Full-degradable controlled-release granular fertilizer based on Sanzan gum as well as preparation method and application of full-degradable controlled-release granular fertilizer

Abstract

The invention discloses a fully-degradable controlled-release granular fertilizer based on Sanzan gum as well as a preparation method and application of the fully-degradable controlled-release granular fertilizer, and belongs to the technical field of fertilizers. The preparation method comprises the following steps: carrying out alkali treatment on Sanzan gum, compounding with bentonite, kaolin, humic acid and calcium sulfate, further treating with a pyridine-acetic anhydride solution by taking inorganic acid, organic acid or calcium chloride as a stationary liquid, and drying to obtain the fully-degradable controlled-release granular fertilizer based on Sanzan gum. The production process of the sustained and controlled release granular fertilizer is simpler and more convenient to form, the preparation efficiency is remarkably improved, a shell-core structure formed by compounding and modifying the Sanzan gum can load a large amount of fertilizer nutrients, and the sustained and controlled release granular fertilizer has the advantages of good water resistance, high mechanical strength and good stability; the Sanzan gum and the humic acid used for preparing the granular fertilizer are both natural polymer materials and can be completely degraded, so that the granular fertilizer is an environment-friendly sustainable green fertilizer.

Description

Technical Field

[0001] The invention belongs to the technical field of fertilizers and relates to controlled-release fertilizers, in particular to a fully degradable slow-release granular fertilizer based on tri-zan gum and a preparation method and application thereof. Background Art

[0002] Against the backdrop of global sustainable agricultural development and increasing awareness of environmental protection, the demand for efficient and environmentally friendly fertilizers is becoming increasingly urgent. As a frontier area of ​​new fertilizer research and application, polymer-coated slow-release fertilizers can prolong nutrient release time and release fertilizer nutrients in a controllable manner by forming a dense coating composed of polymers on the outer layer of the fertilizer core, controlling the nutrient release rate to match the plant's growth cycle, thereby improving the utilization efficiency of nutrients. This technology has been widely used in the planting of a variety of crops such as food crops, cash crops and horticultural crops, promoting crop growth, increasing yield and quality, and reducing the potential impact of excessive fertilizer use on the environment.

[0003] Polymer coating materials can be divided into two categories according to their sources: synthetic polymers and natural polymers. Synthetic polymer materials are prepared by chemical synthesis methods and have the advantages of stable performance, precise control and high mechanical strength. For example, synthetic polymer film materials such as thermoplastic polyethylene and thermosetting polyurethane can efficiently control the release rate of fertilizers, and can adjust the material properties according to the nutritional needs of crops to achieve precise controlled release effects. However, these synthetic polymer film materials are derived from non-renewable petrochemical raw materials and have a relatively complex production process. After the nutrients in the fertilizer are completely released, a large amount of non-functional film materials may remain in the soil, which is difficult to degrade naturally. Long-term application of such film materials may not only affect soil fertility, but also aggravate the problem of microplastic pollution in farmland. With the improvement of environmental awareness and the continuous pursuit of green agriculture, relevant standards and regulations are also constantly being improved. For example, the Chinese agricultural industry standard "General Requirements for Slow-Release Fertilizers" (NY / T 2267-2016) stipulates that the biodegradability rate of polymer resin coating materials used in slow-release fertilizers should not be less than 15%, and the test period should not exceed 180 days. EU Regulation (EU) 2019 / 1009 requires that all ingredients of fertilizers and their packaging must be made of biodegradable substances by July 2024. Specifically, at least 90% of the organic carbon in the polymer should be converted into carbon dioxide within a maximum of 48 months after the end of the claimed functional period, and the final decomposition products are only carbon dioxide, biomass and water.

[0004] Given that synthetic polymer materials are difficult to meet these environmental requirements, it is particularly important to develop fully degradable slow-release membranes based on natural polymers. Natural polymers have outstanding environmental friendliness. They come from nature and can be completely degraded in the environment, without causing long-term burdens on the ecosystem. At the same time, natural polymers also have the significant advantage of environmental responsiveness, and can adjust nutrient release according to changes in the external environment, providing new solutions for the development of green agriculture. However, at present, when natural polymers are used as slow-release membranes, there are many problems such as difficulty in molding, low mechanical strength, and fast nutrient release, which urgently need to be solved through technological innovation. Sanzan Gum is a natural polymer produced by microbial fermentation. It has good environmental responsiveness and biodegradability, and can form a shell-core structure that loads nutrients, making it have important application value and broad development prospects in the field of slow-release fertilizers. Summary of the invention

[0005] The purpose of the present invention is to address the deficiencies of the prior art, especially the problems of great difficulty in molding, low mechanical strength and rapid nutrient release when natural polymers are used as slow-release controlled-release membrane materials, overcome the deficiencies of the prior art, and provide a fully degradable slow-release controlled-release granular fertilizer based on Sanzan gum, and a preparation method and application thereof.

[0006] The technical solution adopted by the present invention to solve the technical problem is:

[0007] A fully degradable slow-release granular fertilizer based on Sanzan gum, and a preparation method and application thereof.

[0008] The fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6-0.8 parts of Sanzan gum, 0-10 parts of bentonite, 0-15 parts of kaolin, 0-20 parts of humic acid, 0-9 parts of calcium sulfate, and 5-80 parts of fertilizer.

[0009] The preparation method of the fully degradable slow-release granular fertilizer based on Sanzan gum as described above comprises the following steps:

[0010] A fully degradable slow-release granular fertilizer based on Sanzan gum and a preparation method and application thereof, the method comprising the following steps:

[0011] Step (1): weigh trimethoprim, add water to prepare a trimethoprim solution with a mass volume percentage of 0.6-0.8% under stirring, and continue stirring until it is completely dissolved; add 0-0.01% of alkali with a mass volume percentage, stir at 35-45° C. for 0.5-2h to obtain a trimethoprim solution;

[0012] Step (2): adding bentonite, kaolin, humic acid, calcium sulfate and fertilizer to the solution obtained in step (1) according to the above-mentioned component ratios, and stirring and mixing them uniformly;

[0013] Step (3): dripping the solution of step (2) dropwise into a 0.1-0.5M inorganic acid or organic acid solution, or a 0.1-0.3M calcium chloride solution, stirring for 5-120 minutes, to obtain a composite gel sphere based on trisaccharide;

[0014] Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 1-2 hours to obtain modified composite gel spheres based on trisaccharide gum;

[0015] Step (5): Filter out the composite gel balls from step (3) or step (4), rinse with tap water, and dry at 60-80° C. to obtain a fully degradable slow-release granular fertilizer based on Sanzan gum.

[0016] Furthermore, the fully degradable slow-release granular fertilizer based on Sanzan gum is characterized in that the molecular marker of the Sanzan gum is SEQ ID NO.1 or SEQ ID NO.2.

[0017] Furthermore, the fully degradable slow-release granular fertilizer based on Sanzan gum is characterized in that the fertilizer includes urea, ammonium sulfate, potassium sulfate, potassium chloride, and NPK compound fertilizer.

[0018] Furthermore, the base in step (1) includes sodium hydroxide or potassium hydroxide.

[0019] Furthermore, the inorganic acid in step (3) includes: hydrochloric acid, boric acid, phosphoric acid or a mixture of two thereof; the organic acid includes: citric acid, acetic acid, oxalic acid or malic acid or a mixture of two thereof.

[0020] The advantages and positive effects achieved by the present invention are:

[0021] The production process of the slow-release granular fertilizer provided by the present invention is simpler to form, and the preparation efficiency is significantly improved. The core-shell structure formed by compounding and modifying Sanzan gum can load a large amount of fertilizer nutrients, and has the advantages of good water resistance, high mechanical strength, and good stability. By adjusting the preparation formula and process, the release rate of fertilizer nutrients can be regulated to match the nutrient requirements of crops, thereby achieving controlled release. In addition, the Sanzan gum and humic acid used in the preparation of granular fertilizers of the present invention are both natural polymer materials, which are completely degradable and are environmentally friendly and sustainable green fertilizers. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 These are the apparent morphologies of granular fertilizers when immersed in water at 25°C at different periods of time.

[0023] Figure 2This is a scanning electron microscope image of the film material of the fully degradable slow-release granular fertilizer based on Sanzan gum in Example 4 of the present invention, wherein: Figure 2 A is a plane electron microscope image of the film material magnified 300 times. Figure 2 B is a plane electron microscope image of the film material magnified 850 times. Figure 2 C is a plane electron microscope image of the film material magnified 1800 times. Figure 2 D is a plane electron microscope image of the membrane material magnified 300 times after 28 days of fertilizer nutrient extraction test. Figure 2 E is a plane electron microscope image of the membrane material magnified 850 times after 28 days of fertilizer nutrient extraction test. Figure 2 F is a plane electron microscope image of the membrane material magnified 1800 times after 28 days of fertilizer nutrient extraction test.

[0024] Figure 3 This is a graph showing the effect of the fully degradable slow-release granular fertilizer based on Sanzan gum on the soil bacterial community of potted corn in Example 4 of the present invention, wherein Figure 3 A is the treatment with 20% less granular fertilizer. Figure 3 B is the treatment of applying urea, Figure 3 C is the control, Figure 3 D is the treatment of applying granular fertilizer. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0026] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0027] Embodiment 1:

[0028] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.8 parts of Sanzan gum and 5 parts of urea.

[0029] The preparation method is as follows:

[0030] Step (1): weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.8% under stirring, and continue stirring until it is completely dissolved to obtain a trimethoprim gum solution;

[0031] Step (2): adding urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring to mix evenly;

[0032] Step (3): drip the solution of step (2) into 0.1 M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain gel spheres based on trisaccharide gel;

[0033] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 70° C. to obtain granular fertilizer based on Sanzan gum.

[0034] According to the method of HG / T 4215-2011, the fertilizer nutrient extraction test was carried out at 25°C, and the initial nutrient release rate was 51.6%, indicating that natural tri-zan gum alone has a certain slow-release ability for fertilizer, but it is highly hydrophilic and releases nutrients quickly.

[0035] Embodiment 2:

[0036] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 2 parts of bentonite and 17 parts of urea.

[0037] The preparation method is as follows:

[0038] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0039] Step (2): adding bentonite and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0040] Step (3): drip the solution of step (2) dropwise into a 0.3 M phosphoric acid solution, and stir for 5 min to obtain a composite gel sphere based on trisaccharide gel;

[0041] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 70° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0042] The hardness of the granular fertilizer is 16.1kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 19.3%, and the 28-day cumulative nutrient release rate was 83.1%. The granular fertilizer has high mechanical strength and slow-release performance.

[0043] Embodiment 3:

[0044] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 5 parts of bentonite and 35 parts of urea.

[0045] The preparation method is as follows:

[0046] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0047] Step (2): adding bentonite and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0048] Step (3): drip the solution of step (2) dropwise into a 0.5 M oxalic acid solution, and stir for 5 min to obtain a composite gel sphere based on trisaccharide gel;

[0049] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 70° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0050] The hardness of the granular fertilizer is 11.6kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 6.1% and the cumulative nutrient release rate after 28 days is 70.8%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 shown.

[0051] Embodiment 4:

[0052] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 10 parts of bentonite and 75 parts of urea.

[0053] The preparation method is as follows:

[0054] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0055] Step (2): adding bentonite and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0056] Step (3): drip the solution of step (2) into 0.5 M boric acid solution drop by drop, stir and fix for 10 min, to obtain composite gel spheres based on trisaccharide;

[0057] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 75° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0058] The hardness of the granular fertilizer is 9.9kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 6.9% and the cumulative nutrient release rate after 28 days is 73.4%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 The electron microscope observation of granular fertilizer film is shown in Figure 2 As shown in the figure, it can be seen that the granular fertilizer still maintains a uniform and dense pore structure after extraction. The pot experiment shows that the application of granular fertilizer can increase the growth rate of corn. The effect of granular fertilizer on the soil bacterial community of potted corn is as follows Figure 3As shown, bacteria from the Proteobacteria and Bacteroidetes phyla are the dominant bacterial communities, indicating that the fully degradable slow-release granular fertilizer based on Sanzan gum has good soil compatibility and is an environmentally friendly green fertilizer.

[0059] Embodiment 5:

[0060] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.8 parts of tri-zan gum, 5 parts of kaolin and 25 parts of urea.

[0061] The preparation method is as follows:

[0062] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.8% under stirring, and continue stirring until it is completely dissolved;

[0063] Step (2): adding kaolin and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0064] Step (3): drip the solution of step (2) into 0.1% hydrochloric acid solution drop by drop, stir and fix for 20 minutes, and obtain composite gel spheres based on trisaccharide;

[0065] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 80° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0066] The hardness of the granular fertilizer is 14.8kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 10.2% and the cumulative nutrient release rate after 28 days is 79.3%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 shown.

[0067] Embodiment 6:

[0068] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.8 parts of Sanzan gum, 10 parts of kaolin and 60 parts of urea.

[0069] The preparation method is as follows:

[0070] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.8% under stirring, and continue stirring until it is completely dissolved;

[0071] Step (2): adding kaolin and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0072] Step (3): drip the solution of step (2) into 0.4M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0073] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 80° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0074] The hardness of the granular fertilizer is 11.5kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 8.8% and the cumulative nutrient release rate after 28 days is 75.1%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 shown.

[0075] Embodiment 7:

[0076] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.8 parts of tri-zan gum, 15 parts of kaolin and 80 parts of urea.

[0077] The preparation method is as follows:

[0078] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.8% under stirring, and continue stirring until it is completely dissolved;

[0079] Step (2): adding kaolin and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0080] Step (3): drip the solution of step (2) into 0.5M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain composite gel spheres based on trisaccharide;

[0081] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 80° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0082] The hardness of the granular fertilizer is 8.1kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 29.8% and the cumulative nutrient release rate after 28 days was 90.2%.

[0083] Embodiment 8:

[0084] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.7 parts of Sanzan gum, 5 parts of humic acid, and 30 parts of urea.

[0085] The preparation method is as follows:

[0086] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.7% under stirring, and continue stirring until it is completely dissolved;

[0087] Step (2): adding humic acid and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0088] Step (3): drip the solution of step (2) into 0.2M hydrochloric acid solution drop by drop, stir and fix for 10 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0089] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0090] The hardness of the granular fertilizer is 12.9 kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 9.9% and the 28-day cumulative nutrient release rate was 72.0%.

[0091] Embodiment 9:

[0092] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.7 parts of Sanzan gum, 10 parts of humic acid and 60 parts of urea.

[0093] The preparation method is as follows:

[0094] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.7% under stirring, and continue stirring until it is completely dissolved;

[0095] Step (2): adding humic acid and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0096] Step (3): drip the solution of step (2) into 0.2M hydrochloric acid solution drop by drop, stir and fix for 10 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0097] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0098] The hardness of the granular fertilizer is 11.3kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 8.6% and the cumulative nutrient release rate after 28 days is 65.7%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 shown.

[0099] Embodiment 10:

[0100] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.7 parts of Sanzan gum, 20 parts of humic acid, and 80 parts of urea.

[0101] The preparation method is as follows:

[0102] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.7% under stirring, and continue stirring until it is completely dissolved;

[0103] Step (2): adding humic acid and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0104] Step (3): drip the solution of step (2) into 0.2M hydrochloric acid solution drop by drop, stir and fix for 10 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0105] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0106] The hardness of the granular fertilizer is 10.7kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 12.3% and the cumulative nutrient release rate after 28 days is 80.2%. The apparent morphology of the granular fertilizer soaked in water at 25℃ at different periods is as follows Figure 1 shown.

[0107] Embodiment 11:

[0108] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.6 parts of tri-zan gum, 9 parts of kaolin, 5 parts of calcium sulfate and 70 parts of urea.

[0109] The preparation method is as follows:

[0110] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0111] Step (2): adding kaolin, calcium sulfate and urea to the solution obtained in step (1) according to the above-mentioned component ratios, and stirring and mixing them uniformly;

[0112] Step (3): drip the solution of step (2) into 0.4M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0113] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 80° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0114] The hardness of the granular fertilizer is 6.7kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 9.7% and the 28-day cumulative nutrient release rate was 68.5%.

[0115] Embodiment 12:

[0116] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.6 parts of tri-zan gum, 6 parts of humic acid, 9 parts of calcium sulfate and 80 parts of urea.

[0117] The preparation method is as follows:

[0118] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0119] Step (2): adding humic acid, calcium sulfate and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0120] Step (3): drip the solution of step (2) into 0.3M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0121] Step (4): Filter out the composite gel balls from step (3), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0122] The hardness of the granular fertilizer is 8.1kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 10.4% and the cumulative nutrient release rate after 28 days was 62.6%.

[0123] Embodiment 13:

[0124] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.6 parts of tri-zan gum, 3 parts of bentonite, 7 parts of calcium sulfate and 80 parts of urea.

[0125] The preparation method is as follows:

[0126] Step (1): Weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved;

[0127] Step (2): adding bentonite, calcium sulfate and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0128] Step (3): drip the solution of step (2) into 0.3M hydrochloric acid solution drop by drop, stir and fix for 5 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0129] Step (4): Filter out the composite gel balls from step (3), rinse with tap water and dry at 70° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0130] The hardness of the granular fertilizer is 8.9kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 16.5% and the 28-day cumulative nutrient release rate was 89.0%. The potted plant experiment in saline-alkali soil showed that the application of granular fertilizer can increase the growth rate of corn.

[0131] Embodiment 14:

[0132] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 6 parts of bentonite and 35 parts of urea.

[0133] The preparation method is as follows:

[0134] Step (1): weigh trimethoprim, add water to prepare a trimethoprim solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved; add 0-0.008% mass volume percentage of sodium hydroxide, stir at 35° C. for 0.5 h to obtain a trimethoprim solution;

[0135] Step (2): adding bentonite and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0136] Step (3): drip the solution of step (2) into 0.1M calcium chloride solution drop by drop, stir and fix for 1 hour, and obtain composite gel spheres based on trisaccharide gel;

[0137] Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 1 hour to obtain modified composite gel spheres based on trisaccharide;

[0138] Step (5): Filter out the composite gel balls from step (4), rinse with tap water, and dry at 70° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0139] The hardness of the granular fertilizer is 13.2kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 2.1%, and the cumulative nutrient release rate after 28 days is 56.9%. After the modification treatment, the nutrient release of the granular fertilizer is slower.

[0140] Embodiment 15:

[0141] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 6 parts of kaolin and 40 parts of urea.

[0142] The preparation method is as follows:

[0143] Step (1): weigh trimethoprim, add water to prepare a trimethoprim solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved; add 0.01% mass volume percentage of sodium hydroxide, stir at 45° C. for 2 hours to obtain a trimethoprim solution;

[0144] Step (2): adding kaolin and fertilizer to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0145] Step (3): dripping the solution of step (2) into a 0.3 M calcium chloride solution dropwise, stirring for 120 min, and obtaining a composite gel sphere based on trisaccharide gel;

[0146] Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 1 hour to obtain modified composite gel spheres based on trisaccharide;

[0147] Step (5): Filter out the composite gel balls from step (4), rinse with tap water, and dry at 80° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0148] The hardness of the granular fertilizer is 8.4kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 9.8% and the cumulative nutrient release rate after 28 days was 70.2%.

[0149] Embodiment 16:

[0150] A fully degradable slow-release granular fertilizer based on Sanzan gum contains the following ingredients and weight proportions: 0.6 parts of Sanzan gum, 10 parts of humic acid, and 60 parts of urea.

[0151] The preparation method is as follows:

[0152] Step (1): weigh trimethoprim gum, add water to prepare a trimethoprim gum solution with a mass volume percentage of 0.6% under stirring conditions, and continue stirring until it is completely dissolved; add 0.005% mass volume percentage of potassium hydroxide, stir at 35° C. for 0.5 h, and obtain a trimethoprim gum solution;

[0153] Step (2): adding humic acid and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0154] Step (3): drip the solution of step (2) into 0.2M calcium chloride solution drop by drop, stir and fix for 60 minutes, and obtain composite gel spheres based on trisaccharide;

[0155] Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 1 hour to obtain modified composite gel spheres based on trisaccharide;

[0156] Step (5): Filter out the composite gel balls from step (4), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0157] The hardness of the granular fertilizer is 10.5kg. The fertilizer nutrient extraction test shows that the initial nutrient release rate is 4.5%, and the cumulative nutrient release rate after 28 days is 50.7%. This shows that by adjusting the preparation formula and process, the release rate of fertilizer nutrients can be regulated, thereby achieving controlled release.

[0158] Embodiment 17:

[0159] A fully degradable slow-release granular fertilizer based on tri-zan gum contains the following ingredients and weight proportions: 0.6 parts of tri-zan gum, 6 parts of humic acid, 5 parts of calcium sulfate, and 80 parts of fertilizer.

[0160] The preparation method is as follows:

[0161] Step (1): weigh trimethoprim, add water to prepare a trimethoprim solution with a mass volume percentage of 0.6% under stirring, and continue stirring until it is completely dissolved; add 0-0.005% potassium hydroxide with a mass volume percentage, stir at 35° C. for 0.5 h to obtain a trimethoprim solution;

[0162] Step (2): adding humic acid, calcium sulfate and urea to the solution obtained in step (1) according to the above-mentioned component ratio, and stirring and mixing uniformly;

[0163] Step (3): drip the solution of step (2) into 0.3M calcium chloride solution drop by drop, stir and fix for 60 minutes, and obtain composite gel spheres based on trisaccharide gel;

[0164] Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 2 hours to obtain modified composite gel spheres based on trisaccharide gum;

[0165] Step (5): Filter out the composite gel balls from step (4), rinse with tap water, and dry at 60° C. to obtain a composite granular fertilizer based on Sanzan gum.

[0166] The hardness of the granular fertilizer is 9.8kg. The fertilizer nutrient extraction test showed that the initial nutrient release rate was 6.9% and the cumulative nutrient release rate after 28 days was 57.2%.

[0167] Embodiment 18:

[0168] Detection method for fully degradable slow-release granular fertilizer based on Sanzan gum.

[0169] Take the fully degradable slow-release granular fertilizer based on Sanzan gum in Example 4, grind and crush, add 9 times the mass of deionized water, vortex and mix evenly, let stand for 8h at 4°C, centrifuge at 3000r / min for 15min, take the supernatant, use the bacterial genomic DNA extraction kit, extract the genomic DNA according to the instructions, and perform electrophoresis detection. Using the extracted DNA as a template, 5'TAAGGTCCCCAAGTCACGTC 3' as the upstream primer, 5'TCTCTCAAGCGCCTTGGTAT 3' as the downstream primer, PCR amplification was performed. The PCR amplification system is: 1μL of template DNA of 10-30ng / uL, 0.5μL of upstream primer and downstream primer of 10μM, 0.5μL of dNTP of 10mM, 2.5μL of 10× buffer, 0.5μL of Taq enzyme of 5U / μL, and ultrapure water to 25μL. The PCR reaction conditions were: 95°C pre-denaturation for 5 min; 94°C for 45 s, 59°C for 45 s, 72°C for 1 min, 30 cycles; 72°C extension for 10 min. The PCR amplification band detected by electrophoresis was about 560 bp. The PCR amplification product was sequenced by DNA, and the sequences near the primers that affected the sequencing accuracy were removed to obtain the specific molecular marker SEQ ID NO.1 representing Trisammonium.

[0170]

[0171] Embodiment 19:

[0172] Detection method for fully degradable slow-release granular fertilizer based on Sanzan gum.

[0173] Take the fully degradable slow-release granular fertilizer based on Sanzan gum in Example 17, grind and crush, add 9 times the mass of deionized water, vortex and mix evenly, let stand for 8h at 4°C, centrifuge at 3000r / min for 15min, take the supernatant, use the bacterial genomic DNA extraction kit, extract the genomic DNA according to the instructions, and perform electrophoresis detection. Using the extracted DNA as a template, 5'TCAGGCCGTGTGGGGAA 3' as the upstream primer, 5'GATCCGATCCAGCTTTCGGG 3' as the downstream primer, PCR amplification was performed. The PCR amplification system is: 1μL of template DNA of 10-30ng / uL, 0.5μL of upstream primer and downstream primer of 10μM, 1.0μL of dNTP of 10mM, 2.5μL of 10× buffer, 0.5μL of Platinum Taq DNA polymerase of 5U / μL, and ultrapure water to 25μL. The PCR reaction conditions were: 95°C pre-denaturation for 5 min; 94°C for 45 s, 62°C for 45 s, 72°C for 1 min, 30 cycles; 72°C extension for 10 min. The PCR amplification band detected by electrophoresis was about 950 bp. The PCR amplification product was sequenced by DNA, and the sequences near the primers that affected the sequencing accuracy were removed to obtain the specific molecular marker SEQ ID NO.2 representing Trisammonium.

[0174]

[0175] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A fully degradable slow-release granular fertilizer based on Sanzan gum, characterized in that: Its components and weight proportions are as follows: 0.6-0.8 parts of Sanzan gum, 0-10 parts of bentonite, 0-15 parts of kaolin, 0-20 parts of humic acid, 0-9 parts of calcium sulfate, and 5-80 parts of fertilizer; The preparation method of the fully degradable slow-release granular fertilizer based on Sanzan gum as described above comprises the following steps: Step (1): weigh trimethoprim, add water to prepare a trimethoprim solution with a mass volume percentage of 0.6-0.8% under stirring, and continue stirring until it is completely dissolved; add 0-0.01% of alkali with a mass volume percentage, stir at 35-45° C. for 0.5-2h to obtain a trimethoprim solution; Step (2): adding bentonite, kaolin, humic acid, calcium sulfate and fertilizer to the solution obtained in step (1) according to the above-mentioned component proportions, and stirring and mixing them uniformly; Step (3): dripping the solution of step (2) dropwise into a 0.1-0.5M inorganic acid or organic acid solution, or a 0.1-0.3M calcium chloride solution, stirring for 5-120 minutes, to obtain a composite gel sphere based on trisaccharide; Step (4): Filter out the gel spheres fixed with calcium chloride in step (3), rinse with tap water, soak in a pyridine solution for 1 hour, and then transfer to a pyridine-acetic anhydride solution with a volume ratio of 1:1, and stir and mix for 1-2 hours to obtain modified composite gel spheres based on trisaccharide gum; Step (5): Filter out the composite gel balls from step (3) or step (4), rinse with tap water, and dry at 60-80° C. to obtain a composite granular fertilizer based on Sanzan gum.

2. The fully degradable slow-release granular fertilizer based on Sanzan gum according to claim 1, characterized in that: The molecular marker of the tri-zan gum is SEQ ID NO.1 or SEQ ID NO.

2.

3. The fully degradable slow-release granular fertilizer based on Sanzan gum according to claim 1, characterized in that: The fertilizers include: urea, ammonium sulfate, potassium sulfate, potassium chloride, and NPK compound fertilizer.

4. The preparation method according to claim 1, characterized in that: The alkali in step (1) includes sodium hydroxide or potassium hydroxide; the inorganic acid in step (3) includes hydrochloric acid, boric acid, phosphoric acid or a mixture of two thereof; the organic acid includes citric acid, acetic acid, oxalic acid or malic acid or a mixture of two thereof.

5. Application of the fully degradable slow-release granular fertilizer based on Sanzan gum prepared by the preparation method according to any one of claims 1 to 4.

Images