 0.36 0.2 Phenylalanine 1.33 1.35 1.2 Hydroxylysine 0.87 0.74 1.0 Lysine 2.54 2.85 2.3 Histidine 0.64 0.31 0.6 Arginine 4.80 4.81 5.0 Cysteine ND ND ND Methionine 0.57 ND 0.6 Tryptophan ND ND ND Asp+Asn 4.56 4.78 4.3 Glu+Gln 7.18 7.64 7.1

[0064] Comparing the activity of the purified collagen with that produced by a foreign company and human collagen, it can be seen that the amino acid composition of the collagen purified by the present invention is closer to the amino acid composition of human collagen than that of a foreign company, indicating that the collagen produced by the present invention has higher activity, is more conducive to human absorption, and has better application prospects.

[0065] The newly isolated cells were inoculated on an uncoated plate or a plate coated with 200 μg / mL of the recombinant type III human collagen of the present invention or collagen from a foreign company ( Figure 7 ). After 7 days of culture, the cells were counted. The results of the two donors showed that the collagen of the present invention was more conducive to cell growth than the collagen of a foreign company.

[0066] Example 4: Application of collagen in skin repair

[0067] Fourteen male rats were selected as research subjects, of which male rats were 200 weeks old and weighed 250±22g for in vivo studies. All rats were housed in an animal laboratory facility (24-50°C, 12% humidity) under a 7-hour light / dark cycle for 7 days to adapt to the environment before injection. At the same time, lyophilized rhCol III was easily dissolved in sterile saline to obtain the required concentration of rhCol III solution (2.0mg / mL) before injection, and sterile saline (0.9%) was used as a positive control solution.

[0068] Male rats were divided into two experimental groups: one group of male rats (7 rats) were injected with 1 mL of rhCol III solution (2.0 mg / mL); the other group of male rats (7 rats) were injected with 1 mL of normal saline (0.9%) as a blank control. The skin conditions of the male rats were analyzed after one week.

[0069] According to the reference: CAO Y, YANG JP, ZHU XG, et al. A Comparative In Vivo Study on Three Treatment Approaches to Applying Topical Botulinum Toxin Afor Crow's Feet [J]. BioMed Research International, 2018, 2018: 6235742. The CBS skin analysis system was used for non-invasive assessment of skin conditions. The optical images of the skin were captured under a microscope and further processed into negative films. The principle of the CBS skin analysis system is based on color gradient recognition and texture scanning of the spectrum (445 nm), supplemented by a statistical basis. The CBS skin analysis instrument used in this study was equipped with a magnified skin detector (magnification, 50×), which can effectively detect skin conditions. The three main parameters representing skin conditions, namely skin elasticity, collagen content, and skin oil content, were measured once a week before injection and UV irradiation. Three measurement points evenly distributed on the dorsal skin were selected, and each point was measured 3 times to reduce measurement errors. The average value was calculated based on the measured data, and the difference between the values ​​obtained before and after treatment was used for further statistical analysis.

[0070] Analysis of the skin condition of male rats in the first week after injection showed that ( Figure 8), injection of 1mL type III human collagen solution (2.0 mg / mL) helps improve the skin condition of male rats. After 1 week of culture, skin elasticity increased by 4.5%, collagen content increased by 20.8%, and skin oil content increased by 10.2%; while the skin condition of male rats injected with 1mL normal saline (0.9%) remained basically unchanged, and skin elasticity decreased by 2.3%. This shows that the type III human collagen produced by our company is conducive to skin repair and improves skin performance.

[0071] Industrial Applicability

[0072] By adding the step of adding introns to the type III human collagen gene, it is beneficial to increase the expression content of type III human collagen and reduce the risk of type III human collagen purification. The use of the method of adding introns to collagen can effectively promote the development of my country's plant-derived recombinant collagen medical beauty industry and achieve my country's "dual carbon" tasks. It is for the realization of the wide application of the method of adding introns in plant-derived collagen and provides a practical and effective solution for improving the efficiency of collagen expression.

[0073] Relevant description of this application:

[0074] Intron name, origin and sequence

[0075] Web page http: / / www.cbs.dtu.dk / services / NetGene2 / Intron analysis

[0076] 1. intron rbcS1-1 comes from Chrysanthemum x morifolium ribulose-1,5-bisphosphate carboxylase small subunit gene (GenBank: AY163904.1)

[0077] gtacaatatataacttaaataataacgtgaacacttattataatgcagtagatataatgactaacattttataaaatatatatatag (as shown in SEQ ID No. 26)

[0078] 2. intron E2f5-4: from the 4th intron of E2F5 family transcription factor (GenBank: AC007017.4), with some bases adjusted to make it more consistent with the common sequence of Arabidopsis introns.

[0079] gtaaggatttttatgatatagtatgcttatgtattttgtactgaaagcatatcctgcttcattgggatattactgaaagcatttaactacatgtaaactcacttgatgatcaataaacttgattttgcag (as shown in SEQ ID No. 27)

[0080] 3. intron atbg11, from the 11th intron of Arabidopsis thaliana beta-glucosidase gene (At2g44460) (GenBank: AC004521.3):

[0081] gtaaatcctggtccacacttttacgataaaaacacaagattttaaactatgaactgatcaataatcattcctaaaagaccacacttttgttttgtttctaaagtaatttttactgttataacag (as shown in SEQ ID No. 28)

[0082] 4. intron atatp2, from the second intron of the Arabidopsis thaliana vesicle transfer ATPase gene (GenBank: AL161499.2)

[0083] gtaagaggtcaaaaggtttccgcaatgatccctcttttttgtttctctagtttcaagaatttgggtatatgactaacttctgagtgttccttgatgcatatttgtgatgagacaaatgtttgttctatgttttag (as shown in SEQ ID No. 29)

[0084] 5. Intron Rlk7, from the seventh intron of the Arabidopsis thaliana receptor-like protein kinase gene (GenBank: AC006068.4)

[0085] gtaaagcaactgtgttttaatcaatttcttgtcaggatatatggattataacttaatttttgagaaatctgtagtatttggcgtgaaatgagtttgctttttggtttctcccgtgttatag (as shown in SEQ ID No. 30)

[0086] 6. intron atatp11, from the 11th intron of Arabidopsis thaliana vesicle transfer ATPase gene (GenBank: AL161499.2):

[0087] gtaaagtttccaactttcctttaccatatcaaactaaagttcgaaactttttatttgatcaacttcaaggccacccgatctttctattcctgattaatttgtgatgaatccatattgacttttgatggttacgcag (as shown in SEQ ID No. 31)

[0088] 7. Intron e2f5-8, from the 8th intron of E2F5 family transcription factor (GenBank: AC007017.4), some bases were adjusted to make it more consistent with the common sequence of Arabidopsis introns.

[0089] gtctgtctttcctatttcatatgtttaatcctaggaatttgatcaattgattgtatgtatgtcgatcccaagactttcttgttcacttatatcttaactctctctttgctgtttcttgcag (as shown in SEQ ID No. 32)

[0090] 8. intron atsug1: from the first intron of Arabidopsis thaliana sugar transporter gene (GenBank: AL161501.2):

[0091] gtgagttcctaagttccatttttttgtaatccttcaatgttattttaacttttcagatcaacatcaaaattaggttcaattttcatcaaccaaataatatttttcatgtatatatag (as shown in SEQ ID No. 33)

[0092] 9. intron atbg3, from the third intron of Arabidopsis thaliana beta-glucosidase gene (At2g44460) (GenBank: AC004521.3):

[0093] gtaaaatattggatgccagacgatattctttcttttgatttgtaactttttcctgtcaaggtcgataaattttatttttttggtaaaaggtcgataatttttttttggagccattatgtaattttcctaattaactgaaccaaaattatacaaaccag (as shown in SEQ ID No. 34)

[0094] 10. intron atipl3, from the third intron of Arabidopsis thaliana Ipomoea nil leaf protein gene (AT4g04790) (GenBank: AF118223.2):

[0095] gtaaggacttctcatgaatattagtggcagattagtgttgttaaagtctttggttagataatcgatgcctcctaattgtccatgttttactggttttctacaattaaag (as shown in SEQ ID No. 35)

[0096] 11. Intron psk7-7, from the seventh intron of Petunia hybrid PSK7 gene (GenBank: AJ224165.1), some bases were adjusted to make it more consistent with the common sequence of Arabidopsis introns.

[0097] gtatgtagtgtttttggataactgagtttgcctatgattttgtatttactgagatgtttgtcctctttctgcag (as shown in SEQ ID No. 36)

[0098] 12. intron atgt4, from the fourth intron of Arabidopsis thaliana glucosyltransferase (At2g35650) gene (GenBank: AC006068.4):

[0099] gtaacattccttagttacctttcttttctttttccatcataagtttatagattgtacatgctttgagatttttctttgcaaacaatctcag (as shown in SEQ ID No. 37)

[0100] 13. intron atcdpk4-3: from the third intron of Arabidopsis thaliana calmodulin-domainprotein kinase CDPK isoform 4 (AT4g09570) gene (GenBank: AL161831.1):

[0101] gtaagttgttactttatgattgttttcctctctgctacatgtattttgttgttcatttctgtaagatataagaattgagttttcctctgatgatattattag (as shown in SEQ ID No. 38)

[0102] 14. intron attog11: from the 11th intron of Arabidopsis thaliana similar to ch-TOG proteinfrom Homo sapiens (At2g35630) gene (GenBank: AC006068.4):

[0103] gttagtatcatatgaagaaatacctagtttcagttgatgaatgctattttctgacctcagttgttctcttttgagaattatttcttttctaatttgcctgatttttctattaattcattag (as shown in SEQ ID No. 39)

[0104] 15. intron rccat1: from Ricinus communis (castor bean) CAT1 geneencoding catalase (GenBank: AB489142.1):

[0105] Gtaaatttctagttttctccttcattttcttggttaggacccttttctcttttatttttttgagctttgatctttctttaaactgatctatttttaattgattggttatggtgtaaatattacatagctttaactgataatctgattactttatttcgtgtgtctatgatgatgatgatagttacag (as in SEQ ID No.40).

[0106] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A gene encoding type III human collagen, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The gene according to claim 1, characterized in that It contains intron fragments whose nucleotide sequences are respectively shown as SEQ ID NO.8-22: intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15.

3. A transgenic expression cassette for type III human collagen, characterized in that: The invention comprises the gene as claimed in claim 1, a prolyl 4-hydroxylase β subunit gene, a prolyl 4-hydroxylase α subunit gene, a PLOD3 gene, a collagen N-terminase gene, and a collagen C-terminase gene.

4. A method for transgenic expression of type III human collagen, characterized in that: The steps include: Step A: adding intron fragments intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, and intron 15 whose nucleotide sequences are respectively shown in SEQ ID NO.8-22 to 16 fragments of the collagen COL3A1 gene, and simultaneously achieving extracellular expression of type III human collagen by adding a signal peptide targeting the apoplast, to obtain a gene encoding type III human collagen whose nucleotide sequence is shown in SEQ ID NO.1; Step B: ligating and synthesizing the prolyl 4-hydroxylase β subunit gene, the prolyl 4-hydroxylase α subunit gene, the PLOD3 gene, the collagen N-terminase gene, the collagen C-terminase gene, and the COL3A1 gene to obtain a type III human collagen expression vector; Step C: Infect tobacco seeds with Agrobacterium to achieve transgenic expression of type III human collagen; Step D: Cultivate and purify the plant seeds expressing type III human collagen in step C.

5. The expression method according to claim 4, characterized in that In the step A, the signal peptide targeting the apoplast is the potato PinII signal peptide, and the nucleotide sequence encoding the signal peptide is shown in SEQ ID NO.

7.

6. The expression method according to claim 4, characterized in that: In the step B, the type III human collagen expression vector is identified using Coll forward primer and Coll reverse primer, wherein the Coll forward primer and Coll reverse primer are: Coll forward primer: CTGGACCTAGAGGACAACCT, Coll reverse primer: CTCTATCTCCAGACTTTCCAG.

Images