Magnetic bead aptamer sensor based on MnTiO3atPd nanoparticle colorimetry

Abstract

The invention belongs to the technical field of biomedicine, and discloses a magnetic bead aptamer sensor based on MnTiO3atPd nanoparticle colorimetry, a construction method and application. The preparation method comprises the following steps: synthesizing a MnTiO3 nanodisk by using a one-step hydrothermal method, and further synthesizing MnTiO3 (at) Pd nanoparticles; designing a capture probe and a signal probe according to the nucleotide sequence of the endotoxin aptamer; synthesis of a capture probe: a magnetic bead modified aminated nucleotide single strand; the method comprises the following steps: synthesizing a signal probe by utilizing ssDNA and MnTiO3 (at) Pd nanoparticles; and constructing the colorimetric aptamer sensor by using the capture probe and the signal probe. The magnetic bead aptamer sensor based on MnTiO3 at Pd nanoparticle colorimetry provided by the invention is used for detecting endotoxin in plasma. The aptamer sensor designed by the invention provides a low-cost, high-sensitivity and rapid method for detecting endotoxin, and quantitative and qualitative detection can be simultaneously carried out.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, a construction method and an application thereof. Background Art

[0002] Endotoxin is a component of the cell wall of Gram-negative bacteria, which consists of lipopolysaccharide A and a sugar chain. After the bacteria die, endotoxin is released into the plasma, causing toxic effects such as fever, septic shock, multiple organ failure, and even death. Endotoxin contamination endangers human health, especially contamination in blood products, injectable drugs, medical dressings, and implantable devices. At present, the main methods for detecting endotoxin are the horseshoe crab amebocyte lysate test (LAL test) and biosensors. Among them, the LAL test is based on enzyme reaction and is easily interfered by proteases.

[0003] As a single nucleotide chain, aptamers can specifically recognize molecular biomarkers. Compared with antibodies, aptamers have good specificity, affinity and stability. In recent years, the application of nanomaterials in the medical field has attracted the attention of researchers. MnTiO3 is a ternary nanodisc that participates in hydrogen peroxide-mediated oxidative degradation as a catalyst, causing methylene blue to change from blue to colorless or lighter in color. Palladium nanoparticles (Pd) can also catalyze the reaction of hydrogen peroxide to a certain extent, and can also bind to single nucleotide chains through Pd-NH2 chemical bonds.

[0004] Through the above analysis, the problems and defects of the prior art are as follows:

[0005] (1) Traditional detection methods have limitations in sensitivity and specificity, especially in complex samples such as blood products.

[0006] (2) The LAL test is easily interfered by external conditions such as proteases, which affects the accuracy and reliability of the results. The LAL test requires a specific environment and conditions, which makes the operation complicated and increases the cost. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, a construction method and an application thereof.

[0008] In the design of the present invention, we constructed a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry for quantitative and qualitative detection of endotoxins. In the presence of hydrogen peroxide solution, MnTiO3@Pd nanoparticles can change methylene blue from blue to colorless or lighter in color. This change can be initially qualitatively determined by the naked eye, and can also be quantitatively detected by measuring absorbance with an ultraviolet spectrophotometer. If there is endotoxin in the plasma to be tested, the aptamer (Apt) in the test solution will bind to it, causing the "magnetic bead modified capture probe (MB-Cp)-Apt-MnTiO3@Pd nanoparticle modified signal probe (MnTiO3@Pd nanoparticle-Sp)" sandwich structure formed in the solution to become less, ultimately resulting in a greater difference in absorbance.

[0009] A method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, the method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry comprising the following steps:

[0010] S1, synthesizing MnTiO3 nanodisks by a one-step hydrothermal method, and then reducing Pd nanoparticles onto the nanodisks to synthesize MnTiO3@Pd nanoparticles;

[0011] S2, designing capture probes and signal probes according to the nucleotide sequence of the endotoxin aptamer;

[0012] S3, synthetic capture probe: single-stranded amino nucleotide modified with magnetic beads;

[0013] S4, synthesizing signal probes using ssDNA and MnTiO3@Pd nanoparticles;

[0014] S5, construction of a colorimetric aptasensor using capture probes and signal probes.

[0015] Furthermore, the specific steps for synthesizing MnTiO3@Pd nanoparticles in S1 are:

[0016] S11, preparing solution A: adding 0.394 ml of 1.25 mmol titanium isopropoxide dropwise into 16 ml of ethylene glycol, and stirring vigorously to form a mixed solution;

[0017] S12, prepare solution B: dissolve 247.8 mg MnCl2·4H2O in 4 ml ethylenediamine;

[0018] S13, pouring solution A into solution B, stirring briefly to mix, and then adding H2O dropwise to the mixture;

[0019] S14, adding the mixed solution into a stainless steel autoclave, sealing the autoclave and placing it into a muffle furnace, and heating at 200 degrees for 12 hours;

[0020] S15, when the temperature of the autoclave drops to room temperature, the liquid is transferred to a centrifuge tube and centrifuged, and then washed three times with anhydrous ethanol and ultrapure water, and the obtained yellow precipitate is dried in a drying oven.

[0021] S16, add 10mM Na2PdCl4 (1ml) to the 1mg / ml MnTiO3 nanodisc aqueous solution, then quickly add ascorbic acid to the mixed solution, stir for 3h at room temperature, then centrifuge and wash. Finally, resuspend in PBS buffer and place in a refrigerator at 4 degrees for use.

[0022] Further, the nucleotide sequence of the endotoxin aptamer in S2 is: 5'-TTTTTTTTTTTCTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGAT GATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; the nucleotide sequence of the capture probe is: 5'-AAAAAGTGTCCGCCTATCTCGTCTCCTGGGGGGCTGACCCTTTATATCATC-3', and the nucleotide sequence of the signal probe is: 5'-TGGCCAGCGCGATCCGGCTAGGAAGGAGGCGGGCAGAAGAAAAAAAAAGGGG-3'.

[0023] Further, the specific steps of synthesizing the signal probe in S4 are:

[0024] S41, equal volumes of ssDNA and MnTiO3@Pd nanoparticles were placed in a 4°C refrigerator with slight stirring overnight, centrifuged and washed three times with PBS buffer;

[0025] S42, 1% BSA was added to block its nonspecific binding sites, and the cells were washed three times with PBS buffer after centrifugation;

[0026] S43, resuspended in PBS buffer and placed in a refrigerator at 4 degrees until use.

[0027] Furthermore, the specific steps of constructing the colorimetric aptamer sensor in S5 are:

[0028] S51, add the quantitative aptamer and target to the ep tube, react at room temperature for 2 h, then add the above reaction solution to the pre-prepared detection reagent (containing MB-Cp and MnTiO3@Pd-Sp), and react at room temperature for 2 h;

[0029] S52, after the above reaction is completed, a magnetic stand is used to remove the components that have not formed a sandwich structure, and the mixture is washed three times with PBS buffer, and the precipitate is retained after the third washing;

[0030] S53, add 0.1 mg / ml methylene blue and H2O2 to the above ep tube in sequence;

[0031] Furthermore, in the process of constructing the colorimetric aptasensor, the reaction conditions were optimized, including the reaction time and temperature of the probe and target, the concentration of hydrogen peroxide, the volume ratio of hydrogen peroxide and methylene blue, and the pH of the PBS buffer.

[0032] Another object of the present invention is to provide a construction system of a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, comprising:

[0033] MnTiO3@Pd nanoparticle assembly: a composite structure formed by the reduction of Pd nanoparticles and their attachment to MnTiO3 nanodisks;

[0034] Aptamer probe assembly: capture probe, composed of a single strand of amino nucleotide modified with magnetic beads, designed based on the nucleotide sequence of the target endotoxin aptamer; signal probe, composed of a single strand of DNA bound to MnTiO3@Pd nanoparticles;

[0035] Detection and signal conversion device: used to capture and separate capture probes with target analytes, detect color changes caused by signal probes, and thus achieve quantitative or qualitative analysis of specific endotoxins;

[0036] Control and analysis unit: receives the test signal, processes and analyzes the signal; provides a user interface, displays the test results and allows the user to input parameters or control the test process.

[0037] Another object of the present invention is to provide a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry.

[0038] Another object of the present invention is to provide the application of the magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry in detecting endotoxin in plasma.

[0039] Furthermore, the magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry was used to detect targets of different concentrations, and a standard curve was established.

[0040] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0041] First, in view of the technical problems existing in the above-mentioned prior art and the difficulty in solving the problems, some creative technical effects are brought about after solving the problems. The specific description is as follows:

[0042] The present invention utilizes the characteristics of MnTiO3 and combines the specific recognition function of aptamers to design a colorimetric aptamer sensor for detecting endotoxins in plasma. The aptamer sensor designed by the present invention provides a low-cost, highly sensitive and rapid method for the detection of endotoxins, and can simultaneously perform quantitative and qualitative detection.

[0043] Second, the aptamer sensor designed by the present invention is based on the principle that MnTiO3@Pd nanoparticles can change methylene blue from blue to colorless or lighter in color in the presence of hydrogen peroxide. Compared with the colorimetric reaction catalyzed by enzymes (such as horseradish peroxidase), MnTiO3@Pd nanoparticles are a kind of nanomaterial with stable properties and structure, which is simple to synthesize, not easy to be decomposed, and not easily affected by the temperature environment. The advantages of the present invention are: not only can the endotoxin be qualitatively detected by quickly judging the color change by the naked eye within a few minutes, but also the concentration of endotoxin can be quantitatively detected; the detection of endotoxin using the aptamer sensor does not require expensive instruments and professional technicians, and the method is simple and easy to operate.

[0044] Third, the expected benefits and commercial value of the technical solution of the present invention after transformation are:

[0045] Highly sensitive and specific detection: By using the MnTiO3@Pd nanoparticle colorimetric magnetic bead aptamer sensor, high-sensitivity and specific detection of endotoxins in plasma can be achieved. This means that in medical tests, endotoxins released by bacterial death can be detected more accurately, avoiding errors and interference, and improving the credibility of test results.

[0046] Fast, low-cost, and easy to operate: Compared with traditional detection methods, the sensor of the present invention has the advantages of being fast, low-cost, and easy to operate. This enables more efficient endotoxin detection in medical practice, reduces the complexity and cost of laboratory operations, and improves the practicality of detection.

[0047] Application in multiple medical fields: Endotoxin detection has a wide range of applications in the medical field, especially in blood products, injectable drugs, medical dressings and implantable devices. Therefore, this technical solution is expected to find applications in multiple medical fields, expanding its commercialization possibilities.

[0048] Improvement of anti-enzyme activity: Traditional endotoxin detection methods, such as the horseshoe crab amebocyte lysate test (LAL test), are based on enzyme reactions and are easily interfered by proteases. The present invention uses a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, combining the specificity of the aptamer and the catalytic properties of the MnTiO3 nanodisc, which may improve the ability to resist proteases, thereby improving the reliability of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0050] Figure 1 It is a flow chart of a method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry provided by an embodiment of the present invention;

[0051] Figure 2 It is a flow chart of the synthesis method of MnTiO3@Pd nanoparticles provided in an embodiment of the present invention;

[0052] Figure 3 is a flow chart of a method for synthesizing a signal probe provided by an embodiment of the present invention;

[0053] Figure 4 is a flow chart of a method for constructing a colorimetric aptasensor provided in an embodiment of the present invention; Figure 5 This is a scanning electron microscope image of the MnTiO3 nanodisk provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0054] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0055] In view of the problems existing in the prior art, the technical solution adopted by the present invention is:

[0056] Synthesis of MnTiO3@Pd nanoparticles: MnTiO3 nanodisks with high specific surface area and excellent optical properties were prepared by a simple one-step hydrothermal method, and Pd nanoparticles were reduced on their surface. This nanocomposite material can be used as a signal probe to significantly improve the sensitivity of the sensor.

[0057] Design of specific probes: Based on the nucleotide sequence of the endotoxin aptamer, capture probes and signal probes are designed. These specially designed probes can specifically recognize the target analyte, thereby reducing false positive and false negative results.

[0058] Construction of colorimetric aptamer sensor: A colorimetric sensor was constructed using magnetic beads modified with amino nucleotide single strands and MnTiO3@Pd nanoparticles. The sensor can detect endotoxin visually through color change without complex instruments.

[0059] The technical effects and significant technical progress brought about by the present invention in solving the problems of the prior art are as follows:

[0060] Improved sensitivity and specificity: By using MnTiO3@Pd nanoparticles and specific probes, the sensitivity and specificity of the sensor for specific analytes were significantly improved.

[0061] Easy and quick operation: This method simplifies the detection process, making the operation easier and quicker, and is suitable for use by non-professionals in various environments.

[0062] Reduce costs: By simplifying the synthesis method and detection steps, the material and operation costs are reduced, making the technology easier to apply and popularize on a large scale.

[0063] Wide application: The sensor can be used not only for endotoxin detection in the medical and biological fields, but also in many fields such as environmental monitoring and food safety.

[0064] In view of the problems existing in the prior art, the present invention provides a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, a construction method and an application thereof.

[0065] like Figure 1 As shown, the method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry provided in an embodiment of the present invention comprises the following steps:

[0066] S1, synthesizing MnTiO3 nanodisks by a one-step hydrothermal method, and then reducing Pd nanoparticles onto the nanodisks to synthesize MnTiO3@Pd nanoparticles;

[0067] S2, designing capture probes and signal probes according to the nucleotide sequence of the endotoxin aptamer;

[0068] S3, synthetic capture probe: single-stranded amino nucleotide modified with magnetic beads;

[0069] S4, synthesizing signal probes using ssDNA and MnTiO3@Pd nanoparticles;

[0070] S5, construction of a colorimetric aptasensor using capture probes and signal probes.

[0071] The construction method of the magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry is as follows:

[0072] synthetic materials

[0073] (1) Figure 2As shown in the figure, the synthesis process of MnTiO3 nanodiscs (one-step hydrothermal method): first prepare solution A: add 0.394ml titanium isopropoxide (concentration of 1.25mmol) dropwise into 16ml ethylene glycol, and stir vigorously to form a mixed solution; then prepare solution B: dissolve 247.8mg MnCl2·4H2O in 4ml ethylenediamine. Then, pour solution A into solution B, stir and mix slightly, add H2O dropwise into the mixed solution, add the above mixed solution into a stainless steel autoclave, seal the autoclave, put it into a muffle furnace, and heat it at 200 degrees for 12 hours. Then, when the temperature of the autoclave drops to room temperature, transfer the liquid to a centrifuge tube for centrifugation, and then wash it three times with anhydrous ethanol and ultrapure water. Finally, dry the resulting yellow precipitate in a drying oven. 10 mM Na2PdCl4 (1 ml) was added to the 1 mg / ml MnTiO3 nanodisc aqueous solution, and then ascorbic acid was quickly added to the mixed solution, stirred at room temperature for 3 h, and then centrifuged for washing. Finally, the mixture was resuspended in PBS buffer and placed in a refrigerator at 4 degrees for use.

[0074] (2) After consulting the literature, it was found that the nucleotide sequence of the endotoxin aptamer is: 5'-TTTTTTTTTCTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGA TGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3', and the capture probe and signal probe were designed based on this. Among them, the nucleotide sequence of the capture probe is: 5'-AAAAAGTGTCCGCCTATCTCGTCTCCTGGGGGGCTGACCCTTTATATCAT C-3', and the nucleotide sequence of the signal probe is: 5'-TGGCCAGCGCGATCCGGCTAGGAAGGAGGCGGGCAGAAGAAAAAAAA AGGGG-3'. The above nucleotide chains were synthesized by Sangon Co., Ltd.

[0075] (3) Synthetic capture probe: single-stranded amino nucleotide modified with magnetic beads.

[0076] (4) Figure 3 As shown, the signal probe was synthesized by placing equal volumes of ssDNA and MnTiO3@Pd nanoparticles in a 4-degree refrigerator with slight stirring overnight, centrifuging and washing with PBS buffer three times. Then, 1% BSA was added to block its nonspecific binding sites, centrifuged and washed with PBS buffer three times. Finally, it was resuspended in PBS buffer and placed in a 4-degree refrigerator for use.

[0077] like Figure 4As shown, a colorimetric aptamer sensor was constructed: quantitative aptamer and target were added to the ep tube, reacted at room temperature for 2 hours, and then the above reaction solution was added to the pre-prepared detection reagent (containing MB-Cp and MnTiO3@Pd-Sp), and reacted at room temperature for 2 hours; after the above reaction was completed, a magnetic stand was used to remove the components that did not form a sandwich structure, and washed three times with PBS buffer, and the precipitate was retained after the third wash; 0.1 mg / ml methylene blue and H2O2 were added to the ep tube in sequence.

[0078] Optimization of reaction conditions: The reaction time and temperature of the probe and target, the concentration of hydrogen peroxide, the volume ratio of hydrogen peroxide and methylene blue, and the pH of the PBS buffer were optimized.

[0079] Establishing a standard curve: The aptamer sensor designed by the present invention is used to detect targets of different concentrations to establish a standard curve.

[0080] A known concentration of endotoxin was added to PBS buffer to prepare a sample to be tested. The MnTiO3@Pd nanoparticle colorimetric magnetic bead aptamer sensor designed by the present invention was used to quantitatively detect the concentration of the sample to be tested. At the same time, an enzyme-linked immunosorbent assay was used to detect the concentration of the same sample to be tested, and the detection results of the two methods were compared.

[0081] In addition, the aptamer sensor designed by the present invention and the enzyme-linked immunosorbent assay were used to detect the same plasma sample, and the detection results of the two were compared.

[0082] The embodiments of the present invention have achieved some positive effects during the development or use process, and indeed have great advantages over the prior art. The following content is described in conjunction with data, charts, etc. of the test process.

[0083] First, MnTiO3 nanodisks were synthesized using a one-step hydrothermal method. Scanning electron microscopy results showed that ( Figure 5 ) Its morphology is disc-shaped, thin, uniform in size, and the particle size is about 300-400nm.

[0084] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry, characterized in that: The following steps are involved: S1, synthesizing MnTiO3 nanodisks by a one-step hydrothermal method, and then reducing Pd nanoparticles onto the nanodisks to synthesize MnTiO3@Pd nanoparticles; S2, designing capture probes and signal probes according to the nucleotide sequence of the endotoxin aptamer; S3, synthetic capture probe: single-stranded amino nucleotide modified with magnetic beads; S4, synthesizing signal probes using ssDNA and MnTiO3@Pd nanoparticles; S5, construction of a colorimetric aptasensor using capture probes and signal probes.

2. The method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry according to claim 1, characterized in that: The specific steps for synthesizing MnTiO3@Pd nanoparticles in S1 are: S11, preparing solution A: adding 0.394 ml of 1.25 mmol titanium isopropoxide dropwise into 16 ml of ethylene glycol, and stirring vigorously to form a mixed solution; S12, prepare solution B: dissolve 247.8 mg MnCl2·4H2O in 4 ml ethylenediamine; S13, pouring solution A into solution B, stirring briefly to mix, and then adding H2O dropwise to the mixture; S14, adding the mixed solution into a stainless steel autoclave, sealing the autoclave and placing it into a muffle furnace, and heating at 200 degrees for 12 hours; S15, when the temperature of the autoclave drops to room temperature, the liquid is transferred to a centrifuge tube and centrifuged, then washed three times with anhydrous ethanol and ultrapure water, and the obtained yellow precipitate is dried in a drying oven; S16, add 10mM Na2PdCl4 (1ml) to the 1mg / ml MnTiO3 nanodisc aqueous solution, then quickly add ascorbic acid to the mixed solution, stir for 3h at room temperature, then centrifuge and wash, finally resuspend in PBS buffer and place in a 4 degree refrigerator for use.

3. The method for constructing a magnetic bead aptasensor based on MnTiO3 nanodisc colorimetry according to claim 1, characterized in that: The nucleotide sequence of the endotoxin aptamer in S2 is: 5'-TTTTTTTTTCTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGAT GATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; the nucleotide sequence of the capture probe is: 5'-AAAAAGTGTCCGCCTATCTCGTCTCCTGGGGGGCTGACCCTTTATATCATC-3', and the nucleotide sequence of the signal probe is: 5'-TGGCCAGCGCGATCCGGCTAGGAAGGAGGCGGGCAGAAGAAAAAAAAAGGGG-3'.

4. The method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry according to claim 1, characterized in that: The specific steps for synthesizing the signal probe in S4 are: S41, equal volumes of ssDNA and MnTiO3@Pd nanoparticles were placed in a 4°C refrigerator with slight stirring overnight, centrifuged and washed three times with PBS buffer; S42, 1% BSA was added to block its nonspecific binding sites, and the cells were washed three times with PBS buffer after centrifugation; S43, resuspended in PBS buffer and placed in a refrigerator at 4 degrees until use.

5. The method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry according to claim 1, characterized in that: The specific steps for constructing the colorimetric aptasensor in S5 are: S51, add the quantitative aptamer and target to the ep tube, react at room temperature for 2 h, then add the above reaction solution to the pre-prepared detection reagent (containing MB-Cp and MnTiO3@Pd-Sp), and react at room temperature for 2 h; S52, after the above reaction is completed, a magnetic stand is used to remove the components that have not formed a sandwich structure, and the mixture is washed three times with PBS buffer, and the precipitate is retained after the third washing; S53, add 0.1 mg / ml methylene blue and H2O2 to the above ep tube in sequence.

6. The method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry according to claim 1, characterized in that: In the process of constructing the eubicolor aptamer sensor, the reaction conditions were optimized, including the reaction time and temperature of the probe and target, the concentration of hydrogen peroxide, the volume ratio of hydrogen peroxide and methylene blue, and the pH of the PBS buffer.

7. A system for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry according to the method of claim 1, characterized in that: include: MnTiO3@Pd nanoparticle assembly: a composite structure formed by the reduction of Pd nanoparticles and their attachment to MnTiO3 nanodisks; Aptamer probe assembly: capture probe, composed of a single strand of amino nucleotide modified with magnetic beads, designed based on the nucleotide sequence of the target endotoxin aptamer; signal probe, composed of a single strand of DNA bound to MnTiO3@Pd nanoparticles; Detection and signal conversion device: used to capture and separate capture probes with target analytes, detect color changes caused by signal probes, and thus achieve quantitative or qualitative analysis of specific endotoxins; Control and analysis unit: receives the test signal, processes and analyzes the signal; provides a user interface, displays the test results and allows the user to input parameters or control the test process.

8. A magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry constructed by the method for constructing a magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry as claimed in any one of claims 1 to 6.

9. Use of the magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry as claimed in claim 8 in detecting endotoxin in plasma.

10. The use of the magnetic bead aptamer sensor based on MnTiO3@Pd nanoparticle colorimetry in detecting endotoxin in plasma as claimed in claim 9, characterized in that: The target with different concentrations was detected using the magnetic bead aptasensor based on MnTiO3@Pd nanoparticle colorimetry, and a standard curve was established.

Images