Visual giardia detection system based on RPA-PfAgo and application of visual giardia detection system

Abstract

The invention discloses a giardia visual detection system based on RPA-PfAgo and application of the giardia visual detection system, by optimizing a reaction system and reaction conditions, the efficiency, sensitivity and specificity of RPA-PfAgo amplification are improved; compared with a CRISPR / Cas9 system, the whole operation process is simpler, the synthesis cost of PfAgo and gDNA is lower, the stability is better, storage and transportation are easy, and the system is more suitable for field detection; the whole reaction only needs RPA amplification at 39 DEG C and PfAgo cutting reaction at 95 DEG C, the reaction can be completed through a water bath or a metal bath, professional temperature control equipment is not needed, whether giardia exists in a sample or not can be directly observed through blue light excitation according to a used probe, the needed time and equipment cost are greatly reduced, the operation method is simple, and the method is suitable for large-scale industrial production. The method has low professional requirements on personnel and is more suitable for on-site diagnosis.

Description

Technical Field

[0001] The invention discloses a visualization detection system of Giardia based on RPA-PfAgo and an application thereof, and specifically relates to a method for rapid visualization detection of Giardia duodenalis in feces using the RPA-PfAgo system, and belongs to the technical field of molecular biology detection. Background Art

[0002] Giardiasis is caused by Giardia duodenalis ( Giardia duodenalis ) is a common zoonotic parasitic disease caused by Giardiasis, which has caused major public health concerns worldwide. So far, there is no effective vaccine to prevent giardiasis. There are drugs such as metronidazole, tinidazole, and albendazole to treat giardiasis, but the problem of drug resistance of Giardia is becoming increasingly prominent. Therefore, it is very important to establish a set of efficient, sensitive and accurate giardiasis detection technology for the prevention and control of giardiasis.

[0003] At present, the detection and epidemiological investigation of Giardia are mainly carried out through traditional microscopic examination and nested PCR. Microscopic examination of cysts is the gold standard for the diagnosis of giardiasis. The cysts in the feces are enriched by suspension method, and the smear is stained with iodine solution and observed under a microscope. Although this method is simple and convenient, it requires high professional skills of personnel, is highly subjective, and is prone to missed detection. Using nested PCR, multiple target genes can be amplified and the products can be sequenced and analyzed. Giardia can be divided into eight isolates of AH, but this method is limited to laboratory diagnosis and requires expensive equipment and instruments. Therefore, the development of a convenient and sensitive on-site detection method has important public health and veterinary significance for the prevention and control of human-animal transmission of Giardia. Summary of the invention

[0004] In order to detect giardiasis efficiently, accurately, sensitively and conveniently, the present invention provides a primer, a kit and a detection method for rapid visual diagnosis of giardiasis based on RPA amplification combined with the PfAgo system. The present invention can read the fluorescence value for analysis through a fluorescent quantitative PCR instrument, and can also directly judge the result according to the fluorescence brightness after blue light excitation, which greatly reduces the dependence on laboratory equipment, reduces the operation steps, and effectively avoids the occurrence of aerosol pollution.

[0005] The first aspect of the present invention aims to provide a reagent for detecting giardiasis.

[0006] The second aspect of the present invention aims to provide a diagnostic kit.

[0007] The third object of the present invention is to provide a Giardia visualization detection system based on RPA-PfAgo and its application.

[0008] To achieve the above object, the present invention adopts the following technical solutions: In a first aspect of the present invention, a reagent for detecting giardiasis using RPA-PfAgo is provided, wherein the detection reagent is a pair of RPA primers and ssDNA; The primer sequences are: RPA-F7: 5' - CAGGCTCATCCAGACGGAGTCGAGGAAGCGC- 3'; RPA-R7: 5' - TGAGTGTGTCGCCCATCTCCGCAAGGGACTT - 3'; The ssDNA nucleotide sequence is as follows: 5'-CAGGCTCATCCAGACGGAGTCGAGGAAGCGCCAGGCCTCGTTCGAGGACATCCGCGAGG- 3' The second aspect of the present invention provides a kit containing the first aspect of the present invention.

[0009] In some embodiments of the present invention, the kit further comprises gDNA, PfAgo protein and molecular probes.

[0010] The sequence of the gDNA is: gDNA2: 5'-ACGAGGCCTGGCGCTT-3', in which the 5' is phosphorylated; gDNA2-2: 5'-CTCCTCGCGGATGTCC-3', in which the 5' is phosphorylated; gDNA2-3: 5'-GAGGAAGCGCCAGGCC-3', in which the 5' is phosphorylated; In some implementation methods of the present invention, the single-stranded gDNA generated by the gDNA cleavage RPA product is used to cleave the probe. The 5' end of the molecular probe is modified with a FAM fluorescent group, and the 3' end is modified with a BHQ quenching group.

[0011] The sequence of the molecular probe MB-1 is: MB-1 6 FAM-cgcaccCCTCGAACGAGGCCTGggtgcg-BHQ 1; MB-1 molecular probe can collect the end-point fluorescence intensity through a fluorescence quantitative PCR instrument or directly observe the results when excited by blue light.

[0012] In some embodiments of the present invention, the kit includes an RPA reaction buffer and a PfAgo reaction buffer.

[0013] The third aspect of the present invention further provides an RPA-PfAgo detection system for giardiasis, wherein the detection system comprises the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention; the specific steps of the specific detection method are as follows: (1) Extracting fecal genome from samples; (2) using the kit and primers of the present invention to perform RPA reaction on the fecal genome of the sample in step (1), the reaction conditions being 39° C. for 30 minutes; (3) mixing the RPA amplification product of step (2) with the RPA-PfAgo kit of the present invention to perform a PfAgo reaction, wherein the PfAgo concentration is 2 μM, the gDNA concentration is 2 μM, and the MB-1 concentration is 1.5 μM; (4) Read the fluorescence signal through a quantitative PCR instrument or determine the result through blue light excitation: When the reaction system has a fluorescence signal or emits fluorescence, it indicates that the sample to be tested contains Giardia; when the reaction system has no fluorescence signal or does not emit fluorescence, it indicates that the sample to be tested does not contain Giardia.

[0014] Preferably, the RPA reaction conditions in step (2) are 39° C. for 30 minutes.

[0015] Preferably, in the PfAgo reaction system of step (3), the concentration of PfAgo is 2 μM, the concentration of gDNA is 2 μM, and the concentration of MB-1 is 1.5 μM.

[0016] The positive effects of the present invention are:

[0017] (1) The present invention establishes a new detection method of RPA combined with PfAgo. By optimizing the reaction system and reaction conditions, the efficiency, sensitivity and specificity of RPA-PfAgo amplification are improved; compared with the currently widely used CRISPR / Cas9 system, the entire operation process is simpler, the synthesis cost of PfAgo and gDNA is lower, and the stability is better, easy to store and transport, and more suitable for on-site detection; compared with the traditional nested PCR, the entire reaction only requires RPA amplification at 39°C and PfAgo cleavage reaction at 95°C, which can be completed in a water bath or metal bath, without the need for professional temperature control equipment, and the presence of Giardia in the sample can be directly observed by blue light excitation according to the probe used.

[0018] (2) The PfAgo protein provided by the present invention, as a nuclease, can target and cut the RPA amplification product under the guidance of gDNA. This feature greatly reduces the risk of aerosol contamination after opening the lid.

[0019] (3) The RPA-PfAgo system greatly reduces the time and equipment costs required. The reagent components of this method are low-cost, easy to store, simple to operate, and do not require high professional skills from personnel, making it more suitable for on-site diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The purification result of PfAgo in the example of the present invention; Figure 2 For the screening of RPA primers of the present invention; Figure 3 Verify the PfAgo function of the present invention; Figure 4 This is the gDNA quantity optimization result of the present invention; Figure 5 The gDNA and PfAgo concentration optimization results of the present invention; Figure 6 This is the MB concentration optimization result of the present invention; Figure 7 It is the specific detection of the present invention; Figure 8 It is the sensitivity detection of the present invention; Fig. 9 This is the sample test of the present invention. DETAILED DESCRIPTION

[0021] In order to facilitate the staff in the professional and technical field to better understand the scheme of the present invention, the following will combine the description of the drawings with the embodiments to describe the scheme of the present invention in detail. However, the described embodiments are only part of the embodiments of the present invention, and the present invention is not limited to the described embodiments. Example 1

[0022] 1. Reagents and instruments TIANamp Stool DNA Kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., RPA nucleic acid amplification kit was purchased from TwistDX, 10X Pfu Buffer and 2X PCR Mix were purchased from Sangon Biotech (Shanghai) Co., Ltd. Fluorescence quantitative PCR instrument was purchased from Jena Analytical Instruments (Germany) Co., Ltd.

[0023] method 2. Preparation of plasmid standards The BG gene was amplified by PCR using the trophozoite genome of Giardia duodenalis WB strain stored in the laboratory as a template, cloned into the pET28a prokaryotic expression vector, and transformed into Escherichia coli DH5α competent cells. A single colony was picked for expansion and culture, and positive clones were screened by bacterial liquid PCR. The bacterial liquid was sent to Shanghai Shenggong Company for sequencing. The plasmid was extracted from the correctly sequenced bacterial liquid and named pET28a-BG. The concentration was measured using nanodrop 2000 and stored in aliquots at -20℃. The pET28a-BG copy number calculation formula. copies / µL = (6.02 × 10 23 ) × (ng / µL × 10 −9 ) / (length of DNA ×660). 3. PfAgo protein expression and purification The recombinant plasmid pET-28a-PfAgo was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The overnight activated bacterial solution was expanded at a ratio of 1%. When the OD reached about 0.6-0.8, IPTG was added at a final concentration of 0.5mM, and the induction was continued at 37°C for 6-8 hours. The bacteria were collected by centrifugation at 12000r for 10 minutes. After ultrasonic disruption, the supernatant was collected and purified by nickel column. After the collected protein was verified for purity by SDS-PAGE, it was concentrated using a 30kDa ultrafiltration tube and replaced with a buffer suitable for PfAgo enzyme activity. The protein concentration was measured by the BCA kit and stored in aliquots at -80°C.

[0024] The results showed that PfAgo was mainly expressed in the supernatant. 500mM imidazole elution could obtain PfAgo protein with high purity. The protein concentration after replacing the buffer was 2 μg / μL and could be used for subsequent experiments, such as Figure 1 As shown; (M: protein marker; 1: flow-through of the recombinant protein pET-28a-His-PfAgo supernatant; 2: wash solution of the recombinant protein pET-28a-His-PfAgo supernatant; 3: elution solution of the recombinant protein pET-28a-His-PfAgo induced supernatant; 4: ultrafiltration concentration of the recombinant protein pET-28a-His-PfAgo).

[0025] 4. Oligonucleotide sequence design and screening According to the conservative sites of the BG gene, RPA amplification primers F1-F8 and R1-R8 were designed. First, different primer pairs were preliminarily screened by conventional PCR, and primers with good amplification effect and high specificity were further screened by RPA. 59bp ssDNA was designed to screen gDNA, and one gDNA was designed every 3 bases, for a total of four gDNAs. According to the gDNA screening results, two auxiliary gDNAs were designed to jointly cut the RPA product. The single-stranded DNA generated by cutting was used to further cut the probe. The probe sequence was. The above primers were sent to Shenggong Biotechnology (Shanghai) Co., Ltd. for synthesis; A pair of RPA primers and ssDNA; Upstream primer: RPA-F7: 5′-CAGGCTCATCCAGACGGAGTCGAGGAAGCGC- 3′; Downstream primer: RPA-R7: 5′ - TGAGTGTGTCGCCCATCTCCGCAAGGGACTT - 3′; ssDNA nucleotide sequence: 5'-CAGGCTCATCCAGACGGAGTCGAGGAAGCGCCAGGCCTCGTTCGAGGACATCCGCGAGG- 3'.

[0026] gDNA, PfAgo protein, and molecular probe MB-1; The sequence of the gDNA is: gDNA2: 5'-ACGAGGCCTGGCGCTT-3', in which the 5' is phosphorylated; gDNA2-2: 5'-CTCCTCGCGGATGTCC-3', in which the 5' is phosphorylated; gDNA2-3: 5'-GAGGAAGCGCCAGGCC-3', in which the 5' is phosphorylated; The sequence of the molecular probe MB-1 is: MB-1: 5′-cgcaccCCTCGAACGAGGCCTGggtgcg-3′, in which the 5′ was modified with FAM and the 3′ was modified with BHQ.

[0027] The results showed that 10 primer pairs were obtained through PCR screening: F1R1; F2R1; F3R3; F3R3-2; F3R3-3; F4R3-2; F4R3-3; F6R6; F7R7; F8R8. Through further screening by PRA, the F7R7 primer pair was obtained. This primer pair has high amplification efficiency and good specificity and can be used for subsequent experiments, such as Figure 2As shown; (Left - DL500 DNA Marker; 1: F1R1; 2: F1R2; 3: F2R1; 4: F2R2; 5: F3R3; 6: F3R3-2; 7: F3R3-3; 8: F3R4; 9: F4R3-2; 10:F4R3-3; 11: F4R4; 12: F5R5; 13: F6R6; 14: F7R7; 15: F8R8. Right - DL500 DNA Marker; 1: F1R1; 2: F2R1; 3: F3R3; 4: F3R3-2; 5: F3R3-3; 6: F4R3-2; 7: F4R3-3; 8: F6R6; 9:F7R7; 10:F8R8). The four gDNAs designed based on the RPA amplification products were used to cut ssDNA. After reacting at 95°C for 25 minutes, gDNA2 with good guiding cutting effect was screened out by 25% Urea TBE-PAGE. At the same time, it was proved that PfAgo had strong cutting ability for single-stranded DNA. The four designed gDNAs could guide the complete cutting of ssDNA. Figure 3 As shown in the figure (1: ssDNA; 2: PfAgo and gDNA; 3: ssDNA, PfAgo and gDNA1; 4: ssDNA, PfAgo and gDNA2; 5: ssDNA, PfAgo and gDNA3; 6: ssDNA, PfAgo and gDNA4; 7: ssDNA, PfAgo and gDNA2; 8: ssDNA and PfAgo; 9: ssDNA and gDNA2; 10: gDNA2). According to the position where gDNA2 binds to ssDNA, gDNA2-2 and gDNA2-3 were designed, and the fluorescence intensity was detected by fluorescence quantitative PCR instrument, which proved that the fluorescence intensity was the highest when there were 3 gDNAs guiding the cutting of RPA products; as shown in the figure Figure 4 As shown (1: gDNA2; 2: gDNA2, gDNA2-2; 3: gDNA2, gDNA2-2, gDNA2-3).

[0028] 5. Optimization of RPA-PfAgo reaction conditions The RPA reaction was performed using reagents from Twist. The reaction system included primers RPA-F7 (10 μM 2.4 μL), RPA-R7 (10 μM 2.4 μL), buffer A (29.5 μL), double distilled water (10 μL), template (3.2 μL), and buffer B (2.5 μl). The reaction was carried out at a constant temperature of 39°C and ended within 30 minutes. The PfAgo reaction system included MB, PfAgo, probe, buffer, and RPA product. The components were optimized by controlling a single variable. The reaction was carried out at 95°C and ended within 25 minutes. The reaction results were observed by measuring the fluorescence intensity and blue light irradiation.

[0029] The results showed that the final system after optimization was 1.5 μM MB, 2 μM PfAgo, 2 μM probe, 2 μl buffer and 5 μl RPA product, and double distilled water was used to make the volume 20 μl. The reaction conditions were 95°C for 25 minutes. The reaction could be carried out in a water bath or a quantitative PCR instrument could be used to collect the end-point signal intensity. Figure 5 (The vertical axis is the gDNA concentration, from bottom to top: 0.5μM, 1μM, 1.5μM, 2μM, 2.5μM, 3μM; the horizontal axis is the PfAgo concentration, from left to right: 2.5μM, 2μM, 1.5μM, 1μM, 0.5μM) and as shown in Figure 6 (from left to right: 0μM, 0.5μM, 1μM, 1.5μM, 2μM).

[0030] 6. Evaluation of RPA-PfAgo detection system The prepared BG gene standard was diluted 10 times continuously to 10 ng-100 fg as a template to verify the sensitivity of the RPA-PfAgo detection system. The parasite genome preserved in this experiment was used to verify the specificity of the RPA-PfAgo detection system. The reaction was carried out at 95°C for 25 minutes, and the results were judged by measuring the end point fluorescence intensity or by naked eyes under blue light excitation: when the reaction system had a fluorescent signal or emitted fluorescence, it indicated that the sample to be tested contained Giardia; when the reaction system had no fluorescent signal or did not emit fluorescence, it indicated that the sample to be tested did not contain Giardia.

[0031] The results showed that the Giardia WB strain, Giardia GS strain, Cryptosporidium, Neospora, Clonorchis, Toxoplasma, Trichomonas, and Coccidia genomes preserved in the laboratory were used for detection. The results showed that positive fluorescent signals were only detected in the Giardia genome samples, proving that the method had no cross-reaction and good specificity; Figure 7As shown in the figure (from left to right: Giardia A isolate, Giardia B isolate, Cryptosporidium parvum, Neospora, Toxoplasma gondii, Clonorchis stygosus, Eimeria skrizzli, E. stygosus, and no-template blank control). The sensitivity of the reaction was verified using a standard sample with a 10-fold dilution ratio of 10 ng-100 fg. The results showed that the minimum detectable level was 100 fg, and the intensity of the positive fluorescence signal was significantly higher than that of the negative signal, proving that the method has high sensitivity; Figure 8 As shown (from left to right: 10ng, 1ng, 100pg, 10pg, 1pg,100fg, NTC).

[0032] 7. Clinical sample testing Eighteen fecal samples were collected from a pig farm in Jilin Province, China, and the established RPA-PfAgo method was used to detect the presence of Giardia duodenalis infection. The results showed that among the 18 clinical samples, 7 were detected with Giardia infection, and 11 were not detected with Giardia infection, which was consistent with the results of traditional nested PCR detection, indicating that the RPA-PfAgo detection technology can be well used for the rapid detection of giardiasis caused by Giardia infection; Fig. 9 As shown (from left to right are samples 1-18, positive control and negative control).

[0033] The present invention combines RPA with PfAgo, taking advantage of the efficient amplification of RPA and the targeted cutting of PfAgo, thereby avoiding the disadvantage of RPA being prone to false positives. In addition, the cutting of the target sequence by PfAgo greatly reduces the risk of aerosol contamination. Example 2

[0034] The preparation method of the Giardia visualization kit based on RPA-PfAgo of the present invention comprises two components, RPA and PfAgo, and the specific operation steps are as follows: 1. RPA reaction components include: A reaction buffer (TwistDX, Catalog No. TABASO3KIT); B reaction buffer (TwistDX, Catalog No. TABASO3KIT); Negative control, negative control does not contain the Giardia genome; positive control, positive control contains the Giardia genome; RPA-F7: 5' - CAGGCTCATCCAGACGGAGTCGAGGAAGCGC- 3'; RPA-R7: 5' - TGAGTGTGTCGCCCATCTCCGCAAGGGACTT- 3'.

[0035] 2. PfAgo reaction components include: PfAgo protein, insert the PfAgo gene into the pET-28a prokaryotic expression vector through the BamH I and EcoR I restriction sites to construct pET-28a-PfAgo. Activate the bacterial solution expressing pET-28a-PfAgo overnight, expand the culture at a ratio of 1%, and add IPTG to a final concentration of 0.5mM when the OD reaches about 0.6-0.8. Collect the bacteria after induction at 37°C for 6-8 hours, ultrasonically disrupt, collect the supernatant and purify it through a nickel column. After the collected protein is verified for purity by SDS-PAGE, it is concentrated using a 30kDa ultrafiltration tube to a concentration of 20μM, and stored in aliquots at -80°C; PfAgo reaction buffer: Catalog No. Sangon, B00078; gDNA2: 5'- P-ACGAGGCCTGGCGCTT- 3'; gDNA2-2: 5'- P-CTCCTCGCGGATGTCC- 3'; gDNA2-3: 5'- P-GAGGAAGCGCCAGGCC- 3'; MB-1: 5′-cgcaccCCTCGAACGAGGCCTGggtgcg-3′, wherein the 5′ is modified with FAM and the 3′ is modified with BHQ.

Claims

1. A reagent for detecting giardiasis by RPA-PfAgo, characterized in that The detection reagent includes: a pair of RPA primers and ssDNA; Upstream primer: RPA-F7: 5′-CAGGCTCATCCAGACGGAGTCGAGGAAGCGC- 3′; Downstream primer: RPA-R7: 5′ - TGAGTGTGTCGCCCATCTCCGCAAGGGACTT - 3′; ssDNA nucleotide sequence: 5'-CAGGCTCATCCAGACGGAGTCGAGGAAGCGCCAGGCCTCGTTCGAGGACATCCGCGAGG- 3'.

2. A Giardia visualization detection kit based on RPA-PfAgo, characterized in that The kit includes: gDNA, PfAgo protein and molecular probe MB-1; The sequence of the gDNA is: gDNA2: 5'-ACGAGGCCTGGCGCTT-3', in which the 5' is phosphorylated; gDNA2-2: 5'-CTCCTCGCGGATGTCC-3', in which the 5' is phosphorylated; gDNA2-3: 5'-GAGGAAGCGCCAGGCC-3', in which the 5' is phosphorylated; The sequence of the molecular probe MB-1 is: MB-1: 5′-cgcaccCCTCGAACGAGGCCTGggtgcg-3′, wherein the 5′ is modified with FAM and the 3′ is modified with BHQ.

3. The preparation method of a Giardia visualization kit based on RPA-PfAgo as claimed in claim 2, comprising two components, RPA and PfAgo, and the specific operation steps are as follows:

1. RPA reaction components include: A reaction buffer (TwistDX, catalog number TABASO3KIT); B reaction buffer (TwistDX, catalog number TABASO3KIT); negative control, which does not contain the Giardia genome; positive control, the positive control contained the Giardia genome; RPA-F7: 5'- CAGGCTCATCCAGACGGAGTCGAGGAAGCGC- 3'; RPA-R7: 5'-TGAGGTGTGTCGCCCATCTCCGCAAGGGACTT- 3'.

4. PfAgo reaction components include: PfAgo protein, insert the PfAgo gene into the pET-28a prokaryotic expression vector through the BamH I and EcoR I restriction sites to construct pET-28a-PfAgo; activate the bacterial solution expressing pET-28a-PfAgo overnight, expand the culture at a ratio of 1%, and add IPTG to a final concentration of 0.5mM when the OD reaches about 0.6-0.

8. After induction at 37°C for 6-8 hours, collect the bacteria, ultrasonically disrupt them, collect the supernatant and purify it through a nickel column; after the purity of the collected protein is verified by SDS-PAGE, it is concentrated using a 30kDa ultrafiltration tube to a concentration of 20μM, and stored in aliquots at -80°C; PfAgo reaction buffer; gDNA2: 5'- P-ACGAGGCCTGGCGCTT- 3'; gDNA2-2: 5'- P-CTCCTCGCGGATGTCC- 3'; gDNA2-3: 5'- P-GAGGAAGCGCCAGGCC- 3'; MB-1 5'-cgcaccCCTCGAACGAGGCCTGggtgcg- 3'.

5. An RPA-PfAgo detection system for giardiasis, characterized in that The invention comprises the reagent involved in claim 1 and the kit involved in claim 2; the specific steps of the specific detection method are as follows: (1) Extracting fecal genome from samples; (2) using the kit and primers of claim 1 to perform RPA reaction on the fecal genome of the sample in step (1), the reaction conditions being 39°C for 30 minutes; (3) The RPA amplification product of step (2) was mixed with the RPA-PfAgo kit of claim 2 to perform a PfAgo reaction, wherein the PfAgo concentration was 2 μM, the gDNA concentration was 2 μM, and the MB-1 concentration was 1.5 μM; (4) Read the fluorescence signal through a quantitative PCR instrument or determine the result through blue light excitation: When the reaction system has a fluorescence signal or emits fluorescence, it indicates that the sample to be tested contains Giardia; when the reaction system has no fluorescence signal or does not emit fluorescence, it indicates that the sample to be tested does not contain Giardia.

Images