Application of NRP1 gene as target spot in inhibition of replication of influenza A virus and influenza B virus

Abstract

The invention discloses application of an NRP1 gene as a target spot in inhibition of replication of influenza A and B viruses, and belongs to the technical field of biological genetic engineering. The invention provides application of an NRP1 gene as a target in inhibition of replication of influenza A and B viruses in order to solve the problem that common targets of influenza A and B viruses and drugs capable of effectively inhibiting replication of influenza A and B viruses are absent in the prior art. CRISPR (clustered regularly interspaced short palindromic repeats) Screen is used for screening to obtain a common new target NRP1 gene for infection and invasion of the influenza A virus and the influenza B virus in a human host cell; the common new target NRP1 gene provided by the invention can be applied to preparation of an expression inhibitor and inhibition of replication of influenza A and B viruses; the NRP1 gene expression synergist can be applied to preparation of NRP1 gene expression synergists, and preparation of influenza A and B virus replication synergists or vaccine production synergists.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and specifically relates to an application of an NRP1 gene as a target in inhibiting the replication of type A and type B influenza viruses. Background Art

[0002] Influenza is an acute respiratory infection caused by influenza viruses, which can cause seasonal epidemics or occasional pandemics. Seasonal influenza viruses evolve to evade host immunity, leading to repeated global epidemics. Among them, influenza A and B viruses belong to the family Orthomyxoviridae; influenza A virus (WSN) can infect humans and a variety of animals, and multiple subtypes of influenza A viruses have high pathogenicity and / or high mortality, seriously threatening the health of animals and humans; influenza B virus (Yamagata) mainly infects humans. Although its pathogenicity to humans is relatively low, pneumonia caused by influenza B virus infection has a high mortality rate. In addition, since the surface protein of influenza virus is prone to antigenic variation, it can develop resistance to drugs that target the surface protein of influenza virus. Therefore, the efficacy of existing drugs against influenza A and B viruses has gradually decreased, and the treatment effect is not ideal.

[0003] The CRISPR (Clustered regularly interspaced short palindromic repeat) system is an adaptive immune defense system from bacteria. CRISPR Screen technology uses the effectiveness and flexibility of the CRISPR Cas gene editing system and has become a very effective tool widely used in biological discoveries.

[0004] Currently, the existing technologies mainly explore the host factors of a single type of influenza virus, but the common targets of multiple different subtypes of influenza viruses have not yet been found. Specifically, there is a lack of common targets for influenza A and B viruses, as well as drugs that can effectively inhibit the replication of influenza A and B viruses at the same time. Summary of the invention

[0005] The present invention solves the problem that the prior art lacks a common target for influenza A and B viruses, and a drug that can effectively inhibit the replication of influenza A and B viruses at the same time, and provides an application of NRP1 gene as a target in inhibiting the replication of influenza A and B viruses.

[0006] One of the purposes of the present invention is to provide an application of the NRP1 gene as a target in screening drugs for preventing / treating influenza A and B virus infections. The nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.1, and the drug targets the NRP1 gene to inhibit or silence the expression of the NRP1 gene.

[0007] The second object of the present invention is to provide the use of NRP1 gene expression inhibitors in the preparation of drugs for preventing / treating influenza A and B virus infections.

[0008] In a preferred embodiment of the present invention, the nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.1.

[0009] In a preferred embodiment of the present invention, the expression inhibitor is an RNA fragment that interferes with the expression of the NRP1 gene, or a shRNA that targets the NRP1 gene, or a small molecule compound that downregulates the expression of the NRP1 gene.

[0010] In a preferred embodiment of the present invention, the shRNA sequence targeting the NRP1 gene is:

[0011] NRP1-shRNA-F: 5'-CAGCCTTGAATGCACTTATAT-3', SEQ ID NO.2;

[0012] NRP1-shRNA-R: 5'-ATATAAGTGCATTCAAGGCTG-3', SEQ ID NO. 3.

[0013] The third object of the present invention is to provide a shRNA specifically targeting the NRP1 gene, wherein the sequence of the shRNA is:

[0014] NRP1-shRNA-F: 5'-CAGCCTTGAATGCACTTATAT-3', SEQ ID NO.2;

[0015] NRP1-shRNA-R: 5'-ATATAAGTGCATTCAAGGCTG-3', SEQ ID NO. 3.

[0016] A fourth object of the present invention is to provide the use of the above shRNA in the preparation of drugs for preventing / treating influenza A and B virus infections.

[0017] A fifth object of the present invention is to provide the use of an NRP1 gene expression enhancer in the preparation of a replication enhancer or a vaccine production enhancer for type A and type B influenza viruses.

[0018] In a preferred embodiment of the present invention, the nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.1.

[0019] In a preferred embodiment of the present invention, the replication enhancer or production enhancer targets the NRP1 gene and promotes the expression of the NRP1 gene.

[0020] Beneficial effects of the present invention: The present invention provides an application of the NRP1 gene as a target in inhibiting the replication of type A and type B influenza viruses, constructs a knockout library of human genomic genes using CRISPR Screen screening technology, obtains a large number of gene mutant cells, and infects the mutant cells with type A influenza virus (WSN) and type B (Yamagata) influenza virus, and finally screens and obtains the key common new target NRP1 gene that can simultaneously affect the infection and invasion of type A and type B influenza viruses in human host cells.

[0021] The present invention verifies the common new target NRP1 gene provided by the present invention through expression detection at protein level and mRNA level, detection of influenza virus nucleoprotein content, and virus titer detection, which can be used as a target for both type A and type B influenza viruses. The new target NRP1 can not only inhibit type A and type B influenza viruses from infecting host cells, but also inhibit the survival and replication of type A and type B influenza viruses in host cells.

[0022] The new target NRP1 gene common to type A and type B influenza viruses provided by the present invention can be used to inhibit the replication of type A and type B influenza viruses, and provides a reliable research basis and theoretical basis for the prevention and control of the epidemic of different subtypes of influenza viruses, as well as the development and preparation of universal influenza vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the Cas9 expression detection of the A549 cell line in Example 1;

[0024] Figure 2 A is a validation diagram for knockdown of the NRP1 gene in Example 4; A is a validation diagram for protein level expression, B is a quantitative diagram for protein level expression, and C is a validation diagram for mRNA level expression;

[0025] Figure 3 Detection diagram of host cell susceptibility to influenza virus after knocking down NRP1 in Example 4; A is a detection diagram of NP protein expression after infection with influenza A virus, B is a quantitative diagram of NP protein expression, C is a detection diagram of NP protein expression after infection with influenza B virus, and D is a quantitative diagram of protein expression of Figure C; wherein ANP represents influenza A virus nucleoprotein, and BNP represents influenza B virus nucleoprotein;

[0026] Figure 4 These are detection diagrams of influenza viruses remaining in host cells after knocking down NRP1 in Example 4, A is a detection diagram of influenza A virus titer, B is a detection diagram of influenza B virus titer, and the vertical axis Virus titers is the virus titer. DETAILED DESCRIPTION

[0027] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0028] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. The test methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0029] Example 1: Construction of a human A549 cell line with stable expression of Cas9

[0030] The human A549 cell line was infected with Cas9 lentivirus, and the ratio of virus added to cell number was 50:1, that is, the virus titer was 1×10 8 2×10 cells were infected with Cas9 lentivirus at TU / mL 6 A549 cell line; after 12 hours, the culture medium was changed to complete medium, and the culture was continued for 48 hours. Hygromycin antibiotics were added for drug screening. The concentration of Hygromycin antibiotics was 600 μg / mL. After screening, A549 cell lines infected with Cas9 were obtained.

[0031] In this example, the A549 cell line obtained above was tested for Cas9 expression. Figure 1 As shown, it was shown that the human A549 cell line stably expressing Cas9 was successfully constructed.

[0032] Example 2: Construction of a mutant cell library for human A549 cell line stably expressing Cas9

[0033] The guide RNA library plasmid (Addgene, Pooled Library #73179) for targeted knockout of 19114 human genes was used to infect the human A549 cell line stably expressing Cas9 obtained in S1 through a lentiviral system to obtain a mutant cell library for targeted knockout of the human genome. Four gRNAs were set for each gene, and the mutant cell library plasmid contained 76441 gRNAs.

[0034] The specific steps include:

[0035] S1: Packaging lentiviral particles on 293T cells, wherein the mixing mass ratio of library plasmid (gRNA pooled library inlentiCRISPRv2): packaging plasmid PAX2: envelope plasmid VSVG is 13:5:2, transfection reagent Lipo3000 (L3000015, Thermofisher) and plasmid are mixed at a volume mass ratio of 3:1, complete culture medium is replaced after 6 hours, and culture is continued for 72 hours, and the supernatant containing lentiviral particles is collected and concentrated, and the supernatant is removed by ultrahigh-speed centrifugation for concentration, and the concentrated suspension containing lentiviral particles is obtained after the culture medium is resuspended;

[0036] S2: The suspension containing lentiviral particles obtained in S1 was used to infect the human A549 cell line stably expressing Cas9 obtained in Example 1 to obtain infected A549-Cas9 cells, and the A549-Cas9 cells were cultured to the logarithmic growth phase and counted. 6×10 7 A549-Cas9 cells were infected, and the multiplicity of infection of the virus-infected cells was 0.5, that is, the amount of virus was 3×10 7 TU, complete medium was replaced 12 h after infection and culture continued;

[0037] S3: 48 hours after the virus infection described in S2, an effective concentration of puromycin (ST551, Bio-Time) was added for drug screening. The concentration of puromycin added was 5-6 ug / mL according to the sensitivity of A549 cells to screen cells infected with the virus containing the knockout library. The culture medium was replaced every 2 days to obtain A549-Cas9 cells infected with the virus containing the knockout library;

[0038] S4: The A549-Cas9 cells infected with the virus containing the knockout library obtained in S3 were amplified and cultured, and then the above cells were divided into 3 groups, namely, a control group, an experimental group infected with influenza A virus (Flu A, specifically WSN), and an experimental group infected with influenza B virus (Flu B, specifically Yamagata). The culture medium was replaced 12 hours after infection and culture was continued.

[0039] Example 3: Extraction and sequencing of genomic DNA

[0040] S1: In a 15 mL centrifuge tube, 6 mL of NK lysis buffer (50 mM Tris, 50 mM EDTA, 1% SDS, pH=8) and 30 μL of 20 mg / mL proteinase K (QIAGEN 19131) were added to each group of cell samples (the cell samples were the control group, the experimental group infected with influenza A virus, and the experimental group infected with influenza B virus described in Example 2), and incubated at 55° C. overnight to obtain a lysed sample;

[0041] S2: The next day, 30 μL of RNase A (QIAGEN 19101) was added to each group of lysed samples obtained in S1, inverted 25 times, and incubated at 37°C for 30 min;

[0042] S3: The lysed samples of each group obtained in S2 were placed on ice for cooling, and then 2 mL of pre-cooled 7.5 M ammonium acetate (Sigma A1542) was added to precipitate the protein. After adding ammonium acetate, the sample was vortexed at high speed for 20 seconds, and then centrifuged at 4000×g for 10 minutes; 6 mL of 100% isopropanol was added, inverted and mixed 50 times, and centrifuged at 4000×g for 10 minutes. At this time, genomic DNA was visible in the tube as small white particles; after discarding the supernatant, 6 mL of freshly prepared 70% ethanol was added, the tube was inverted 10 times, and centrifuged at 4000×g for 1 minute; the supernatant was poured out and the remaining ethanol was aspirated with a pipette; after air drying for 10-30 minutes, when the DNA changed from white particles to slightly translucent, 500 μL of 1x TE buffer (Sigma T9285), incubated at 65°C for 1 h, and incubated at room temperature overnight to fully dissolve the DNA, and obtained the sample DNA of the control group, the experimental group infected with influenza A virus, and the experimental group infected with influenza B virus in Example 2, respectively, referred to as the control group, A549-Cas9Library+Flu A, and A549-Cas9 Library+Flu B, respectively.

[0043] In this example, the above groups of DNA samples were shaken and centrifuged the next day, and the genomic DNA concentration was measured using Nanodrop. The samples were sent to Anno Biotech for next-generation sequencing. The sequencing results were analyzed to obtain the common target NRP1 gene that can affect influenza A and B virus infection. The nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.1.

[0044] Example 4: Application of NRP1 gene as a target in inhibiting the replication of influenza A and B viruses

[0045] Preparation of A549 cell line with knockdown of NRP1 gene: In this example, two NRP1 gene shRNA plasmids were constructed, namely sh-NRP1-1 and sh-NRP1-2, wherein the plasmid sequences for constructing sh-NRP1-1 are shown in SEQ ID NO.4 and SEQ ID NO.5; the plasmid sequences for constructing sh-NRP1-2 are shown in SEQ ID NO.6 and SEQ ID NO.7. The plasmids containing NRP1shRNA (sh-NRP1-1 and sh-NRP1-2) were packaged with lentivirus in 293T cells, wherein the mixing mass ratio of shRNA plasmid: packaging plasmid PAX2: envelope plasmid VSVG was 13:5:2, the transfection reagent Lipo3000 (L3000015, Thermofisher) and the plasmid were mixed at a volume mass ratio of 3:1, the mixed solution was added to 293T cells, the complete culture medium was replaced after 6 hours, the culture was continued for 72 hours, and the supernatant containing lentivirus particles was collected; 1 ml of the supernatant containing lentivirus particles was taken to infect A549 cells, and the normal culture medium was replaced after 12 hours for culture, and 5 μg / mL of puromycin was added after 48 hours to screen out the cells infected with lentivirus, and the screened cells were the A549 cell lines (sh-NRP1-1 and sh-NRP1-2) with knockdown of NRP1 gene.

[0046] The NRP1 gene overexpression plasmid used in this example was constructed by Qingke Company.

[0047] Effect experiment:

[0048] In this example, the A549 cell line without NRP1 gene knockdown was used as the control group (sh-NC), and the sh-NRP1-1 and sh-NRP1-2 experimental groups with NRP1 gene knockdown obtained in this example were subjected to the following effect test.

[0049] (1) Western blot experiment

[0050] Proteasome inhibitors (B14001, Selleck) were added to RIPA lysis buffer (P0013B, Beyotime) in proportion (lysis buffer: inhibitor volume ratio = 100:1), mixed and placed on ice for later use; after removing the culture medium from the cells to be tested, the cells were washed twice with pre-cooled PBS, the PBS was removed, and the prepared lysis buffer was added, and the cells were lysed on ice for 20 min. The cell lysate was scraped off with a cell scraper and transferred to a 1.5 ml EP tube, and centrifuged at 4°C and 12000 rpm for 10 min; the supernatant was transferred to a new EP tube, and 1 / 4 volume of 5X protein loading buffer was added, and the tube was heated in a 100°C metal bath for 10 min to obtain the protein sample to be tested.

[0051] Electrophoresis buffer was added to the SDS-PAGE gel, and the above protein samples were added to each well of the gel. The voltage was adjusted to 80V constant voltage for electrophoresis, and the membrane was transferred after the electrophoresis. According to the size of the gel, a PVDF membrane (ISEQ00010, Merck Millipore) of the same size was cut out, and the PVDF membrane was placed in methanol for activation for 2 minutes, taken out and placed in the transfer buffer for activation, and the membrane was placed on the gel, and bubbles were driven out. The sandwich splint was closed and placed in the transfer tank, and the transfer buffer was added. The membrane was transferred at a constant current of 250mA for 1.5h, and then the membrane was placed in 5% skim milk (TBST configuration) for blocking for 2h; NRP1 primary antibody (60067-1-Ig, Pro Teintech Company) was diluted with TBST at a ratio of 1:1000, and the internal reference GAPDH (B1034, Biodragon) was diluted at a ratio of 1:3000; the membrane was placed in the diluted primary antibody and placed on a shaker at 4°C overnight. The incubation box was taken out the next day, and the strips were placed in TBST for washing three times, each time for 10 minutes; the above strips were taken out and placed in the diluted secondary antibody (diluted with TBST, the dilution ratio was 1:4000), and incubated on a shaker at room temperature for 1.5 hours, the strips were taken out and placed in TBST, and gently shaken on a shaker for washing three times, each time for 10 minutes. After the strips were washed, ECL ultrasensitive developer was added and placed in a developer for development.

[0052] (2) Fluorescence quantitative qPCR detection

[0053] In this example, RNA was extracted from the cells to be tested according to the instructions of the RNA extraction kit (19211ES60, Yeasen Company), and the RNA was reverse transcribed into cDNA using a reverse transcription kit (AU341-02, Quanshijin Company). The reverse transcription program was: 55°C-5min, 85°C-2min, 4°C-∞; after the reverse transcription was completed, the reaction tube was placed on ice to prepare a fluorescent quantitative qPCR reaction system, and the fluorescent quantitative qPCR reaction system was: 5 μL SYBR (SYBR enzyme AQ601-01-V2, Quanshijin Company), 0.3 μL upstream primer (10 μM), 0.3 μL downstream primer (10 μM), DEPC water was supplemented to 10 μL, and the fluorescence quantitative qPCR reaction program was: 95°C-2 min, 95°C-5 s, 57°C-30 s, 72°C-30 s, 95°C-30 s, 65°C-5 s, 95°C-15 s, for a total of 40 cycles; the primer sequences used for NRP1 gene expression detection are shown in SEQ ID NO.8 and SEQ ID NO.9, and the primer sequences used for reference gene GAPDH expression detection are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0054] Experimental results:

[0055] (1) Western blot test results are as follows Figure 2 As shown in A, this example successfully prepared an A549 cell line with NRP1 gene knockdown; and its protein expression level was quantitatively detected. The results are shown in FIG. Figure 2 As shown in B, the A549 cell line with NRP1 gene knockdown prepared in this example has a significantly lower NRP1 gene expression level than the control group; the mRNA level expression verification results are as follows Figure 2 As shown in C, compared with the control group, the mRNA level expression in the A549 cell line with NRP1 gene knockdown prepared in this example was significantly reduced, and the sh-NRP1-1 experimental group had a better NRP1 gene knockdown effect than the sh-NRP1-2 experimental group; therefore, the A549 cell line with NRP1 gene knockdown used in subsequent experiments was the sh-NRP1-1 experimental group.

[0056] (2) In this example, the control group infected with influenza virus and the A549 cell line with NRP1 gene knockdown prepared in this example (sh-NRP1-1 experimental group) were infected with the representative strain of influenza A virus (WSN) and the representative strain of influenza B virus Yamagata B / Yamagata / 16 / 1988 (BYam), and the infection time was 6h, 12h, and 24h, respectively.

[0057] Influenza virus nucleoprotein (NP) is a structural protein that coats the negative-strand RNA of the virus. NP protects the viral RNA from being degraded by cellular enzymes during the viral life cycle and regulates the transcription and replication of the viral RNA template. Therefore, this example detects the expression of influenza virus nucleoprotein (NP) in the cells of the control group and the NRP1 knockdown group (sh-NRP1-1) after 6h, 12h, and 24h of infection.

[0058] The results are as follows Figure 3 As shown, ANP represents influenza A virus nucleoprotein, and BNP represents influenza B virus nucleoprotein; compared with the control group (sh-NC), the intracellular NP protein expression level of the NRP1 knockdown group (sh-NRP1-1) was significantly reduced, indicating that the transcription and replication of the A549 cell line after knocking down the NRP1 gene were significantly weakened in the cells; it can be seen that knocking down the NRP1 gene can effectively inhibit the transcription and replication of influenza viruses in cells.

[0059] (3) In this example, the intracellular viral titer was detected in the control group (sh-NC) and the NRP1 knockdown group (sh-NRP1) 12 h, 24 h and 48 h after infection, respectively.

[0060] The results are as follows Figure 4 As shown, the viral titer in the cells of the NRP1 knockdown group (sh-NRP1) was significantly reduced compared with that in the control group (sh-NC), indicating that the number of viruses retained in the cells of the NRP1 knockdown group was reduced, and the NRP1 gene inhibited the replication of influenza A and B viruses.

[0061] In order to further verify the function of the NRP1 gene, this example conducted an NRP1 gene recovery experiment, and the NRP1 overexpression plasmid constructed by Qingke Company was added to the NRP1 knockdown group (sh-NRP1) prepared in this example, and this experimental group was named NRP1 recovery group (sh-NRP1+Flag-NRP1); and the viral titer in the cells of the above-mentioned control group (sh-NC), NRP1 knockdown group (sh-NRP1) and recovery group (sh-NRP1+Flag-NRP1) was detected again.

[0062] The results are as follows Figure 4 As shown, the amount of virus retained in the cells of the recovery group (sh-NRP1+Flag-NRP1) with the addition of NRP1 overexpression plasmid was significantly increased compared with the control group (sh-NC) and the NRP1 knockdown group (sh-NRP1), indicating that the expression of the NRP1 gene was restored and restored to a level close to that of the control group, and the replication of influenza A and B viruses was restored.

[0063] In summary, the present invention has verified that the NRP1 gene provided by the present invention can be used as a target for both type A and type B influenza viruses through expression detection at the protein level and mRNA level, detection of influenza virus nucleoprotein content, and virus titer detection. The new target NRP1 can not only inhibit type A and type B influenza viruses from infecting host cells, but also inhibit the survival and replication of type A and type B influenza viruses in host cells.

[0064] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. The use of NRP1 gene as a target in screening drugs for preventing / treating influenza A and B virus infections, characterized in that: The nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.

1. The drug targets the NRP1 gene and inhibits or silences the expression of the NRP1 gene.

2. Application of NRP1 gene expression inhibitors in the preparation of drugs for preventing / treating influenza A and B virus infections.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.

1.

4. The use according to claim 2, characterized in that: The expression inhibitor is an RNA fragment that interferes with the expression of the NRP1 gene, or a shRNA that targets the NRP1 gene, or a small molecule compound that downregulates the expression of the NRP1 gene.

5. The use according to claim 4, characterized in that: The shRNA sequence targeting the NRP1 gene is: NRP1-shRNA-F: 5'CAGCCTTGAATGCACTTATAT3', SEQ ID NO.2; NRP1-shRNA-R: 5'ATATAAGTGCATTCAAGGCTG3', SEQ ID NO.

3.

6. A shRNA specifically targeting the NRP1 gene, characterized in that: The shRNA sequence is: NRP1-shRNA-F: 5'CAGCCTTGAATGCACTTATAT3', SEQ ID NO.2; NRP1-shRNA-R: 5'ATATAAGTGCATTCAAGGCTG3', SEQ ID NO.

3.

7. Use of the shRNA according to claim 6 in the preparation of a drug for preventing / treating influenza A and B virus infections.

8. Use of NRP1 gene expression enhancers in the preparation of influenza A and B virus replication enhancers or vaccine production enhancers.

9. The use according to claim 8, characterized in that: The nucleotide sequence of the NRP1 gene is shown in SEQ ID NO.

1.

10. The use according to claim 8, characterized in that: The replication enhancer or production enhancer targets the NRP1 gene and promotes the expression of the NRP1 gene.

Images