Gold nanorod and preparation method and application thereof

Abstract

The invention discloses a preparation method of gold nanorods. The preparation method comprises the following steps: preparing a gold seed solution; the preparation method comprises the following steps: preparing gold nanorods, and sequentially adding 5-10mL of a CTAB (Cetyltrimethyl Ammonium Bromide) solution with the concentration of 0.2 mol / L, 2mL of a HAuCl4 solution with the concentration of 0.2 mol / L and 0.5 mL of a Vc solution with the concentration of 0.0788 mol / L into a container while stirring under the condition of a constant-temperature water bath at 28 DEG C until the solution in the container is colorless; the volume of the container is kept to be 25 mL, and 50 microliters of the prepared gold seed solution is continuously added into the container; adding 0.65 mL of NaCl solution with the concentration of 4 mol / L after the reaction is completed in the container, keeping the temperature for a period of time, then removing supernate, and centrifugally washing precipitate to obtain the gold nanorod; compared with the prior art, the preparation method has the following technical effects that the length-diameter ratio of the prepared gold nanorod is 8-15, the gold nanorod can be directly matched with an aptamer to enable the aptamer to be uniformly and electrostatically adsorbed on the surface of the gold nanorod, and a good effect is shown when profenofos in a pesticide is detected.

Description

Technical Field

[0001] The invention relates to the technical field of pesticide residue detection, and in particular to a gold nanorod and a preparation method and application thereof. Background Art

[0002] With the development of the agricultural industry, pests and diseases have become increasingly prominent, and pesticides are widely used for prevention and control. Organophosphate pesticides (OPPs) are a class of organic compound pesticides containing phosphorus, and are one of the commonly used pesticides in crops. They mainly protect crops and plants from pests and diseases, and weeds, and increase crop yields. However, excessive organophosphates will remain in vegetables and fruits, causing food safety problems, and infiltrate into soil and water, causing environmental pollution. Therefore, the detection and regulation of OPPs are receiving more and more attention.

[0003] Traditional detection methods mainly focus on chromatographic technology, including gas chromatography (GC) and high performance liquid chromatography (HPLC). However, the above detection methods have the disadvantages of complex operation, cumbersome pre-treatment, long detection time and high cost. In addition, other detection methods such as molecular methods and enzyme-linked immunosorbent assay (ELISA) are also used for the detection of organophosphorus due to their high sensitivity, but they also have limitations such as complex sample processing and insufficient remote sensing capabilities. Immunological detection methods are simple, rapid, low-cost and can be screened on a large scale. However, these methods are based on the specific binding of antigens and antibodies. The full antigens and antibodies of organophosphorus are protein molecules, which are easily inactivated and denatured under extreme detection environments such as high temperature, strong acid and strong alkali.

[0004] In order to solve the above problems, CN113252631A discloses a fluorescent colorimetric nucleic acid aptamer sensor for dual detection of bromophos pesticide, comprising platinum / gold / rhodium nanoparticles, metal mesh-graphene oxide and fluorescent group-modified bromophos nucleic acid aptamer; wherein the fluorescent group-modified bromophos nucleic acid aptamer is non-specifically adsorbed on the platinum / gold / rhodium nanoparticles, and then non-specifically adsorbed with the metal mesh-graphene oxide to form an assembly, which is the fluorescent colorimetric nucleic acid aptamer sensor for dual detection of bromophos pesticide.

[0005] The aptamer Apt for the pesticide Profenofos in the fluorescent colorimetric aptamer sensor is used to adsorb to the metal mesh-graphene oxide and specifically recognize and bind to the pesticide Profenofos. However, the Profenofos aptamer needs to be modified with a fluorescent group before it can be combined with platinum / gold / rhodium nanoparticles to detect Profenofos in pesticides.

[0006] At the same time, further searching also found a method for preparing a PD-L1 aptamer-modified gold nanorod material APDL1@GNR in CN116688121A, including preparing gold nanoseeds, preparing gold nanorods and preparing PD-L1 aptamer gold nanorod APDL1@GNR;

[0007] The preparation of the PD-L1 aptamer gold nanorod APDL1@GNR comprises mixing the thiol-modified PD-L1 aptamer APDL1-SH and the gold nanorod aqueous solution evenly, stirring overnight and then centrifuging to obtain APDL1@GNR.

[0008] Among them, the PD-L1 aptamer APDL1-SH also needs to be modified with thiol groups before it can be combined with gold nanorods to be effectively used.

[0009] In summary, due to the poor adhesion ability of currently prepared gold nanoparticles, nucleic acid aptamers need to be modified before they can be combined with gold nanoparticles for applications such as the detection of bromophos in pesticides. Summary of the invention

[0010] In view of the deficiencies in the prior art, the purpose of the present invention is to provide a gold nanorod and a preparation method and application thereof, so as to solve the problem in the prior art that the adhesion ability of the currently prepared gold nanoparticles is poor and the nucleic acid aptamers need to be modified before they can be combined with the gold nanoparticles to detect bromophos in pesticides.

[0011] To achieve the above object, the first aspect of the present invention adopts the following technical solution: a method for preparing gold nanorods, comprising the following steps:

[0012] preparing gold seed solution;

[0013] To prepare gold nanorods, 5-10 mL of 0.2 mol / L CTAB solution, 2 mL of 0.2 mmol / L HAuCl4 solution and 0.5 mL of 0.0788 mol / L Vc solution were sequentially added to the container under a constant temperature water bath at 28°C, stirring until the solution in the container was colorless; then the volume of the container was fixed to 25 mL, and 50 μL of the prepared gold seed solution was continuously added to the container; after the reaction in the container was completed, 0.65 mL of 4 mol / L NaCl solution was added, the temperature was kept constant for a period of time, and then the supernatant was removed and the precipitate was washed by centrifugation to obtain the gold nanorods.

[0014] Technical principle:

[0015] The preparation method can obtain gold nanorods with regular structure, while increasing or decreasing the amount of CTAB solution cannot obtain gold nanorods with regular structure. It is unexpectedly found that the prepared gold nanorods have good adhesion ability. When mixed with aptamers, the aptamers do not need to be modified first. Instead, after the gold nanorods and the aptamers are directly mixed, the aptamers can be uniformly electrostatically adsorbed on the surface of the gold nanorods, showing a good effect in the detection of bromophos in pesticides.

[0016] The second aspect of the present invention adopts the following technical solution: a gold nanorod is prepared according to the preparation method of the gold nanorod described in the first aspect of the present invention.

[0017] The third aspect of the present invention adopts the following technical solution: an application of the gold nanorods described in the second aspect of the present invention to the detection of bromophos in pesticides.

[0018] The fourth aspect of the present invention adopts the following technical solution: a detection method for the detection of bromophos in pesticides using a gold nanorod according to the second aspect of the present invention, comprising the following steps:

[0019] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution and 25 μL of an aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added to react at room temperature. After the reaction is completed, 5-55 μL of a 10 μg / mL profenofos mother solution is added to react. After the reaction is completed, a detection solution is formed.

[0020] The prepared test solution was tested by UV-visible absorption spectroscopy.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The aspect ratio of the gold nanorods prepared by the present invention is 8-15, and the gold nanorods can be directly matched with the aptamer to make the aptamer uniformly electrostatically adsorbed on the surface of the gold nanorods, thereby showing a good effect in the detection of bromophos in pesticides;

[0023] 2. This detection method has a low detection limit and is more accurate. It also has the advantages of low cost, simple operation, good chemical stability and ease of use. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a SEM image of the gold nanorods prepared in Example 1 of the present invention;

[0025] Figure 2 This is a SEM image of the gold nanorods prepared in Example 2 of the present invention;

[0026] Figure 3 This is a SEM image of the gold nanorods prepared in Example 3 of the present invention;

[0027] Figure 4 This is a SEM image of the gold nanoparticles prepared in Example 4 of the present invention;

[0028] Figure 5 This is a SEM image of the gold nanoparticles prepared in Example 5 of the present invention;

[0029] Figure 6 This is a SEM image of the gold nanoparticles prepared in Example 6 of the present invention;

[0030] Figure 7 This is a schematic diagram of the detection principle of propyl bromide by the gold nanorods in the application process of the present invention;

[0031] Figure 8 It is the UV-visible absorption spectrum of application 1 in the present invention;

[0032] Fig. 9 It is the UV-visible absorption spectrum of Application 2 in the present invention;

[0033] Fig.10 It is the UV-visible absorption spectrum of application 3 in the present invention;

[0034] Fig.11 a is a UV-visible absorption spectra of gold nanorods in four systems of gold nanorods, gold nanorods-profenofos, gold nanorods-aptamer-salt, and gold nanorods-aptamer-salt-profenofos in Application 4, Comparative Application 1, Comparative Application 2, and Comparative Application 3 of the present invention;

[0035] Fig.11 b is a UV-visible absorption spectrum of gold nanorods obtained at different room temperature incubation times of the present invention;

[0036] Fig.11 c is the UV-visible absorption spectra of gold nanorods obtained at different aptamer concentrations of the present invention;

[0037] Fig.11 d is the UV-visible absorption spectra of the gold nanorods and the gold nanorod-aptamer complex at different salt concentrations at 500 nm and 508 nm respectively;

[0038] Fig.12 This is a characteristic analysis diagram of the biosensor of the present invention for different pesticides.

[0039] The reference numerals in the drawings of the specification include: . DETAILED DESCRIPTION

[0040] The present invention is further described in detail below through specific embodiments:

[0041] Preparation of gold seed solution:

[0042] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0043] Preparation of gold nanorods:

[0044] Under the condition of a constant temperature water bath at 28°C, 5-10mL of 0.2mol / L CTAB solution was added to the round-bottom flask, bubbles were removed, and then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, the temperature was kept constant for 12 hours, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugation at a speed of 10000r / min. The brown precipitate was gold nanorods.

[0045] Applications of Gold Nanorods:

[0046] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution and 25 μL aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature for 20 minutes. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added and allowed to react at room temperature for 10 minutes. After the reaction is completed, 5-55 μL of a 10 μg / mL profenofos mother solution is added to react for 10 minutes. After the reaction is completed, a detection solution is formed.

[0047] The prepared test solution was tested by UV-visible absorption spectroscopy.

[0048] Wherein, the aptamer is:

[0049] AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGC TACGC (Shanghai Bioengineering).

[0050] In the study, it was found that the prepared gold seed solution was brown-yellow, and the gold nanorods synthesized immediately were more uniform and had controllable morphology; when the prepared gold seed solution was placed for 2 days, the gold seed solution turned red, and triangular or trapezoidal block gold nanoparticles appeared when synthesizing gold nanorods; the gold seed solution that was placed for a longer time turned orange-yellow, and the prepared products were mostly polyhedrons. It is considered that due to the non-directional growth of the gold seed solution in the CTAB solution, uneven gold nanoparticles will be formed, resulting in the lateral and longitudinal diversified growth of the gold seed solution, and the morphology is varied. Therefore, the preparation of the gold seed solution is the first process of the growth method, which directly affects the morphology.

[0051] The preparation of gold nanorods is a process of longitudinal orderly growth. When the amount of chloroauric acid and reducing agent is constant, the amount of surfactant CTAB has a greater influence on the morphology. When CTAB is insufficient, only gold nanoparticles or short strip particles can be generated. As CTAB increases, there will be a trace of short rods, but small particles are still the main part. The increase in CTAB promotes longitudinal growth to produce a large number of short nanorods, about 140nm long and 16nm wide. When the amount of CTAB continues to increase, the gold nanorods are uniform, about 185nm long and 16nm wide. When the amount of CTAB reaches the optimal amount, the gold nanorods are long, about 240nm long, 16nm wide, and uniform. Excessive CTAB will lead to the generation of a large number of blocks, which may be caused by disordered growth in the longitudinal and lateral directions, resulting in variable morphology. Therefore, the amount of CTAB added is an important factor in controlling the aspect ratio of gold nanorods.

[0052] In the present invention, the gold nanorod solution is formed by dispersing the gold nanorods prepared by the invention into ultrapure water, and the optical density value under 508nm ultraviolet light detection is 0.28, which is recorded as: OD 508 It is 0.28.

[0053] Example 1

[0054] Preparation of gold seed solution:

[0055] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0056] Preparation of gold nanorods:

[0057] Under the condition of a constant temperature water bath at 28°C, 5 mL of 0.2 mol / L CTAB solution was added to the round-bottom flask, bubbles were removed, and then 2 mL of 0.2 mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5 mL of 0.0788 mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25 mL, and 50 μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65 mL of 4 mol / L NaCl solution was added, the temperature was kept constant for 12 hours, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugation at a speed of 10000 r / min. The brown precipitate was gold nanorods.

[0058] After testing and calculation, the aspect ratio R of this gold nanorod is approximately equal to 8.

[0059] Example 2

[0060] Preparation of gold seed solution:

[0061] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0062] Preparation of gold nanorods:

[0063] Under the condition of a constant temperature water bath at 28°C, 7.5mL of 0.2mol / L CTAB solution was added to the round-bottom flask, bubbles were removed, and then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, the temperature was kept constant for 12 hours, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugation at a speed of 10000r / min. The brown precipitate was gold nanorods.

[0064] After testing and calculation, the aspect ratio R of this gold nanorod is approximately equal to 12.

[0065] Example 3

[0066] Preparation of gold seed solution:

[0067] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0068] Preparation of gold nanorods:

[0069] Under the condition of a constant temperature water bath at 28°C, 10mL of 0.2mol / L CTAB solution was added to the round-bottom flask, bubbles were removed, and then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, the temperature was kept constant for 12 hours, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugation at a speed of 10000r / min. The brown precipitate was gold nanorods.

[0070] After testing and calculation, the aspect ratio R of this gold nanorod is approximately equal to 15.

[0071] Example 4

[0072] Preparation of gold seed solution:

[0073] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0074] Preparation of gold nanoparticles:

[0075] Under the condition of a constant temperature water bath at 28°C, 2.5mL of 0.2mol / L CTAB solution was added to the round-bottom flask, bubbles were removed, and then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, the temperature was kept constant for 12 hours, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugal washing at a speed of 10000r / min.

[0076] Example 5

[0077] Preparation of gold seed solution:

[0078] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0079] Preparation of gold nanoparticles:

[0080] Under the condition of a constant temperature water bath at 28°C, 3.5mL of 0.2mol / L CTAB solution was added to the round-bottom flask, and bubbles were eliminated. Then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, and the temperature was kept constant for 12 hours. After that, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugal washing at a speed of 10000r / min.

[0081] Example 6

[0082] Preparation of gold seed solution:

[0083] Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution, stirring while dropping until the solution turns bright light yellow, then add 0.6 mL of 0.1 mol / L NaBH4 solution, and continue stirring for 2 min. Stop stirring when the solution turns brown-yellow, and let it stand at 28°C for 2 h for use.

[0084] Preparation of gold nanoparticles:

[0085] Under the condition of a constant temperature water bath at 28°C, 15mL of 0.2mol / L CTAB solution was added to the round-bottom flask, and bubbles were eliminated. Then 2mL of 0.2mmol / L HAuCl4 solution was added dropwise, stirred, and then 0.5mL of 0.0788mol / L Vc solution was added until the solution in the round-bottom flask became colorless; the volume of the round-bottom flask was then fixed to 25mL, and 50μL of the prepared gold seed solution was continued to be added to the round-bottom flask; after the reaction in the round-bottom flask was completed, 0.65mL of 4mol / L NaCl solution was added, and the temperature was kept constant for 12 hours. After that, the purple-red supernatant was removed, and the brown precipitate was collected by centrifugal washing at a speed of 10000r / min.

[0086] During the preparation process, it was found that the gold nanorods prepared in Examples 1 to 3 were evenly distributed, while the products of Examples 4 and 5 were mainly gold nanoparticles, and the product of Example 6 was mainly gold nanoblocks, and the aspect ratio could not be detected; the products of Examples 4, 5 and 6 were prepared according to the above-mentioned application of gold nanorods (wherein, 5-55 μL of 10 μg / mL bromophos mother solution), and it was found that this application could not be completed; the inventors further studied and analyzed and concluded that the aptamer could not be evenly adsorbed on the surface of the product, resulting in the inability to detect bromophos.

[0087] The localized surface plasmon resonance characteristics of gold nanorods are affected by material morphology, surface properties, environmental media or particle spacing, which triggers changes in the ultraviolet-visible absorption peak of the gold nanorods, which serves as an optical signal for detection; the propyl bromide molecule and the aptamer have the characteristic of specific binding, which is used as a detection and identification element to establish the relationship between the content of the pesticide propyl bromide and the strength of the ultraviolet-absorption signal of the gold nanorods to achieve detection. The detection principle of gold nanorods for propyl bromide during application is as follows Figure 7 :

[0088] (1) Stable state of aptamer and gold nanorods in the absence of target. In the absence of bromophos, the aptamer is electrostatically adsorbed on the surface of gold nanorods, maintaining the gold nanorods in a stable dispersed state in the high salt system, and the strong ultraviolet absorption of the gold nanorods is not affected.

[0089] (2) When the target is present, the aptamer specifically binds to the target. After adding bromofos to the system, the aptamer preferentially binds to bromofos to form a target-aptamer complex. The gold nanorods without aptamer protection will aggregate in the salt solution system, and the UV-visible absorption peak intensity will decrease or red-shift, establishing a relationship between the optical signal and the bromofos concentration.

[0090] It should be noted that: Figure 7The GNRs in the graphene are gold nanorods.

[0091] The gold nanorods prepared in Examples 1 to 3 were used in the following specific applications:

[0092] Application 1

[0093] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution (the gold nanorod solution is formed by dispersing the gold nanorods prepared in Example 1 into ultrapure water) and 25 μL of an aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature for 20 minutes. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added and allowed to react at room temperature for 10 minutes. After the reaction is completed, 5 μL of a 10 μg / mL profenofos mother solution is added to react for 10 minutes. After the reaction is completed, a detection solution is formed.

[0094] The prepared test solution was tested by UV-visible absorption spectroscopy, and its UV-visible absorption spectrum was as shown in Figure 8 .

[0095] Application 2

[0096] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution (the gold nanorod solution is formed by dispersing the gold nanorods prepared in Example 2 into ultrapure water) and 25 μL of an aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature for 20 minutes. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added and allowed to react at room temperature for 10 minutes. After the reaction is completed, 5 μL of a 10 μg / mL profenofos mother solution is added to react for 10 minutes. After the reaction is completed, a detection solution is formed.

[0097] The prepared test solution was tested by UV-visible absorption spectroscopy, and its UV-visible absorption spectrum was as shown in Fig. 9 .

[0098] Application 3

[0099] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution (the gold nanorod solution is formed by dispersing the gold nanorods prepared in Example 3 into ultrapure water) and 25 μL of an aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature for 20 minutes. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added and allowed to react at room temperature for 10 minutes. After the reaction is completed, 5 μL of a 10 μg / mL profenofos mother solution is added to react for 10 minutes. After the reaction is completed, a detection solution is formed.

[0100] The prepared test solution was tested by UV-visible absorption spectroscopy, and its UV-visible absorption spectrum was as shown in Fig.10 .

[0101] The dosage of the bromophos mother solution in Application 3 is further adjusted below. Specifically, the amount of bromophos mother solution added is adjusted to 10 μL, 15 μL, 20 μL, 25 μL, 30 μL, 35 μL, 40 μL, 45 μL, 50 μL and 55 μL, respectively. Then, the relationship between the absorbance change at 508 nm and the bromophos concentration is established through UV-visible absorption spectrum test, and the following linear relationship is obtained:

[0102] y=-0.000137x+0.373023,R 2 =0.990118.

[0103] Application 4

[0104] Application 4 is the same as Application 3 above, except that the amount of bromophos mother solution added is adjusted to 55 μL.

[0105] Comparison application 1

[0106] Add 1200 μL of OD to the centrifuge tube. 508 The gold nanorod solution with a concentration of 0.28 was tested by UV-visible absorption spectroscopy.

[0107] Comparison application 2

[0108] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28% gold nanorod solution and 55 μL of a 10 μg / mL bromophos mother solution are reacted to form a detection solution after the reaction is completed;

[0109] The prepared test solution was tested by UV-visible absorption spectroscopy.

[0110] Comparison application 3

[0111] Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution (the gold nanorod solution is formed by dispersing the gold nanorods prepared in Example 3 into ultrapure water) and 25 μL of aptamer with a concentration of 10 μmol / L are mixed evenly and incubated at room temperature for 20 minutes. After the room temperature incubation is completed, 25 μL of NaCl solution with a concentration of 1 mol / L is added and allowed to react at room temperature for 10 minutes; after the static reaction is completed, a detection solution is formed;

[0112] The prepared test solution was tested by UV-visible absorption spectroscopy.

[0113] The changes of the UV-visible absorption spectra of gold nanorods in the four systems of gold nanorods, gold nanorods-profenofos, gold nanorods-aptamer-salt, and gold nanorods-aptamer-salt-profenofos in Application 4, Comparative Application 1, Comparative Application 2, and Comparative Application 3 are shown in Figure 2. Fig.11 As shown in a, the maximum ultraviolet absorption of gold nanorods is at 500nm. After adding bromophos, the ultraviolet absorption of gold nanorods will not be changed; the aptamer binding to gold nanorods will cause the ultraviolet absorption peak to red-shift to 508nm, and the aptamer can protect the dispersion state of gold nanorods in the high salt system; after bromophos is added to the system, the aptamer preferentially binds to it, the gold nanorods lose protection, and the absorbance at 508nm will decrease, indicating that the detection is feasible.

[0114] It should be noted that the UV-visible absorption spectrum test is an existing technology and will not be described in detail here.

[0115] Based on Application 4, the room temperature incubation time was changed to 10 min, 15 min, 25 min and 30 min respectively, and then the UV-visible absorption spectrum test was performed; Fig.11 b. It can be seen that, from the perspective of incubation time, it takes a certain incubation time for the opened aptamer DNA single strand to bind to the gold nanorod. The results show that the binding process is fast and can be stable in 20 minutes. The maximum ultraviolet absorption peak of the gold nanorod-aptamer complex is red-shifted to 508nm, and the absorbance increases slightly. Therefore, the incubation time of the aptamer is 20 minutes.

[0116] Based on Application 4, the aptamer concentrations were changed to 0 μmol / L, 0.16 μmol / L, and 0.24 μmol / L, respectively, and then UV-visible absorption spectroscopy was performed; Fig.11 c. It can be seen that the amount of aptamers bound to the gold nanorod surface through electrostatic adsorption is limited, and the aptamer concentration will affect the ultraviolet absorption of the gold nanorods. When 25 μL of aptamers are added to the reaction system, that is, the aptamer concentration in the system is 0.2 μmol / L, the amount of aptamers bound to the gold nanorod surface reaches stability, and the absorbance of the gold nanorod-aptamer complex at 508 nm reaches the maximum. Therefore, the optimal concentration of the aptamer is 0.2 μmol / L.

[0117] The UV absorption performance of gold nanorods is affected by the concentration of NaCl solution in the system. The high salt system causes the gold nanorods to aggregate and lose their UV properties, which is the basis for detection. The experiment examined the effects of different salt concentrations on the UV absorption of pure gold nanorods and gold nanorod-aptamer complexes at 500nm and 508nm, respectively. The results are shown in Fig.11d. Compared with the same NaCl solution concentration in the system, the stability of gold nanorods is worse than that of gold nanorod-aptamer complexes, which is more affected by salt concentration and has a greater decrease in absorbance. When the salt concentration is 0-16mmol / L, the absorbance of the gold nanorod-aptamer complex decreases less, indicating that the aptamer can stabilize the gold nanorods in the low-salt system to keep the performance basically unchanged, and the corresponding gold nanorod absorbance decreases slightly; the salt concentration of 20mmol / L is the inflection point (hollow point in the figure), and the absorbance of the gold nanorod-aptamer complex also begins to decrease, which means that the aptamer has played the maximum protective role; in the control group, the absorbance of the gold nanorods decreases significantly at this time, that is, the gold nanorods begin to agglomerate in large quantities, affecting their ultraviolet performance. Therefore, the NaCl solution concentration of 20mmol / L is selected as the optimal reaction concentration.

[0118] Finally, a calibration curve for bromophos detection was established based on the absorbance value at 508 nm, and (F-F0) / F0 was used for detection, where F0 and F were the absorbances without bromophos and with bromophos, respectively. The linear regression equation was y=0.0004x+0.0126, with a high regression coefficient (r2=0.9901) and a wide linear concentration range (41-460 μg / L). The detection limit (31.93 μg / L) was calculated with reference to the literature Zhao.

[0119] The profenofos mother solution in Application 4 was replaced with five commonly used pesticides, namely, avermectin, acetamiprid, trichlorfon, phoxim and imidacloprid. The concentrations of profenofos in the five commonly used pesticides, namely, avermectin, acetamiprid, trichlorfon, phoxim and imidacloprid, were all 250 μg L-1. The test results are as follows: Fig.12 As shown, Fig.12 The six columns in the figure are the results of the detection of bromophos mother solution, avermectin, acetamiprid, trichlorfon, phoxim and imidacloprid from left to right. It was found that trichlorfon and phoxim are both organophosphorus pesticides, which has an impact on the detection. Therefore, the biosensor based on aptamer gold nanorods has the characteristics of identifying organophosphorus pesticides and has certain applicability.

[0120] To verify the practicality of this method, the content of bromophos in fresh cucumber and citrus juice samples was determined. The results showed that bromophos was not detected in both samples. Then 80μg L-1, 200μg L-1 and 450μg L-1 of bromophos were added to the fresh cucumber and citrus juice samples, and analyzed according to the detection method in this scheme, and the standard recovery test was completed. The results are shown in Table 1:

[0121] Table 1 Detection test of propyl bromide in fruit and vegetable samples (n=3)

[0122]

[0123] Table 1 shows that the sample recovery rate of cucumber juice is 92.67% to 104.41%; the sample recovery rate of citrus juice is 90.46% to 93.37%, indicating that the bio-optical sensor formed by the gold nanorods and aptamers prepared by this method has certain feasibility in the analysis and detection of bromophos pesticide residues in fruits and vegetables using ultraviolet spectrophotometry.

[0124] Table 2 Comparison with different determination methods reported in the literature

[0125]

[0126] The method of the present invention was compared with the bromophos detection method reported in the literature, and the results showed that the method for detecting bromophos based on the gold nanorod-aptamer biosensor established in this study has a low detection limit and is more accurate, and also has the advantages of low cost, simple operation, good chemical stability, and easy use.

[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A method for preparing gold nanorods, characterized in that: The steps include: preparing gold seed solution; To prepare gold nanorods, 5-10 mL of 0.2 mol / L CTAB solution, 2 mL of 0.2 mmol / L HAuCl4 solution and 0.5 mL of 0.0788 mol / L Vc solution were sequentially added to the container under a constant temperature water bath at 28°C, stirring until the solution in the container was colorless; then the volume of the container was fixed to 25 mL, and 50 μL of the prepared gold seed solution was continuously added to the container; after the reaction in the container was completed, 0.65 mL of 4 mol / L NaCl solution was added, the temperature was kept constant for a period of time, and then the supernatant was removed and the precipitate was washed by centrifugation to obtain the gold nanorods.

2. The method for preparing gold nanorods according to claim 1, characterized in that: The process of preparing the gold seed solution is as follows: Add 5 mL of 0.5 mmol / L HAuCl4 solution into 5 mL of 0.2 mol / L CTAB solution and stir until the solution turns bright light yellow. Then add 0.6 mL of 0.1 mol / L NaBH4 solution and stir for the preset time until the solution turns brown-yellow. Stop stirring and let stand at 28°C for use.

3. A method for preparing gold nanorods according to claim 1 or 2, characterized in that: The amount of the CTAB solution added was 10 mL.

4. A gold nanorod, characterized in that: The gold nanorods are prepared according to the method for preparing the gold nanorods according to any one of claims 1 to 3.

5. An application of the gold nanorod according to claim 4 for detecting bromophos in pesticides.

6. A detection method for detecting bromophos in pesticides using a gold nanorod according to claim 4, characterized in that: The following steps are involved: Add 1200 μL of OD to the centrifuge tube. 508 A 0.28 gold nanorod solution and 25 μL of an aptamer with a concentration of 10 μmol / L are evenly mixed and incubated at room temperature. After the room temperature incubation is completed, 25 μL of a 1 mol / L NaCl solution is added to react at room temperature. After the static reaction is completed, 5-55 μL of a 10 μg / mL bromophos mother solution is added to react. After the reaction is completed, a detection solution is formed. The prepared detection solution is tested by UV-visible absorption spectroscopy.

Images