Larix olgensis SNP (Single Nucleotide Polymorphism) molecular marker, whole-genome liquid phase chip prepared from molecular marker and application of whole-genome liquid phase chip

Abstract

The invention discloses a larix olgensis SNP (Single Nucleotide Polymorphism) molecular marker, a whole-genome liquid phase chip prepared from the molecular marker and application of the whole-genome liquid phase chip. The larix olgensis SNP molecular marker comprises at least one of 61 and 680 SNP molecular markers, and the physical positions of the 61 and 680 SNP molecular markers are determined by performing sequence alignment based on a Japanese larix reference genome GCA027924585.1; the larix olgensis SNP molecular marker disclosed by the invention can be used for specifically identifying larix olgensis trees, and sites are used for preparing a larix olgensis tree species whole genome liquid phase chip; low-cost genetic typing, genetic diversity evaluation of larix olgensis, identification of germplasm resources and genetic relationships, molecular design breeding, genetic map construction and functional gene positioning, whole genome association analysis and intelligent breeding can be achieved, and the method has high application value in multiple fields of larix olgensis breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a larch SNP molecular marker and a whole genome liquid phase chip prepared therefrom and applications thereof. Background Art

[0002] Larix olgensis Henry belongs to the genus Larix in the Pinaceae family. It has a straight trunk and strong resistance to adversity. It has high economic and ecological value and is an important native timber and afforestation tree species. At present, the research on Larix olgensis Henry mainly focuses on genetic evolution and excellent family selection. Excellent germplasm is obtained by selecting excellent clones and families and hybridization, and has achieved varying degrees of development. However, due to the long growth cycle of Larix olgensis, it has become a major limiting factor in germplasm improvement. At the same time, Larix olgensis species also have problems such as uneven yield and low seed quality. The use of molecular marker breeding to construct genetic maps and establish markers associated with phenotypic traits can shorten the breeding cycle and reduce breeding costs, and improve the accuracy of breeding. The evaluation of genetic diversity for specific traits of germplasm resources can better explore and utilize excellent germplasm and improve breeding efficiency.

[0003] In recent years, the molecular markers that are widely used in larch research include RAPD, RFLP, SNP, etc. These markers have the characteristics of genetic stability and high specificity. Among them, SNP is the most numerous type of variation in the whole genome. Compared with other markers, it has the characteristics of high density, high genetic stability and easy analysis. The whole genome breeding chip is a breeding tool based on high-throughput molecular marker technology. It can cover the SNP sites of the entire genome and has the characteristics of wide coverage, high sensitivity, high throughput and high accuracy. SNP liquid phase chip has the advantages of convenient detection, low cost, high throughput and high sensitivity. The use of whole genome breeding chips to conduct a comprehensive evaluation of the genotype analysis, genetic diversity and functional gene discovery of Changbai larch germplasm resources will help accelerate the discovery of excellent germplasm resources of larch germplasm resources and the identification of new functional genes, and promote the transformation of larch from conventional breeding to molecular design breeding and intelligent breeding. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention provides a Larix olgensis SNP molecular marker.

[0005] The present invention also provides a whole genome liquid phase chip for detecting the above-mentioned Larix olgensis SNP molecular markers.

[0006] The present invention also provides a kit for detecting the above-mentioned Larix olgensis SNP molecular marker.

[0007] The invention also provides a method for screening SNP molecular markers of Larix olgensis.

[0008] The present invention also provides an application of the above-mentioned Larix olgensis SNP molecular marker, whole genome liquid phase chip or kit.

[0009] The invention also provides a breeding method for larch.

[0010] According to one aspect of the present invention, a Changbai Larix olgensis SNP molecular marker is proposed, including at least one of 61,680 SNP molecular markers, the physical positions of the 61,680 SNP molecular markers are determined by sequence alignment based on the Japanese Larix olgensis reference genome GCA_027924585.1, and the site information is specifically shown in Table 1 below.

[0011] Table 1

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082] In some embodiments of the present invention, the position information of the SNP molecular marker is expressed in the form of chromosome number: physical position, and the specific chromosome number is the chromosome number before ":" in the BSBM0100+table.

[0083] In some embodiments of the present invention, the SNP molecular marker is 0826.1:5022779G / -, where "-" represents the insertion of GAAACCGAGTCGAATGAGCCGGAGAAAAGCAAAACCGAGTCGAATGAGCCGAAGAAAAGCA.

[0084] In some embodiments of the present invention, the Alt is ".", indicating that it has multiple mutation possibilities.

[0085] In some embodiments of the present invention, when ref is A, Alt is ".", indicating that the mutation can be T, G, C or N;

[0086] When ref is T, Alt is ".", indicating that the mutation can be A, G, C, or N;

[0087] When ref is G, Alt is ".", indicating that the mutation can be T, A, C, or N;

[0088] When ref is C, Alt is ".", indicating that the mutation can be T, A, G or N, where N is a deletion.

[0089] In a second aspect of the present invention, a whole genome liquid phase chip is proposed, wherein the whole genome liquid phase chip comprises a primer set and / or a probe for detecting the above-mentioned Larix olgensis SNP molecular marker.

[0090] In the third aspect of the present invention, a kit is provided, which comprises a primer set and / or a probe for detecting the above-mentioned Larix olgensis SNP molecular marker.

[0091] In the fourth aspect of the present invention, a screening method for the above-mentioned Larix olgensis SNP molecular markers is proposed, and the screening method comprises the following steps: using the whole genome sequencing data of Larix olgensis to mine and screen the target site SNPs, then designing probes for the target site SNPs, screening the SNPs whose probes meet the requirements, and finally using them as Larix olgensis SNP molecular markers.

[0092] In some embodiments of the present invention, the mining and screening of target site SNPs includes the following steps: collecting samples of Larix olgensis and sequencing them to obtain whole genome sequencing data; aligning the whole genome sequencing data to the Japanese Larix olgensis reference genome GCA_027924585.1, and using GATK software to detect and filter SNPs; screening the markers obtained by filtering to obtain target site SNPs; the screening parameters are: Maf≥0.05, detection rate≥90%, heterozygosity≤0.3, Depth≥5.

[0093] In some embodiments of the present invention, the filtering criteria are as follows: QD<2.0||FS>60.0||MQ<35.0||MQRankSum<-12.5||Read PosRankSum<-8.0||DP>6950.

[0094] In some embodiments of the present invention, the length of the probe is 80-120 bp.

[0095] In some embodiments of the invention, the probe is about 100 bp in length.

[0096] In some embodiments of the present invention, the GC content of the probe is between 20% and 80%.

[0097] In some embodiments of the present invention, screening probes for SNPs that meet the requirements includes the following steps: sequencing the probes, and removing probes that cannot be uniquely aligned on the genome and contain repetitive sequences in the flanking sequences.

[0098] In the fifth aspect of the present invention, an application of at least one of the above-mentioned Larix olgensis SNP molecular markers, whole genome liquid phase chip and kit is proposed, and the application is an application in genotyping detection of Larix olgensis.

[0099] In some embodiments of the present invention, the application is an application in the identification of germplasm resources of Larix olgensis.

[0100] In some embodiments of the present invention, the application is an application in genome-wide association analysis of Larix olgensis.

[0101] In some embodiments of the present invention, the application is application in cluster analysis and kinship identification of Larix olgensis.

[0102] In some embodiments of the present invention, the application is application in genetic mapping and gene positioning of Larix olgensis.

[0103] In some embodiments of the present invention, the application is application in identifying the genetic diversity of Larix olgensis.

[0104] In some embodiments of the present invention, the application is application in molecular design breeding of Larix olgensis.

[0105] In some embodiments of the present invention, the application can be implemented by the following method:

[0106] S1. Perform genotyping on the sample to be tested using at least one of the Larix olgensis SNP molecular marker, whole genome liquid phase chip and kit to obtain a genotyping result;

[0107] S2. Analyze the genotyping results obtained in step S1.

[0108] In the sixth aspect of the present invention, a breeding method for Changbai Larix olgensis is proposed, comprising the following steps: using at least one of the Changbai Larix olgensis SNP molecular markers, whole genome liquid phase chip and kit to detect the DNA of the Changbai Larix olgensis to be tested, and selecting Changbai Larix olgensis for subsequent breeding.

[0109] In some embodiments of the present invention, the detection is performed based on liquid phase probe capture sequencing typing technology.

[0110] The present invention has at least the following beneficial effects:

[0111] The Changbai larch SNP molecular marker of the present invention can be used for specific identification of Changbai larch trees. Changbai larch SNP molecular markers are used to prepare a Changbai larch tree species whole genome liquid phase chip, which can realize low-cost genotyping, mainly with specificity for Changbai larch, and can also realize Changbai larch genetic diversity assessment, germplasm resource and kinship identification, molecular design breeding, genetic map construction and functional gene positioning, whole genome association analysis and smart breeding, and has high application value in multiple fields of Changbai larch breeding; and the whole genome liquid phase chip also includes 256 growth and stress resistance trait sites, which can be used for mining and utilization of important trait genes and molecular marker-assisted breeding.

[0112] At the same time, the whole genome liquid phase chip of the Changbai larch tree species prepared by the present invention can be used for low-cost and large-scale genotyping detection of Changbai larch. Because the reference genome of larch is large (up to 13Gb), the cost of obtaining genotyping results by resequencing is high. The cost of 60K liquid phase chip is reduced by more than 90% compared with resequencing (10×) typing; and based on the principle of liquid phase chip, the site is flexible, and new functional marker sites can be added at any time in the later stage. This chip also contains 256 trait-associated sites, which is more suitable for the mining and research of Changbai larch variety growth and stress resistance genes, and is conducive to the development and utilization of Changbai larch germplasm resources and the creation of new varieties.

[0113] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0115] Figure 1 : is the MAF distribution diagram in Example 1 of the present invention;

[0116] Figure 2 This is the chromosome density distribution map of the 60K cGPS liquid phase chip loci of Larix olgensis in Example 1 of the present invention;

[0117] Figure 3 This is a schematic diagram of the cGPS liquid chip process detection in Example 1 of the present invention;

[0118] Figure 4 This is a graph showing the average consistency rate of genotype detection results of technical repeated samples in Example 3 of the present invention;

[0119] Figure 5 This is a cluster analysis diagram of the larch 60K cGPS liquid phase chip in Example 4 of the present invention. DETAILED DESCRIPTION

[0120] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0121] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0122] Example 1

[0123] In this embodiment, a Larix olgensis SNP molecular marker and a Larix olgensis whole genome liquid phase chip designed based on the Larix olgensis SNP molecular marker were prepared.

[0124] 1. The screening process of SNP molecular markers for Larix olgensis is as follows:

[0125] (1) Obtaining a set of SNP candidate sites from whole-genome resequencing data

[0126] In order to obtain whole-genome loci rich in genetic information, representative germplasms from different natural distribution areas of Larix olgensis were collected, including 131 Larix olgensis materials from Heilongjiang and Jilin provinces, for whole-genome resequencing, and the library was sequenced on the MGI's DNBSEQ-T7 high-throughput sequencing platform. SNP calling was filtered using fastp (v0.20.0) according to the process, aligned to the Japanese larch reference genome (GCA_027924585.1) using Burrows-Wheeler Aligner (0.7.12-r1039), sorted and converted sam files into bam files using picard1.107 software (http: / / www.psc.edu / index.php / user-resources / software / picard), and PCR duplicates were removed. GATK software was used to detect and filter SNPs. According to the genomic data, the filtering criteria were as follows: QD<2.0||FS>60.0||MQ<35.0||MQRankSum<-12.5||Read PosRankSum<-8.0||DP>6950. After filtering, a .vcf file containing SNP variation information of all samples was obtained.

[0127] (2) Site screening

[0128] The MAF (Minor Allele Frequency) values, detection rates, heterozygosity rates, and sequencing depths of the SNP sites of all samples were statistically analyzed, and 228,174,614 SNP sites were screened based on the parameters of MAF ≥ 0.05, detection rate ≥ 90%, heterozygosity rate ≤ 0.3, and Depth ≥ 5, and these sites were used for probe design. The principle of probe design is to design probes within 100 bp of all target sites. The probe length is generally 100 bp, and the GC content is between 20% and 80%. According to the probe design results, probes that cannot be uniquely aligned on the genome and contain repetitive sequences in the flanking sequences are removed. Based on the principle of uniform distribution, 61,424 SNP sites with high polymorphism and good versatility (such as Figure 1 At the same time, combined with the existing research results of the subject (differential sites obtained by transcriptome sequencing analysis) and 256 important trait association sites mined by whole genome association analysis, including DBH, annual branch length, conifers and stress resistance, 61,680 candidate SNP sites were finally obtained, as shown in Table 1 of the manual. Chromosome distribution map is shown in Figure 2 .

[0129] 2. Larix olgensis whole genome liquid phase array

[0130] Based on the 61,680 SNP sites obtained through screening, liquid capture probes were synthesized by Huazhi Biotechnology Co., Ltd., and the precise positioning sequencing typing technology (cGPS) based on liquid phase capture of the target region genome sequence was used to form a system of Changbai Larix olgensis whole genome liquid phase chip, and the Changbai Larix olgensis whole genome liquid phase chip (61,680 SNP liquid phase chip) was prepared.

[0131] Based on an optimized thermodynamic stability algorithm model, cGPS designs probes for genomic sequences in different target regions, uses synthetic specific probes to capture and enrich multiple target sequences located at different genomic locations by liquid phase hybridization, and then constructs sequencing libraries and performs high-throughput sequencing on the captured and enriched target genomic sequences, thereby obtaining the genotypes of all SNP / InDel sites in the target region, such as Figure 3 shown.

[0132] Example 2

[0133] This example provides a method for using the Larix olgensis whole genome liquid phase chip in the above-mentioned Example 1 in identifying Larix olgensis, which specifically includes the following contents:

[0134] 1. Extraction and detection of gDNA from Larix olgensis

[0135] Twelve samples of Larix olgensis were selected as validation samples for the development system of the whole genome liquid phase chip of Larix olgensis. Fresh needle tissues of 12 samples of Larix olgensis were collected and gDNA was extracted from the tissues using the magnetic bead method. The integrity and purity of gDNA were analyzed by 1% agarose gel electrophoresis, and the concentration was accurately quantified using Qubit.

[0136] 2. cGPS Experiment Process

[0137] (1) Take 200 ng of gDNA that has passed the quantitative quality inspection, use an enzyme digestion reagent to cut the DNA into fragments of 100-500 bp in size, and then add Taq enzyme for end repair;

[0138] (2) Use T4 ligase to connect the adapter fragments to both ends of the DNA, use fragment sorting magnetic beads to purify the ligation products and amplify the library to complete the library construction;

[0139] (3) Place the library that has passed the quality inspection, the blocking reagent, the RNase inhibitor RNase Block, and the 60K liquid phase chip probe on a PCR instrument for hybridization reaction, and incubate the hybridization at 55°C overnight (16-24h);

[0140] (4) The hybridization product was captured using streptavidin, and the captured library was amplified and enriched, and PE150 sequencing was performed using the BGI sequencing platform; (5) The raw data after high-throughput sequencing was processed by quality control filtering, and fastp software was used to remove reads containing adapter contamination and low-quality reads. BWA software was used to compare with the target genome, and then GATK software was used to analyze the variant sites of the sequencing results to obtain the genotyping results of the target site. The process diagram is shown in the figure. Figure 3 shown.

[0141] Example 3 Evaluation of genotyping effect of Larix olgensis whole genome liquid phase chip

[0142] To verify the genotyping effect of the Larix olgensis whole genome liquid phase chip, 15 Larix olgensis samples (including 3 duplicate samples) were genotyped using the Larix olgensis whole genome liquid phase chip obtained in Example 1 (see Example 2 for specific operation methods).

[0143] Table 2 Detection rate of 15 samples of Larix olgensis

[0144]

[0145] The results are shown in Table 2 and Figure 4 As shown in Table 2, the detection rates of the 15 samples ranged from 97.17% to 98.68%, with an average detection rate of 98.05%. Figure 4 It can be seen that the consistency of the genotype results of the three repeated samples is between 98.00% and 98.92%, and the average consistency is 98.31%.

[0146] Example 4 Evaluation of genotyping effect of Larix olgensis whole genome liquid phase chip

[0147] The whole genome liquid phase chip of Larix olgensis prepared in Example 1 was used to test 673 samples of different Larix olgensis (known sources), and the sample genotyping was extracted. The genetic distance matrix was calculated based on the IBS method using Plink software and cluster analysis was performed. The phylogenetic tree diagram was constructed to determine the kinship, evolutionary relationship and composition structure of different materials.

[0148] The results are as follows Figure 5 As shown, the results show that the whole genome liquid phase chip of Larix olgensis prepared by the scheme of the present invention can effectively distinguish Larix olgensis varieties from different sources.

[0149] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A SNP molecular marker for Larix olgensis, characterized in that: It includes at least one of 61,680 SNP molecular markers, the physical positions of the 61,680 SNP molecular markers are determined by sequence alignment based on the Japanese larch reference genome GCA_027924585.1, and the site information is specifically shown in Table 1 in the specification.

2. A whole genome liquid phase chip, characterized in that: The whole genome liquid phase chip comprises a primer set and / or a probe for detecting the Larix olgensis SNP molecular marker as claimed in claim 1.

3. A kit, characterized in that: The kit comprises a primer set and / or a probe for detecting the Larix olgensis SNP molecular marker as claimed in claim 1.

4. A method for screening SNP molecular markers of Larix olgensis according to claim 1, characterized in that: The screening method comprises the following steps: mining and screening target site SNPs using whole genome sequencing data of Larix olgensis, designing probes for the target site SNPs, screening SNPs whose probes meet the requirements, and finally using them as Larix olgensis SNP molecular markers.

5. The screening method according to claim 4, characterized in that The mining and screening of target site SNPs includes the following steps: collecting representative samples from the Changbai Larix olgensis distribution area, sequencing to obtain whole genome sequencing data; aligning the whole genome sequencing data to the Japanese Larix olgensis reference genome GCA_027924585.1, and using GATK software to detect and filter SNPs; screening the filtered markers to obtain target site SNPs; the screening parameters are: Maf≥0.05, detection rate≥90%, heterozygosity≤0.3, Depth≥5.

6. The screening method according to claim 5, characterized in that The filtering criteria are as follows: QD<2.0||FS>60.0||MQ<35.0||MQRankSum<-12.5||Read PosRankSum<-8.0||DP>6950.

7. The screening method according to claim 4, characterized in that The length of the probe is 80-120 bp.

8. The screening method according to claim 4, characterized in that The GC content of the probe is between 20% and 80%.

9. Use of one of the Larix olgensis SNP molecular markers according to claim 1, the whole genome liquid phase chip according to claim 2, and the kit according to claim 3 in any of the following: (1) Application in genotyping of Larix olgensis; (2) Application in identification of Larix olgensis germplasm resources; (3) Application in genome-wide association analysis of Larix olgensis; (4) Application in cluster analysis and phylogenetic identification of Larix olgensis; (5) Application in genetic mapping and gene localization of Larix olgensis; (6) Application in identification of genetic diversity of Larix olgensis; (7) Application in molecular design breeding of Larix olgensis.

10. A breeding method for Larix olgensis, characterized in that: The method comprises the following steps: using one of the Changbai larch SNP molecular markers as claimed in claim 1, the whole genome liquid phase chip as claimed in claim 2 and the kit as claimed in claim 3 to detect the DNA of the Changbai larch to be tested, and selecting the Changbai larch for subsequent breeding.

Images