The invention relates to a multiple myeloma chromosome translocation t (1; 22) detection reagent and application thereof

Abstract

The invention provides a multiple myeloma chromosome translocation t (1; 22) and application thereof, and belongs to the technical field of disease diagnosis. According to the invention, a novel chromosome translocation is obtained through identification by using a bioinformatics technology, and specifically, an upstream sequence formed by breaking a chromosome 22 at a 39280931 site is reconnected with a downstream sequence formed by breaking a chromosome 1 at a 178385884 site. The enhancer of the chromosome 1 is translocated to the vicinity of the dyed APOBEC3A gene 22 to cause up-regulated expression of potential cancer genes of the APOBEC3A. Thus, the multiple myeloma patient's chromosomal translocation t (1; 22) can be used as a novel detection target in multiple myeloma molecular typing, and can be used for disease diagnosis and prognosis evaluation.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a detection reagent for multiple myeloma chromosome translocation t(1;22) and application thereof. Background Art

[0002] Chromosomal translocation is one of the important molecular genetic changes in malignant tumors. On the one hand, chromosomal translocation can cause abnormal expression of oncogenes; on the other hand, after chromosomal translocation, adjacent genes fuse and express related products, which can lead to changes in biological behaviors such as cell growth and differentiation. Specific translocation or translocation gene products can be used as tumor-specific markers, which is conducive to the diagnosis of tumors.

[0003] Among the molecular genetic changes in the onset of multiple myeloma (MM), t(11;14)(q13;q32) is the most common. This translocation leads to upregulation of cyclin D1 gene expression, which binds to CDK4 or CDK6, leading to phosphorylation of Rb protein, promoting the transition of cells from G1 phase to S phase, promoting the malignant transformation of cells, and leading to decreased expression of cell adhesion molecules (CAM). In MM, chromosomal translocation usually involves IgH. The enhancer in IgH is translocated to the upstream of certain oncogenes. For example, t(6;14)(p21;q32) translocation upregulates cyclin D3 expression. The role and mechanism of cyclin D3 in regulating cell division are the same as those of cyclin D1 protein. Chromosomal translocation produces some new fusion genes or upregulates the expression of certain proteins. The expression of these fusion genes or proteins not only reflects the molecular mechanism of the pathogenesis of malignant tumors, but also has important value for the diagnosis and typing of multiple myeloma.

[0004] At present, with the improvement of medical level, more and more chromosomal translocation types have been reported, and the types of chromosomal translocations in malignant tumors are constantly supplemented, which is very helpful for the determination of molecular typing of related tumors and the formulation of targeted tumor treatment strategies and prognostic measures. Therefore, the development and enrichment of specific chromosomal translocations is of great significance for the diagnosis and clinical treatment of multiple myeloma. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a new type of chromosome translocation t(1;22) for multiple myeloma patients, which not only enriches the types of chromosome translocations, but also provides a reliable detection target for the molecular typing of multiple myeloma patients.

[0006] The present invention provides a chromosomal translocation t(1;22) for multiple myeloma patients, which is formed by reconnecting an upstream sequence obtained by breaking chromosome 22 at site 39280931 and a downstream sequence obtained by breaking chromosome 1 at site 178385884 on the basis of the human genome version GRCh38;

[0007] The upstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO: 1;

[0008] The downstream sequence is a DNA sequence as shown in SEQ ID NO:2.

[0009] Preferably, the upstream sequence on chromosome 22 further comprises the sequence of the APOBEC3A gene promoter; and the downstream sequence on chromosome 1 further comprises the sequence of the enhancer;

[0010] The nucleotide sequence of the enhancer is shown in SEQ ID NO: 3;

[0011] The nucleotide sequence of the APOBEC3A gene promoter is shown in SEQ ID NO:4.

[0012] The present invention provides a reagent for detecting the chromosome translocation t(1;22) of the multiple myeloma patient, including a reagent for detection based on PCR amplification and / or a reagent for detection based on FISH technology.

[0013] Preferably, the PCR-based amplification detection reagent includes primers for amplifying the chromosome translocation t(1;22) of the multiple myeloma patient;

[0014] The primers for amplifying the chromosome translocation t(1;22) of multiple myeloma patients include t122-F1 / t122-R1 and / or t122-F2 / t122-R2;

[0015] The nucleotide sequence of t122-F1 is shown in SEQ ID NO:5;

[0016] The nucleotide sequence of t122-R1 is shown in SEQ ID NO:6;

[0017] The nucleotide sequence of t122-F2 is shown in SEQ ID NO:7;

[0018] The nucleotide sequence of t122-R2 is shown in SEQ ID NO:8.

[0019] Preferably, the FISH-based detection reagents include FISH probes;

[0020] The nucleotide sequences of the FISH probes are shown in SEQ ID NO:9 to SEQ ID NO:30.

[0021] The invention provides a reagent kit for detecting the chromosome translocation t(1;22) of the multiple myeloma patient, comprising the reagent and a reagent used in conjunction with the reagent.

[0022] Preferably, it also includes a reagent for detecting the expression of APOBEC3A gene by qPCR;

[0023] The reagents for qPCR detection of APOBEC3A gene expression are a forward primer with a nucleotide sequence as shown in SEQ ID NO:31 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:32.

[0024] The present invention provides the use of the chromosome translocation t(1;22) of the multiple myeloma patient as a detection target in the preparation of a kit for detecting molecular typing of multiple myeloma.

[0025] The invention provides application of the reagent in preparing a kit for detecting molecular typing of multiple myeloma.

[0026] The present invention provides a chromosomal translocation t(1;22) of a multiple myeloma patient, which is formed by reconnecting an upstream sequence obtained by the break of chromosome 22 at position 39280931 and a downstream sequence obtained by the break of chromosome 1 at position 178385884 on the basis of the human genome version GRCh38, wherein the upstream sequence is a DNA sequence including a nucleotide sequence such as SEQ ID NO: 1; and the downstream sequence is a DNA sequence including a nucleotide sequence such as SEQ ID NO: 2. The present invention uses bioinformatics technology to identify a new type of chromosomal translocation, specifically, the sequence after the break of chromosome 22 at position 127798852 and the sequence after the break of chromosome 1 at position 173708142 are reconnected. The present invention uses PCR amplification and Sanger sequencing to detect the chromosomal translocation, and the results show that the upstream sequence at the reconnection point is completely matched with the sequence of chromosome 22, and the downstream sequence at the reconnection point is completely matched with the sequence of chromosome 1, proving the occurrence of the above chromosomal translocation. Bioinformatics analysis shows that the reconnection point occurs near the APOBEC3A gene stained on chromosome 22 and near the enhancer of chromosome 1. Therefore, in order to verify that the chromosome translocation t(1;22) causes up-regulated expression of potential oncogenes, the present invention uses real-time fluorescence quantitative PCR to detect the expression level of the potential oncogene APOBEC3A. The results show that compared with the control GM12878 cells, the expression of the APOBEC3A gene in multiple myeloma patient cells is significantly upregulated, indicating that the enhancer translocation in chromosome 1 increases the expression of the APOBEC3A gene in chromosome 22, which may be the molecular mechanism causing the occurrence of multiple myeloma. Therefore, the chromosome translocation t(1;22) in multiple myeloma patients can be used as a new detection target in the molecular typing of multiple myeloma. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1This is the electropherogram of PCR amplification to detect the chr1-chr22 staining translocation;

[0028] Figure 2 Sanger sequencing map of the chr1-chr22 staining translocation;

[0029] Figure 3 To analyze the up-regulation of APOBEC3A gene expression caused by chr1-chr22 translocation using bioinformatics;

[0030] Figure 4 To analyze the relationship between APOBEC3A upregulation caused by chr1-chr22 translocation and prognosis using bioinformatics;

[0031] Figure 5 qPCR was used to verify the upregulation of APOBEC3A gene expression caused by chr1-chr22 translocation;

[0032] Figure 6 The results were verified by dual luciferase reporter assay for APOBEC3A enhancer;

[0033] Figure 7 CD138 + FISH test results of multiple myeloma cells, where the probes are: red - chr1-568; green - chr22-488;

[0034] Figure 8 The FISH test results of CD138- peripheral blood mononuclear cells; the probes: red-chr1-568; green-chr22-488;

[0035] Fig. 9 The FISH detection results of GM12878 cell line; the probes are: red-chr1-568; green-chr22-488.

[0036] Fig.10 The results of OGM analysis in a patient with multiple myeloma showed the presence of t(1;22)(q25.;q13) translocation. DETAILED DESCRIPTION

[0037]

[0038]

[0039] The present invention provides a reagent for detecting the chromosome translocation t(1;22) of the multiple myeloma patient, including a reagent for detection based on PCR amplification and / or a reagent for detection based on FISH technology.

[0040] In the present invention, the PCR-based amplification detection reagent preferably includes primers for amplifying the chromosome translocation t(1;22) of the multiple myeloma patient. The primers for amplifying the chromosome translocation t(1;22) of the multiple myeloma patient include t122-F1 / t122-R1 and / or t122-F2 / t122-R2. The nucleotide sequence of the t122-F1 is shown in SEQ ID NO:5 (CCATTGACTCCTCCTGTGAAGA). The nucleotide sequence of the t122-R1 is shown in SEQ ID NO:6 (GCAACCTGCTGGATTAGTCA). The nucleotide sequence of the t122-F2 is shown in SEQ ID NO:7 (AGGTTAAAGTCACACAGCCAATG). The nucleotide sequence of the t122-R2 is shown in SEQ ID NO:8 (AGGTAGCAGCATTAGCAAGAGC).

[0041] The present invention does not impose any special restrictions on the source of the primers, and any primer source known in the art can be used. In the embodiment of the present invention, the primers were commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0042] In the embodiment of the present invention, the genome of somatic cells of multiple myeloma patients was used as a template, and the above two pairs of primers were used to perform PCR amplification respectively, and the PCR amplification products were sequenced. The sequencing results showed that the PCR amplification products The upstream sequence of the target reconnection point completely matches the chromosome 22 sequence (the underlined part in SEQ ID NO: 33), and the other side completely matches the chromosome 1 sequence (the bold part in SEQ ID NO: 33), while the above target band was not detected in the genome of the control cell. This indicates that chromosomal translocation t(1;22) does occur in the somatic cells of multiple myeloma patients, and at the same time proves that the primers have good amplification specificity and accuracy of prediction results.

[0043] In the present invention, the reagents for FISH-based detection preferably include FISH probes. The FISH probes preferably detect the FISH probes for the ends of chromosome 22 and the FISH probes for the ends of chromosome 1, and the nucleotide sequences of the FISH probes are shown in SEQ ID NO:9 to SEQ ID NO:30. The present invention does not impose any special restrictions on the source of the FISH probes, and any FISH probe source known in the art can be used. In the embodiment of the present invention, the FISH probes were commissioned to Morningstar Genetics.

[0044] In the present embodiment, the FISH test results show that CD138 + The probes for chromosome 1 (red) and chromosome 22 (green) of multiple myeloid cells overlapped significantly, while other control cells did not show the same detection results, which proved that CD138 + Chromosomal translocations are present in multiple myeloid cells.

[0045] The invention provides a reagent kit for detecting the chromosome translocation t(1;22) of the multiple myeloma patient, comprising the reagent and a reagent used in conjunction with the reagent.

[0046] In the present invention, the detection reagent used in conjunction with the reagent refers to other detection reagents required when performing PCR amplification or FISH detection, such as PCR amplification premix or fixative, gradient concentration ethanol, etc.

[0047] In the present invention, the kit preferably further comprises a reagent for detecting the expression of the APOBEC3A gene by qPCR. The reagent for detecting the expression of the APOBEC3A gene by qPCR preferably comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:31 (TGGCATTGGAAGGCATAAGAC) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:32 (TTAGCCTGGTTGTGTAGAAAGC).

[0048] In the present invention, chromosomal translocation in multiple myeloma patients causes the enhancer on chromosome 22 to be close to the APOBEC3A gene on chromosome 1. After bioinformatics analysis, it may cause the potential APOBEC3A gene to be upregulated. In the embodiment of the present invention, the GM12878 cell line was used as a control to detect the expression level of the APOBEC3A gene in the patient cells with chromosomal translocation. The results showed that the expression of the APOBEC3A gene in the patient cells was significantly upregulated compared with the control group. The present invention experiments have proved that chromosomal translocation leads to upregulation of the expression level of the APOBEC3A gene in the patient cells. Therefore, the chromosomal translocation in the present invention provides a new type of molecular typing target for the molecular typing of multiple myeloma, and provides a reference for the molecular typing of clinical multiple myeloma. Therefore, the present invention provides the use of the chromosomal translocation t (1; 22) of the multiple myeloma patient as a detection target in the preparation of a kit for molecular typing of multiple myeloma. The multiple myeloma preferably includes a smoldering myeloma subtype.

[0049] Based on the fact that the reagent can detect chromosomal translocation t(1;22) in multiple myeloma patients with high specificity and accuracy, and the chromosomal translocation specifically occurs in multiple myeloma patients, the present invention provides the use of the reagent in preparing a kit for detecting molecular typing of multiple myeloma.

[0050] In the present invention, the method for molecular typing of multiple myeloma preferably comprises the following steps:

[0051] Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primer pair in the reagent, sequencing the amplified product, and obtaining a sequencing result;

[0052] The molecular typing results were determined based on the sequencing results: when the amplified product was a translocation connection between chromosome 22 and chromosome 1, the molecular typing was chromosomal translocation t(1;22) and APOBEC3A gene high expression type; when the target fragment was not amplified, the molecular typing was other types.

[0053] The following is a detailed description of a detection reagent for chromosome translocation t(1;22) in multiple myeloma and its application provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] A method for detecting chromosome translocation

[0056] 1. Materials

[0057] The test sample is a multiple myeloma patient sample, numbered PAT3.

[0058] 2. Detection methods of chromosome translocation

[0059] 1. The myeloma cells isolated from the above samples were commissioned to Berry Genomics for third-generation genome sequencing, and Fraser Genetics was commissioned to perform sequencing based on the Illumina platform. Chromosome translocations were identified from the acquired sequencing data, and the intersection was taken to obtain a chromosome translocation, namely, the unknown chromosome translocation of chr1-chr22 in the patient (PAT3), specifically, an enhancer on chromosome 22 was translocated to the vicinity of the promoter of the APOBEC3A gene on chromosome 1, that is, the chr1 site 39280931 on chromosome 22 was reconnected with the chr8 site 178385884 on chromosome 1 (see Table 1).

[0060] Table 1 Specific genomic loci of a translocation screened

[0061] Myeloma samples Chr1 Pos1 Chr2 Pos2 PAT3 Chr1 178385884 chr22 39280931

[0062] 2. Verify the obtained chromosome translocation using PCR and Sanger sequencing

[0063] Two pairs of primers were designed in NCBI-Blast for the sequences on both sides of the reconnection point analyzed above. In order to prevent breakpoint drift, the primer PCR product was controlled to be above 2 kb. Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the primers. The genome of the sample cell of a multiple myeloma patient (PAT3) was extracted as a template, and PCR amplification was performed using the three pairs of designed primers. The amplification system is shown in Table 2.

[0064] Table 2 PCR reaction system

[0065]

[0066]

[0067] The primer sequences are as follows:

[0068] PAT3-t122-F1:CCATTGACTCCTCCTGTGAAGA (SEQ ID NO: 5);

[0069] PAT3-t122-R1:GCAACCTGCTGGATTAGTCA (SEQ ID NO: 6;

[0070] PAT3-t122-F2:AGGTTAAAGTCACACAGCCAATG (SEQ ID NO:7);

[0071] PAT3-t122-R2: AGGTAGCAGCATTAGCAAGAGC (SEQ ID NO: 8).

[0072] The PCR program was as follows: preliminary denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 2 min, 30 cycles; final extension at 72°C for 10 min.

[0073] The obtained PCR amplification products were subjected to agarose gel electrophoresis, and the target bands were collected and then entrusted to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to obtain sequencing results. The genome extracted from the human B lymphocyte cell line GM12878 was also used as a control in the example.

[0074] The electrophoresis of PCR amplification products is shown in Figure 1 Agarose gel electrophoresis results showed that both pairs of primers spanning the breakpoints in the genomic DNA of the patient sample successfully amplified the sequence near the breakpoint, while the genome of the control cell line GM12878 could not be amplified, proving the specificity of the primers and the accuracy of the predicted results.

[0075] Sanger sequencing peak diagram Figure 2 .Depend on Figure 2 It can be seen that the upstream sequence of the predicted rejoining point completely matches the sequence of chromosome 22, and the downstream sequence of the rejoining point completely matches the sequence of chromosome 1. This shows that the chr1-chr22 chromosome translocation predicted by the present invention is accurate.

[0076] 3. The verified chromosome translocation obtained in the previous step is further subjected to bioinformatics analysis to find the new loop generated due to the chromosome translocation.

[0077] 4. Entrust the above samples to Berry Genomics for ChIP-seq sequencing and RNA-seq sequencing to obtain ChIP-seq sequencing data and RNA-seq sequencing data for histone modification H3K27ac. Annotate the promoter-enhancer loop based on the ChIP-seq sequencing data of H3K27ac, and use RNA-seq data to screen target genes with Fold Change>2, that is, potential target genes caused by chromosomal translocation.

[0078] Results Figure 3 The analysis and prediction of this example show that the chr1-chr22 chromosome translocation leads to up-regulation of the expression of the APOBEC3A gene.

[0079] The results of survival analysis are shown in Figure 4 The APOBEC3A gene was negatively correlated with prognosis.

[0080] Example 4

[0081] Validation experiment based on up-regulated expression of APOBEC3A gene caused by chr1-chr22 chromosome translocation

[0082] RNA was extracted from malignant plasma cells of a multiple myeloma patient (PAT3) and reverse transcribed according to the reaction system in Table 3. RNA was also extracted from a B lymphocyte cell line (GM12878) as a normal cell control group.

[0083] Table 3 Reverse transcription system

[0084] <![CDATA[RNase-freeddH2O]]> Add to 20 μL 5×All-in-oneqRTSupermix 4μL EnzymeMix 1μL Template RNA 2μg

[0085] Use a pipette to gently pipette 8 to 10 times to mix thoroughly, centrifuge briefly to collect the contents at the bottom of the tube, and perform reverse transcription in the following program: 37°C for 15 min, 85°C for 5 s.

[0086] After reverse transcription, the reverse transcription reaction system was used as a template and primers were used to prepare a qPCR amplification reaction system, as shown in Table 4.

[0087] Table 4 qPCR amplification reaction system

[0088] 2×SYBR qPCR Master Mix 10μL qPCR upstream primer (10 μM) 0.4μL qPCR downstream primers (10 μM) 0.4μL DNA / cDNA 2μL <![CDATA[ddH2O]]> Add to 20 μL

[0089] Among them, APOBEC3A-qp-F: TGGCATTGGAAGGCATAAGAC (SEQ ID NO: 31); APOBEC3A-qp-R: TTAGCCTGGTTGTGTAGAAAGC (SEQ ID NO: 32).

[0090] At the same time, this embodiment also sets a control and an internal reference, the internal reference gene upstream primer: CACCATTGGCAATGAGCGGTTC (SEQ ID NO: 34); the internal reference gene downstream primer: AGGTCTTTGCGGATGTCCACGT (SEQ ID NO: 35). Each group is set with 4 replicates, and the amplification and data capture are performed on the machine; the reaction program is set to 95℃30s; 95℃30s, 60℃30s, 40cycles; 95℃30s, 60℃1min, 95℃1s. Process the data.

[0091] Results Figure 5 The mRNA expression of APOBEC3A gene in patient samples was significantly upregulated compared with that in control GM12878 cells.

[0092] Example 5

[0093] Dual luciferase reporter assay

[0094]

[0095] Results Figure 6 The results showed that compared with the control plasmid, the vector inserted with the APOBEC3A enhancer significantly increased the promoter strength of the APOBEC3A gene promoter, which proved the function of the enhancer.

[0096] Example 6

[0097] FISH detection experiment

[0098] Primers were designed to amplify the non-repetitive sequences in the target region to prepare probes. The primer sequences are shown in Table 5. The primer coverage region is about 25 kb in length, which are used as probes for chromosome 1 and chromosome 22, respectively. The PCR product was purified using a DNA purification kit (Vazyme, DC301-01), and the Tn5 transposase (Vazyme, TD501) was used to cut it into fragments less than 500 bp and add adapter fragments on both sides of the DNA fragment under the action of the enzyme. The cut DNA was then amplified using primers (N5 / N7) labeled with fluorescent dyes. Green Alexafluor-488 was used for the chromosome 22 locus, and red Alexafluor-568 was used for the chromosome 1 locus. The amplified fluorescent probe (the specific sequence is the primer sequence of N5 / N7 in the table below) was purified again using a DNA purification kit. The GM12878 cell line and CD138 were collected by centrifugation at 500g for 5 minutes at room temperature. + Multiple myeloma primary cells and CD138 -The experiment was performed on bone marrow mononuclear cells. The cells were washed once with 20 mL PBS and then mixed with Carnoy's solution. The slides were soaked in poly-lysine solution for 10 min, then removed and dried. 200 μL of Carnoy's solution evenly mixed with cells was added to the treated slides and kept at 37°C for 20 min to ensure complete drying. For FISH experiments, 1 million fixed cells were taken and permeabilized in PBS solution containing 0.5% Triton X-100 and 20% glycerol for 30 min at room temperature. The permeabilized cells were then mixed thoroughly with 10 ng of red probe for chromosome 1 locus and 10 ng of green probe for chromosome 22 locus and 20 μL of hybridization buffer (50% deionized formamide, 2× sodium citrate buffer, 10% dextran sulfate), denatured at 75°C for min, and then hybridized overnight at 37°C. The next day, the hybridized cells were washed with washing buffer (0.4% NP-40, 2× sodium citrate buffer, 10% deionized formamide) at 73°C for two minutes, then washed at room temperature for 5 minutes, repeated twice, and then washed twice with 1 mL PBS. The PBS on the slide was removed and then mounted with VECTASHIELD mounting medium containing DAPI (BIORIGIN, BN20923-50ml). Finally, the prepared slides were imaged using a Nikon AX confocal microscope (equipped with a 100X apoplan oil lens), and representative images were processed and analyzed using ImageJ software (version 1.54f, NIH).

[0099] Table 5 Primers required for FISH probe preparation

[0100]

[0101] Results Figure 7 to Figure 9 The white scale bar in the figure is 5 μm. From the FISH results, we can see that CD138 + The probes for chromosome 1 (red) and chromosome 22 (green) of multiple myeloid cells overlapped significantly, proving the existence of chromosomal translocation; - The probes for chromosome 1 (red) and chromosome 22 (green) in the peripheral blood mononuclear cells and GM12878 cell line were clearly separated, demonstrating the absence of chromosomal translocation.

[0102] Example 7

[0103] This experiment was commissioned by Beijing Jingzhun Medical Technology Co., Ltd. The Bionano Prep SPFrozen Human Bone Marrow Aspirate (BMA) DNA Isolation Kit was used to extract long-fragment DNA from bone marrow puncture fluid samples (the samples were from the Department of Hematology of Peking University People's Hospital, which had passed ethical review. The disease diagnosis was IgAκ type, belonging to patients with relapsed and refractory multiple myeloma, relapsed after autologous hematopoietic stem cell transplantation, and cancer bone metastasis). The extracted ultra-long fragment double-stranded DNA molecules were sequence-specifically labeled using the Bionano Prep DLS Kit. The DLE 1 enzyme specifically recognizes the CTTAAG base sequence on DNA and transfers a green fluorescent label to this sequence position; then the entire DNA molecular backbone is stained with a blue dye; finally, a series of long-fragment blue DNA molecules with green fluorescent signals are obtained. The labeled DNA was loaded onto the Saphyr G2.3 chip, and the linear double-stranded molecules were imaged using the Saphyr instrument (Gen 2, Bionano Genomics).

[0104] Approximately 400× effective data (1500GB / sample) were collected for each of the two samples. Quality control assessment (total DNA (≥150kbp), N50 (≥150kbp), alignment rate (≥150kbp), effective data depth and average marker density (≥150kbp)) was performed according to the Bionano data quality control guidelines. Rare variant analysis (RVA) was performed on the acquired data using Bionano Access Server. The filtering parameters of the data were set to the initial default values ​​of Bionano Access Server. The genome database of 179 healthy individuals was embedded in the Bionano Access system (https: / / www.internationalgenome.org / faq / which-populations-are-part-your-study / :.), and the parameter "SV in less than or equal to this%ofthe control db samples" was set to "0" to delete the SVs present in the healthy population in the data.

[0105] Fig.10 The purple line in the middle circle represents the translocation between chromosomes; green represents the GRCh38 reference chromosome with OGM markers. Light blue represents the assembled sample map with markers. Gray lines indicate the alignment of the same markers in the reference chromosome and the assembled sample. Purple represents the translocation breakpoint. Fig.10The results showed that the OGM technique was used to analyze the presence of t(1;22) chromosome translocation in multiple myeloma patients.

[0106] Example 8

[0107] The method for molecular typing of multiple myeloma using PCR technology comprises the following steps:

[0108] The genomic DNA of the sample to be tested (blood of a confirmed multiple myeloma patient, denoted as PAT21) was used as a template, and PCR amplification was performed using a primer pair (PAT3-t122-F1 / PAT3-t122-R1) according to the method of Example 3. The amplified product was entrusted to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to obtain the sequencing results. According to the sequencing results, the molecular typing of the PAT21 patient was chromosomal translocation t(1;22).

[0109] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multiple myeloma patient with chromosomal translocation t(1;22), characterized in that: It is formed by reconnecting the upstream sequence obtained by the break of chromosome 22 at site 39280931 and the downstream sequence obtained by the break of chromosome 1 at site 178385884 based on the human genome version GRCh38; The upstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO: 1; The downstream sequence is a DNA sequence as shown in SEQ ID NO:

2.

2. The multiple myeloma patient chromosome translocation t(1;22) according to claim 1, characterized in that: The upstream sequence on chromosome 22 also includes the sequence of the APOBEC3A gene promoter; the downstream sequence on chromosome 1 also includes the sequence of the enhancer; The nucleotide sequence of the enhancer is shown in SEQ ID NO: 3; The nucleotide sequence of the APOBEC3A gene promoter is shown in SEQ ID NO:

4.

3. A reagent for detecting the chromosome translocation t(1;22) in multiple myeloma patients according to claim 1 or 2, characterized in that: It includes reagents for PCR amplification detection and / or reagents for FISH technology detection.

4. The reagent according to claim 3, characterized in that The PCR-based amplification detection reagent includes primers for amplifying chromosome translocation t(1;22) of multiple myeloma patients.

5. The reagent according to claim 4, characterized in that The primers for amplifying the chromosome translocation t(1;22) of multiple myeloma patients include t122-F1 / t122-R1 and / or t122-F2 / t122-R2; The nucleotide sequence of t122-F1 is shown in SEQ ID NO:5; The nucleotide sequence of t122-R1 is shown in SEQ ID NO:6; The nucleotide sequence of t122-F2 is shown in SEQ ID NO:7; The nucleotide sequence of t122-R2 is shown in SEQ ID NO:

8.

6. The reagent according to claim 4, characterized in that The reagents for FISH-based detection include FISH probes; The nucleotide sequences of the FISH probes are shown in SEQ ID NO: 9 to SEQ ID NO:

30.

7. A kit for detecting the chromosome translocation t(1;22) in a multiple myeloma patient according to any one of claims 1 to 3, characterized in that: The invention comprises the reagent according to any one of claims 4 to 6 and a reagent used in conjunction with the reagent.

8. The kit according to claim 7, characterized in that: Also included are reagents for qPCR detection of APOBEC3A gene expression; The reagents for qPCR detection of APOBEC3A gene expression are a forward primer with a nucleotide sequence as shown in SEQ ID NO:31 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

32.

9. Use of the chromosome translocation t(1;22) of a multiple myeloma patient as claimed in any one of claims 1 to 3 as a detection target in the preparation of a kit for detecting molecular typing of multiple myeloma.

10. Use of the reagent according to any one of claims 4 to 6 in the preparation of a kit for detecting molecular typing of multiple myeloma.

Images