Insertion / deletion marker NC037647.18674876 for identifying bee colony royal jelly high-yield character and application of insertion / deletion marker NC037647.18674876

Abstract

The invention relates to an insertion and deletion marker NC037647.18674876 for identifying the high-yield character of bee colony royal jelly of western bees and application of the insertion and deletion marker NC037647.18674876 The method comprises the following steps: randomly collecting adult worker bee individuals from a to-be-detected western bee colony, extracting genome DNA (deoxyribonucleic acid) as a template, and carrying out PCR (polymerase chain reaction) amplification reaction by using a primer of NC037647.18674876 to obtain a PCR reaction product; carrying out agarose gel electrophoresis detection on the obtained PCR reaction product, and sequencing the PCR reaction liquid with a target band; nC037647.18674876 site genotyping is carried out according to a sequencing result, the genotype is a homozygous insertion type II, a homozygous deletion type DD or a heterozygous type ID, the I allele shows 14bp insertion, and the D allele shows 14bp deletion; the allele frequency of the NC037647.18674876 site of the to-be-detected western bee colony is calculated, and whether the to-be-detected western bee colony is the royal jelly high-yield bee colony or not is determined. The method can accurately, quickly and scientifically identify the royal jelly high-yield character of the western bee colony, can greatly shorten the breeding period of the royal jelly high-yield bees, and accelerates the breeding speed of the bees.

Description

Technical Field

[0001] The invention relates to a method for identifying a high-yield royal jelly trait of a bee colony, and in particular to an insertion-deletion marker NC_037647.1_8674876 for identifying a high-yield royal jelly trait of a western honey bee colony and an application thereof, belonging to the field of biotechnology. Background Art

[0002] Royal jelly is one of the main products of my country's bee industry. It is not only a key factor in regulating the development and differentiation of bees, but also has extraordinary health value for human health. Royal jelly has important pharmacological effects in regulating blood sugar and preventing Alzheimer's disease. Royal jelly has antibacterial effects, and its main active substance 10-HDA has an inhibitory effect on Staphylococcus aureus and Escherichia coli. 10-HDA also has the effect of inhibiting tumor cell proliferation and promoting cell apoptosis. Therefore, it is widely used in improving human health, medicine, health products and cosmetics.

[0003] my country is a major producer of royal jelly, accounting for more than 90% of the world's total, with an annual production of about 4,000 tons, which is closely related to the variety of bees raised in my country. In 1910, Italian honey bees were introduced, and their royal jelly production was about 0.5 to 1 kg per colony per year. The royal jelly production was extremely low and in short supply. In the last century, numerous scientists and beekeepers in my country conducted breeding research on this bee species, and collected high-yield royal jelly bee colonies in Hangzhou, Pinghu, Jiaxing, Tonglu, Shaoxing and Longyou as breeding objects. After years of directional breeding and group closed breeding, using Taihu island isolation and artificial insemination technology, a new strain of Italian bees with excellent production performance and stable genetic traits was cultivated - "Zhejiang Agricultural University No. 1" Italian bees, whose royal jelly production exceeds 10kg per colony per year, with advantages such as fast reproduction, strong honey collection ability, strong disease resistance, high royal jelly production, strong insect breeding ability and docile temperament. Later, high-yield royal jelly bee species such as Pinghu bees and Xiaoshan bees were cultivated. Therefore, the cultivation of high-yield royal jelly bee species has received more and more attention and brought great economic benefits.

[0004] For a long time, my country's beekeeping scientific and technological workers have been committed to the research of royal jelly high-yielding bees, discovered the mechanism of royal jelly high production and many genetic markers related to royal jelly high-yielding traits, strengthened the conservation and breeding of royal jelly high-yielding bee species, and fully utilized the advantages of my country's excellent bee species resources. The research on molecular genetic markers related to royal jelly high-yielding traits and the research conducted on InDel technology are summarized as follows: 1. Research on molecular genetic markers related to high royal jelly production In beekeeping, the high production of royal jelly in a bee colony has always been an important factor that beekeepers pay attention to. In order to more accurately and efficiently determine whether a bee colony is a high-production royal jelly colony, scientists have conducted in-depth research on molecular genetic marker technology to find molecular markers related to high royal jelly production traits, thereby providing a scientific basis for bee breeding and selection.

[0005] Molecular genetic markers are one of the important means in modern biotechnology. They analyze specific sequences or gene polymorphisms in the genome of organisms to explore the relationship between these markers and target traits. In the study of high-yield royal jelly traits of honey bees, researchers have widely used several molecular genetic marker technologies, including random amplified polymorphic DNA-PCR (RAPD-PCR) analysis, microsatellite DNA analysis, and gene chip technology.

[0006] For high-yield bee species of different strains, such as "Zhejiang Agricultural University No. 1", Pinghu honey bee and Xiaoshan honey bee, researchers found a specific DNA sequence fragment W316bp, which is common in worker bees but not in drones, indicating that the fragment may be associated with the high-yield trait of royal jelly. Through experimental verification, W316bp was confirmed as a reliable molecular marker for high-yield royal jelly. Microsatellite DNA analysis provides another important molecular marker method; by analyzing the microsatellite loci of different bee species, specific microsatellite markers related to the high-yield trait of royal jelly were found. Among them, the microsatellite markers of "Zhejiang Agricultural University No. 1" bees showed their particularity in evolutionary history and were closely related to their high-yield traits; with the advancement of gene chip technology, researchers can screen genes related to the high-yield trait of royal jelly in a wider range of genomes. Through gene expression analysis of high-yield and low-yield bee species, multiple differentially expressed genes were found, which are involved in biological processes such as the olfactory system, nervous system and glandular function of bees. In particular, several upregulated genes such as dop2, SsRbeta and hex71 were considered to be potential molecular markers for high royal jelly production.

[0007] The research on molecular genetic markers related to high-yield royal jelly has achieved certain results, but it still faces some challenges and limitations. Traditional molecular marker methods such as RAPD-PCR and microsatellite analysis have the disadvantage of narrow screening range and cannot fully cover all potential markers of the genome. Although gene chip technology can efficiently screen out potential molecular markers, the technology is complicated to operate and has high cost, which limits its popularity in large-scale applications. Therefore, more mature and scientific molecular technologies need to be adopted in the future to study the genetic basis of high-yield royal jelly more comprehensively and accurately. Finding a molecular marker method that is easy to operate, highly reliable and low-cost is of great significance to the development of bee breeding industry. This will provide a scientific breeding strategy for the beekeeping industry, help improve the production efficiency of royal jelly, and thus promote the sustainable development of the bee breeding industry.

[0008] 2. InDel technology InDel (Insertion-Deletion) markers are insertion-deletion markers, which refer to the difference between two genotypes in the whole genome. Compared with one genotype, the genome of the other genotype has a certain number of nucleotide insertions or deletions. According to the insertion-deletion sites in the genome, some PCR primers that specifically amplify and recognize these insertion-deletion sites are designed. This is the InDel marker, which is a type of co-dominant marker.

[0009] InDels are widely distributed in the genome, with high density and large number. In terms of distribution density, there is an InDel site every 953bp on average, second only to SNP sites, which have one every 268bp, but much higher than SSR marker sites. SNP markers have great potential in theory, but due to the problem of ambiguous analysis results after sequencing, detection methods and cost limitations, they are currently only used in the field of human diseases and have not been widely used in genetic breeding. InDel markers have high accuracy and stable variation, avoiding the difficulties in subsequent analysis due to specificity and complexity.

[0010] As a new generation of biotechnology, although my country's bee industry scientists are committed to the research of royal jelly high-producing bees, and have discovered the mechanism of royal jelly high production and many genetic markers related to royal jelly high production traits, there are still few studies and applications on royal jelly high production molecular markers. Therefore, this method uses the insertion and deletion marker (InDel) technology to identify the high royal jelly production traits of adult worker bees of the Western honey bee, based on which high royal jelly production bees can be accurately, efficiently and quickly selected for breeding, and even lay a good foundation for breeding better quality jelly-producing bees through genetic means. Summary of the invention

[0011] The invention aims to provide an insertion-deletion marker NC_037647.1_8674876 for identifying the high-yield royal jelly trait of a western honey bee colony and an application thereof.

[0012] The purpose of the present invention is achieved through the following technical solutions: The invention discloses an insertion-deletion marker NC_037647.1_8674876 for identifying the high-yield royal jelly trait of a western honey bee colony. The insertion-deletion marker NC_037647.1_8674876 is a DNA fragment with 14 bp inserted or deleted after the 8674876th base of chromosome 10 of the western honey bee genome, and the nucleotide sequence of the DNA fragment is 5'-TTTTACGTAGCCAA-3'.

[0013] A primer for detecting the insertion and deletion marker NC_037647.1_8674876, wherein the nucleotide sequence of the primer is as follows: Primer-F: 5'-CCGCTACACTCTCATTCGCACC-3', Primer-R: 5'--CGGCACCGTAATTGTCGTCGTA-3'; the size of the target band amplified by the primer is 574 bp.

[0014] The application of the above-mentioned insertion and deletion marker NC_037647.1_8674876 and primers in identifying the high-yield royal jelly traits of western honey bee colonies.

[0015] Application of the above-mentioned insertion-deletion marker NC_037647.1_8674876 and primers in western honey bee breeding.

[0016] A method for identifying the high-yield royal jelly trait of a western honey bee colony, comprising the steps of randomly collecting adult honey bee worker individuals from a western honey bee colony to be tested, extracting genomic DNA; using the extracted genomic DNA as a template, performing a PCR amplification reaction using the primers described in claim 2 to obtain a PCR reaction product; performing agarose gel electrophoresis detection on the obtained PCR reaction product, and sequencing a PCR reaction solution in which a target band appears; performing genotyping of the NC_037647.1_8674876 locus according to the sequencing result, wherein the genotype is a homozygous insertion type II, a homozygous deletion type DD, or a heterozygous ID, wherein the I allele is a 14 bp insertion, and the D allele is a 14 bp deletion; calculating the allele frequency of the NC_037647.1_8674876 locus of the western honey bee colony to be tested, and determining whether the western honey bee colony to be tested is a high-yield royal jelly colony; When the I allele frequency P of the tested western honey bee colony InDel The D allele frequency P NCWhen there is no significant difference, the tested honey bee colony is a high-yield royal jelly colony; when the I allele frequency P InDel Significantly greater than the D allele frequency P NC At this time, the tested western honey bee colony was a colony with low royal jelly production; The reaction system of the PCR amplification is: PCR reaction mixture Mix 25 μL, Primer-F 2 μL, Primer-R 2 μL, DNA template 1 μL, ddH2O 20 μL;

[0017] The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, for a total of 40 cycles; and extension at 72°C for 6 min.

[0018] Beneficial effects of the present invention: The present invention uses the InDel marker NC_037647.1_8674876 to identify the high-yield royal jelly trait of the bee colony, which has been strictly screened and verified. The samples used in the study came from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period in my country. In the bee farm, 100 colonies of Western honey bees in the high-yield royal jelly colony and the low-yield royal jelly colony were marked respectively as experimental bee colonies as research objects, and the genomic DNA of the bee samples was extracted, and the purity, concentration and integrity were tested. The library of the qualified samples was constructed, and the IlluminaNovaseq 6000PE150 sequencing platform was used for double-end sequencing, and the sequencing data was subjected to data quality control and processing. After obtaining high-quality sequencing data after quality control of each sample of high and low royal jelly production, Samtools was used to detect and obtain Indels. By θ π Ratio(θ πHRJB / θ πLRJB ) analysis method preliminarily screened out 10 Indels related to the high royal jelly production trait. The preliminarily screened Indels were verified by PCR and DNA sequencing technology on samples of high and low royal jelly producing Western honey bees, and NC_037647.1_8674876 was screened out as an insertion marker related to the royal jelly production trait.

[0019] The significant advantages of the present invention are: 1. The jelly production capacity of bee colonies is affected by genotype, and there are significant differences in specific alleles between high-yield royal jelly bee colonies and low-yield bee colonies. Therefore, the gene frequency P of the inserted fragment InDel (TTTTACGTAGCCAA) in the bee samples of the tested bee colonies was statistically analyzed. InDel The gene frequency P of "non-InDel insertion type" NC, it can conveniently, quickly and accurately identify whether the bee colony has the ability to produce high royal jelly.

[0020] 2. Determine the royal jelly production capacity of the bee colony based on statistical indicators: When the gene frequency P of the inserted fragment InDel (TTTTACGTAGCCAA) exists in the bee colony InDel The gene frequency P of "non-InDel insertion type" NC When the ratio is close to 1:1, the bee colony is a high-yield royal jelly bee colony; when the gene frequency P of the inserted fragment InDel (TTTTACGTAGCCAA) exists in the bee colony InDel Significantly greater than the gene frequency of "non-InDel insertion type" P NC When the bee colony is low in royal jelly production, the bee colony with high royal jelly production is selected accordingly to increase the royal jelly production of the bee colony, thereby increasing the income of the beekeeper. The method of identifying the high royal jelly production trait of a bee colony by using the InDel markers related to high royal jelly production of honey bees of the present invention can greatly improve efficiency.

[0021] 3. InDel is widely distributed in the genome, with high density and large number. In terms of distribution density, there is an InDel site every 953bp on average, second only to the SNP site that exists every 268bp, but much higher than the SSR marker site. SNP markers have great potential in theory, but due to the problem of ambiguous analysis results after sequencing, they have not been widely used in genetic breeding. InDel markers have high accuracy and stable variation, avoiding the difficulties in subsequent analysis due to specificity and complexity; the method of the present invention is currently mainly used in the laboratory to grasp the high royal jelly production mechanism of honey bees at the molecular level, detect molecular genetic markers related to jelly production traits, and combine molecular genetic markers to assist honey bee variety breeding technology, which can not only ensure the accuracy of selection, but also speed up the selection of honey bee varieties, greatly improve the success rate of breeding royal jelly high-producing bee species, and can safely, effectively and quickly identify royal jelly high-producing bee species. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The attached figure is a reference peak diagram and melting curve diagram of the genotype judgment of InDel markers related to high production of royal jelly in honey bees. Figure 1 The genotype of the InDel (NC_037647.1_8674876) site marked by the box is homozygous "(TTTTACGTAGCCAA) fragment insertion type", that is, type II; Figure 2 This is the melting curve of the PCR product.

[0023] Figure 3The genotype of the InDel (NC_037647.1_8674876) site is homozygous "non-InDel insertion type" (the site is marked with a red arrow), that is, homozygous "(TTTTACGTAGCCAA) fragment deletion type", that is, DD type; Figure 4 This is the melting curve of the PCR product.

[0024] Figure 5 This is the melting curve diagram of the PCR product with the heterozygous genotype of the InDel (NC_037647.1_8674876) site, with a (TTTTACGTAGCCAA) fragment inserted on one chromosome and no (TTTTACGTAGCCAA) fragment inserted on the other homologous chromosome, that is, ID type.

[0025] Figure 6 It is the average royal jelly production of high royal jelly producing bee colonies (HRJB) and low royal jelly producing bee colonies (LRJB). DETAILED DESCRIPTION

[0026] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0027] Embodiment 1: Screening of insertion / deletion markers (InDels) for identifying high royal jelly production traits in honey bee colonies.

[0028] (1) Collection of sequencing samples: The samples used in this study came from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period. First, the royal jelly production of 120 Western honey bee colonies in each of the high-yield and low-yield bee farms was recorded according to the standard royal jelly determination method. The top 100 colonies with high royal jelly production and the bottom 100 colonies with low royal jelly production were selected according to the royal jelly production ranking from high to low. Through the determination and statistical analysis of the royal jelly production of 100 high-yield royal jelly bee colonies and 100 low-yield royal jelly bee colonies, the average royal jelly production of the high-yield and low-yield colonies was 243.38g and 77.90g, respectively ( Figure 6 ), T-test analysis showed that there was a significant difference in royal jelly production between the two bee colonies (P < 0.001). One worker bee was taken from each of 100 colonies with high royal jelly production and 100 colonies with low royal jelly production, and the genomic DNA of the bee samples was extracted and tested for purity, concentration and integrity.

[0029] (2) Detection and filtering of InDels: The samples with qualified quality were used for library construction, and double-end sequencing was performed using the Illumina Novasek6000PE150 sequencing platform, and the sequencing data was quality controlled and processed. After obtaining high-quality sequencing data of each sample of high and low royal jelly production after quality control, InDels were obtained by Samtools detection, and filtered by VCFtools software to ensure the high quality of InDels (the filtering and screening conditions were set: VCFtools-maf0.05-max-missing 0.7-allow-extra-chr) to filter out sites with a minimum allele frequency of <0.05 and sites with a sample missing rate of >30%.

[0030] (3) Screening of InDels related to high royal jelly production: π Ratio(θ πHRJB / θ πLRJB ) analysis method preliminarily screened out 10 InDels related to the high royal jelly production trait. The preliminarily screened InDels were verified by PCR and DNA sequencing technology on samples of high and low royal jelly producing Western honey bees, and NC_037647.1_8674876 was screened out as an InDel marker related to the royal jelly production trait.

[0031] Embodiment 2: A method for identifying high-yield royal jelly traits of a bee colony using InDel marker NC_037647.1_8674876, comprising the following steps: (1) Sampling of individual bees: The samples used in this study were from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period. In the bee farm, 15 colonies of high-yield royal jelly bees and 15 colonies of low-yield royal jelly bees were marked as experimental colonies (all from the Western honey bee colonies whose royal jelly production has been measured in Example 1. Statistical analysis showed that there was a significant difference in royal jelly production between high-yield and low-yield bees). From each experimental colony, 3 to 4 adult worker bees that had just left the hive were collected, randomly sampled, and placed in a -20°C refrigerator for freezing for later use; (2) Extraction of honey bee sample DNA (using TIANGEN genome extraction kit) ① Place the abdominal samples of high- and low-producing royal jelly worker bees in a 1.5 mL centrifuge tube, add small magnetic beads and 200 μL buffer GA, and grind and homogenize thoroughly with a tissue disruptor; ② Add 20 μL of Proteinase K solution, mix well, and place in a 56°C metal bath to dissolve tissue fragments for 1.5 hours, turning upside down several times every 30 minutes to allow for a more complete reaction; ③ Add 200 μL of buffer GB, mix thoroughly, place in a metal bath at 70°C for 10 min, and the reaction solution becomes clear without bubbles; ④ Add 200 μL of anhydrous ethanol, shake thoroughly, and centrifuge at 12000 rpm for 2 min at room temperature; ⑤ Use a pipette to draw the solution and add it to the adsorption column, centrifuge at 12000rpm for 30s, and discard the waste liquid; ⑥Add 500μL GD buffering and 600μL rinsing solution PW in sequence, centrifuge at high speed each time and discard the waste liquid.

[0032] ⑦ Place the adsorption column in a clean centrifuge tube, add 30 μL DEPC water, place for 5 minutes, centrifuge at high speed, and repeat this step twice; ⑧ The obtained DNA was tested for concentration and OD value using NanoDrop 2000 UV spectrophotometer, and the quality of the extracted DNA was tested using agarose gel, and finally stored at -20°C for future use.

[0033] (3) The upstream and downstream primer sequences of the amplified product containing the insert fragment InDel (NC_037647.1_8674876) are as follows: Primer-F: 5'-CCGCTACACTCTCATTCGCACC-3' Primer-R: 5'-CGGCACCGTAATTGTCGTCGTA-3'.

[0034] It was diluted to 10 μmol / μL and stored at -20°C after use.

[0035] (4) PCR detection: Using the DNA of each individual bee in step (2) as a template and Primer-F and Primer-R as primers, PCR is performed, and the PCR reaction products are detected by agarose gel electrophoresis. The PCR reaction solution showing the target band is sequenced.

[0036] PCR reaction system (50 μL): Reaction mixture Mix: 25 μL Primer-F: 2 μL Primer-R: 2 μL Template:1μL ddH2O: 20 μL Reaction conditions: (5) Analysis of InDel marker NC_037647.1_8674876 and obtained sequencing results: The DNA sequence of the PCR product is shown below. The position of the InDel marker NC_037647.1_8674876 in the DNA sequence is marked as (TTTTACGTAGCCAA).

[0037] 5'-CCGCTACACTCTCATTCGCACCCCCGTTCCCCCCGCCCCCATTGTCTCTCTTTC ATCGTTGTGGTCGACGGCTTTACGTCACGACGACGCCGTCTTCCGCGAGCACACGACACACAAAAACGCCGGTCTATACCCCTCCTTTTCTCGCAATTGTCCGGAGATTCACCTGGTGAAATCGAACCTTCGACGAAGAGGGGGAGGGA GGGTGGAAATACTCGGGAATCGTTTAAGCGTCGATTATTCCAACACGTGCTTTGCTTAAAAAAGAAATATCTATAGGAATAGTAGAAA(TTTTACGTAGCCAA)TTTTTTTTCTTTTTTTATATCGATCGAGAATGAAACGACGAAGAAA CGAGAAAAAATTTTCGAAAATGATCAATCTTGTACGATCGAGCTTGAATCTCATCCAATATTTCTTTTCAACGAGGAAGGAAGAAAGAAGGAGAGACAAAGGTGAATGATGCATGGAGGAAACGTTCGAATCTCGAGTACCGGCATCGCCTCGTGTTAACGACGATTAAGACCGCGTCGCGTGCCGCCCAGGGAATAACCATTACGACGACAATTACGGTGCCG-3' Check the PCR product sequencing peak graph and locate the position of InDel marker NC_037647.1_8674876 in the peak graph. The genotype peak graph standard is as follows: Figure 1 and Figure 3 The marker position was determined to determine whether the marker of each sample was homozygous "InDel (TTTTACGTAGCCAA) fragment insertion type" or homozygous "non-InDel insertion type"; if overlapping peaks appeared in the genotype peak graph, the sample was considered to be "heterozygous InDel insertion type", and the number of individuals in the three types was counted.

[0038] Note: The peak samples have been cloned and sequenced, and the Figure 1 and Figure 3The two peak types indicate that the sample is a "heterozygous InDel insertion type", excluding nonspecific amplification; record the melting curve of the PCR product amplification as follows Figure 2 , Figure 4 and Figure 5 This further ensures that the amplified product is the target fragment.

[0039] (6) Using the InDel (NC_037647.1_8674876) marker to identify the high-yield royal jelly trait of the bee colony: The sequencing results of step (4) were aligned using BioEdi software, the peak graph types of the marker were counted, and the genotype and gene frequency were calculated, as shown in Table 1. According to the analysis results, if the gene frequency of the insertion fragment InDel (TTTTACGTAGCCAA) at the NC_037647.1_8674876 site of the identified bee colony is present, it can be determined whether the bee colony is a high-yield royal jelly bee colony.

[0040] Table 1 Effects of different genotypes on honey bee colony production capacity and gene frequency distribution Table 1 by χ 2 The Chi-Square Test statistic obtained the χ 2 =15.9645, P<0.001 shows that there are extremely significant differences between bee colonies with different royal jelly production abilities and different genotypes, which is statistically significant, indicating that the royal jelly production ability of bee colonies will be affected by genotype. InDel The D allele frequency P NC There was no significant difference, while the frequency of I allele in the low-yield group was P InDel Significantly greater than the D allele frequency P NC Therefore, the frequency of I allele P in the bee samples of the tested bee colony can be statistically analyzed. InDel The D allele frequency P NC , to determine whether the bee colony is a high-producing royal jelly bee colony.

[0041] The main reagents used in the present invention are as follows (all chemical reagents are analytically pure): Anhydrous ethanol, Proteinase K, DEPC water, gold Trans DNA Marker I, gold 2×EasyTaq PCR SuperMix, gold agarose, gold Galstain, Bio-Tech 50×TAE electrophoresis buffer, TIANGEN genome extraction kit, and upstream and downstream primers were synthesized by Bio-Tech.

[0042] The instruments used in the present invention are mainly as follows: Axygen 1.5mL centrifuge tube, Axygen PCR tube, microwave oven, electronic balance, oscillator, small centrifuge, water bath, micropipette gun, electrophoresis instrument, ABI 96-well PCR instrument, Shanghai Peiqing Technology Co., Ltd. gel imaging analyzer, high-speed centrifuge, low-temperature refrigerator, high-pressure sterilizer, NanoDrop 2000, etc.

[0043] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. An insertion-deletion marker NC_037647.1_8674876 for identifying high-yield royal jelly traits of western honey bee colonies, characterized in that: The insertion and deletion marker NC_037647.1_8674876 is a DNA fragment with 14 bp inserted or deleted after the 8674876th base of chromosome 10 of the western honey bee genome, and the nucleotide sequence of the DNA fragment is 5'-TTTTACGTAGCCAA-3'.

2. A primer for detecting the insertion and deletion marker NC_037647.1_8674876 according to claim 1, characterized in that: The nucleotide sequences of the primers are as follows: Primer-F: 5'-CCGCTACACTCTCATTCGCACC-3', Primer-R: 5'--CGGCACCGTAATTGTCGTCGTA-3'; the size of the target band amplified by the primers is 574 bp.

3. Use of the insertion-deletion marker NC_037647.1_8674876 described in claim 1 and the primers described in claim 2 in identifying the high-yield royal jelly trait of Western honey bee colonies.

4. Use of the insertion-deletion marker NC_037647.1_8674876 described in claim 1 and the primers described in claim 2 in breeding of western honey bees.

5. A method for identifying the high-yield royal jelly of a honey bee colony, characterized in that: Adult honey bee worker individuals were randomly collected from the tested western honey bee colonies, and genomic DNA was extracted; Using the extracted genomic DNA as a template, and using the primers described in claim 2 to perform a PCR amplification reaction to obtain a PCR reaction product; The obtained PCR reaction products were detected by agarose gel electrophoresis, and the PCR reaction solution with the target band was sequenced; The NC_037647.1_8674876 locus genotyping was performed according to the sequencing results, and the genotype was homozygous insertion type II, homozygous deletion type DD or heterozygous type ID, wherein the I allele showed a 14 bp insertion and the D allele showed a 14 bp deletion; Calculate the allele frequency of the NC_037647.1_8674876 locus of the tested western honey bee colony to determine whether the tested western honey bee colony is a high-production royal jelly colony.

6. The method according to claim 5, characterized in that: When the I allele frequency of the tested honey bee colony P InDel The frequency of the D allele P NC When there is no significant difference between the two, the tested honey bee colony is a high-yield royal jelly colony; when the I allele frequency of the tested honey bee colony is P InDel Significantly greater than the D allele frequency P NC At this time, the western honey bee colony to be tested was a low royal jelly production colony.

7. The method according to claim 5, characterized in that: The reaction system of the PCR amplification is: PCR reaction mixture Mix 25 μL, Primer-F 2 μL, Primer-R 2 μL, DNA template 1 μL, ddH2O 20 μL.

8. The method according to claim 5, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, for a total of 40 cycles; and extension at 72°C for 6 min.

Images