Small interfering RNA (Ribonucleic Acid) nanoparticles as well as preparation method and application thereof

Abstract

The invention discloses small interfering RNA (Ribonucleic Acid) nanoparticles as well as a preparation method and application thereof. The small interfering RNA nanoparticle comprises a polyethyleneimine vector, a small interfering RNA and an sp13c aptamer, wherein the polyethyleneimine vector is a polyethyleneimine vector; the nucleotide sequence of the polyethyleneimine vector is as shown in SEQ ID NO.3, the nucleotide sequence of the small interfering RNA is as shown in SEQ ID NO.11, and the compounding ratio of the polyethyleneimine vector to the small interfering RNA to the sp13c aptamer is (0.2-2): (0.5-5): (0.2-2). The drug delivery carrier of the small interfering RNA is prepared by adopting a rolling circle transcription method, meanwhile, the sp13c aptamer is used as a bladder cancer targeting molecule of the nano delivery system, the drug loading capacity of the small interfering RNA is high, and compared with a control group of an unmodified sp13c aptamer, the bladder cancer cell targeting efficiency of the small interfering RNA is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of gene therapy, and in particular to a small interfering RNA nanoparticle and a preparation method and application thereof. Background Art

[0002] Bladder cancer is one of the most common malignant tumors worldwide, especially in industrialized countries. It mainly affects the urothelial cells in the bladder. The incidence of bladder cancer is related to multiple factors, including smoking, exposure to chemicals (such as aromatic amines), occupational exposure, and chronic cystitis. The symptoms of bladder cancer are mostly painless hematuria. Early bladder cancer is often limited to the bladder endometrium, but as it progresses, it can invade the bladder muscle layer and even metastasize to distant sites. According to the depth of tumor infiltration, it can be divided into non-muscle invasive bladder cancer (NMIBC) and muscle invasive bladder cancer (MIBC), and the treatment and prognosis of the two are quite different. The treatment of bladder cancer is based on the tumor stage, the patient's health status and individual characteristics, and a variety of treatment strategies are often used, mainly including surgical treatment, chemotherapy, immunotherapy and targeted therapy.

[0003] Small interfering RNA (siRNA) is a proven effective gene drug that can specifically silence gene expression through the RNA interference (RNAi) mechanism. In recent years, it has attracted widespread attention in cancer treatment, especially in the treatment of bladder cancer, showing great potential. However, the low efficiency of small interfering RNA entering bladder cancer cells has become the main bottleneck limiting its application in bladder cancer treatment. There are three main reasons for the difficulty of small interfering RNA entering bladder cancer cells: (1) small interfering RNA is negatively charged and has low affinity with the tumor cell membrane, which is also negatively charged; (2) the drug loading capacity of the drug carrier used to deliver small interfering RNA is low; (3) both small interfering RNA and the delivery carrier of small interfering RNA lack targeting to bladder cancer cells.

[0004] In order to improve the efficiency of small interfering RNA entering bladder cancer cells, researchers have developed different drug delivery systems. For example: (1) Improving the targeting of nanoparticles by covalently binding and modifying hyaluronic acid dialdehyde; (2) Covalently modifying chitosan on the surface of nanoparticles by biotin-avidin to increase the efficiency of nanoparticles entering bladder cancer cells by increasing mucosal adhesion; (3) Extracting exosome vesicles from the human embryonic kidney cell line HEK-293T, and loading small interfering RNA into exosomes by electroporation, using the affinity between the exosome membrane and the bladder cancer cell membrane to improve the efficiency of small interfering RNA entering the cell. In response to (1), the carrier uses electrostatic binding to encapsulate small interfering RNA, and has limited adsorption capacity for small interfering RNA, so the drug loading is low, and there are disadvantages such as unstable drug loading and easy premature leakage of drugs. In addition, the preparation process of the carrier also involves the preparation process of hyaluronic acid dialdehyde, which is more complicated and time-consuming. For (2), the target head is covalently modified with biotin-avidin, which is a complicated process and more time-consuming and labor-intensive. Surface modification with chitosan can only increase the mucosal adhesion of the carrier, but cannot distinguish between normal cells and cancer cells in the bladder wall, and the effect of improving targeting is limited. For (3), it is prepared based on exosomes secreted by human cell lines, but has shortcomings such as unclear carrier components and poor stability between product batches; the electroporation method is used to encapsulate small interfering RNA, which requires equipment support and has low encapsulation efficiency, resulting in low drug loading of the carrier; the carrier lacks targeting to bladder cancer cells. None of the above drug delivery systems can take into account high targeting efficiency, drug loading stability and drug loading.

[0005] Therefore, there is an urgent need to provide small interfering RNA nanoparticles with high drug loading, high targeting efficiency to bladder cancer cells and simple preparation method. Summary of the invention

[0006] In view of the defects in the prior art, the present invention proposes a small interfering RNA nanoparticle and its preparation method and application. The present invention proposes a nanoparticle that can deliver small interfering RNA to bladder cancer cells in a targeted manner, the nanoparticle has clear ingredients, simple preparation steps, high drug loading and high targeting to bladder cancer cells.

[0007] The present invention provides a small interfering RNA nanoparticle, comprising a polyethyleneimine carrier (PEI), a small interfering RNA (siRNA) and an sp13c aptamer;

[0008] The nucleotide sequence of the small interfering RNA is shown in SEQ ID NO.3;

[0009] The nucleotide sequence of the sp13c aptamer is shown in SEQ ID NO.11;

[0010] The compounding ratio of the polyethyleneimine carrier, the small interfering RNA and the sp13c aptamer is (0.2-2): (0.5-5): (0.2-2), preferably 2:1:1.

[0011] The present invention affects the stability of the complex, the targeting recognition ability, and the cell uptake and release efficiency of siRNA by adjusting the different ratios of PEI, siRNA and sp13c aptamers in small interfering RNA nanoparticles, thereby maximizing the uptake efficiency of siRNA by bladder cancer cells. When the ratio of sp13c aptamers is too high, its conversion rate in nanoparticles is reduced, and the stability of the nanostructure is reduced; when the ratio of sp13c aptamers is too low, the targeting efficiency is reduced, resulting in a weakened specific recognition ability of nanoparticles for bladder cancer cells.

[0012] In some embodiments, the particle size of the small interfering RNA nanoparticles is 100 to 500 nm; the particle size of the nanoparticles can affect the effectiveness of the sp13c aptamer, and the particle size within a specific range can provide a larger surface area, allowing the sp13c aptamer to better bind to specific receptors on tumor cells, thereby improving the targeting efficiency.

[0013] In some embodiments, the drug loading of the small interfering RNA is 10 to 50 wt %, preferably 20 to 50 wt %.

[0014] The present invention also provides a method for preparing the small interfering RNA nanoparticles, comprising the following steps:

[0015] (i) amplifying small interfering RNA using rolling circle transcription to produce small interfering RNA microparticles;

[0016] (ii) compressing the small interfering RNA microparticles described in (i) into nanoparticles using polyethyleneimine;

[0017] (iii) modifying the nanoparticles of (ii) using sp13c aptamers to obtain the small interfering RNA nanoparticles.

[0018] The present invention adopts the rolling circle transcription method to prepare the drug delivery vector of small interfering RNA. The backbone of the vector itself is mainly composed of long-chain RNA containing small interfering RNA fragments. Compared with other existing technologies that require the addition of additional materials as a backbone, the drug loading efficiency of small interfering RNA can be effectively improved.

[0019] In some embodiments, the step (i) is specifically as follows:

[0020] The small interfering RNA template sequence and the T7 promoter sequence are mixed and denatured to form a circular DNA molecule, which is then connected using T4 ligase and subjected to rolling circle transcription and ultrasonic treatment to obtain small interfering RNA microparticles;

[0021] The small interfering RNA template sequence is shown in SEQ ID NO.9.

[0022] In some embodiments, the step (iii) is specifically as follows:

[0023] The nanoparticle solution (ii) is mixed with the sp13c aptamer, stirred and centrifuged, the supernatant is discarded, and the solution is resuspended in nuclease-free water.

[0024] In some embodiments, the sequence of the T7 promoter is shown as SEQ ID NO.10.

[0025] The present invention also provides application of the small interfering RNA nanoparticles in preparing medicine for treating bladder cancer.

[0026] In summary, compared with the prior art, the present invention achieves the following technical effects:

[0027] 1. The present invention adopts the rolling circle transcription method to prepare the drug delivery vector of small interfering RNA, and uses the sp13c aptamer as the targeting molecule of the nano-delivery system targeting bladder cancer, and compounded with the small interfering RNA particles in a specific ratio, which significantly improves the conversion rate of the sp13c aptamer and the targeting efficiency of the small interfering RNA to bladder cancer cells.

[0028] 2. The preparation method of the small interfering RNA nanoparticles of the present invention is simple, easy to operate, and has high drug loading stability. It can effectively protect the small interfering RNA from degradation, improve drug delivery efficiency, and is suitable for a wide range of application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0030] Figure 1 This is a comparison of the knockdown effects of different siERCC2 sequences on bladder cancer cell ERCC2 expression in Example 1 of the present invention; the scrambled siRNA treatment group served as the negative control group. n = 3 per group; NS, no significant difference; * significant difference (P < 0.05); *** extremely significant difference (P < 0.001).

[0031] Figure 2 This is the effect of surface-modified sp13c aptamers on the uptake efficiency of nanoparticles by bladder cancer cells in Example 4 of the present invention; Figure 1 A is the ratio of Cy5 fluorescence positive cells detected by flow cytometry; Figure 1B is the mean fluorescence intensity of Cy5 detected by flow cytometry; n = 3 for each group; NS, no significant difference; *** extremely significant difference (P < 0.001). DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only embodiments of a part of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention.

[0033] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used are all commercially available unless otherwise specified.

[0034] The invention discloses a small interfering RNA self-assembled nanoparticle targeting bladder cancer. The preparation method thereof comprises the following steps: (1) DNA fragments encoding small interfering RNA sequences are connected end to end, and long RNA fragments containing a large number of small interfering RNA copies are prepared by in vitro transcription using a rolling circle transcription method, and self-assembled to form micrometer-scale particles during the transcription process; (2) cationic polymer polyethyleneimine (PEI) is used to compress the self-assembled microparticles to nanometer scale; (3) the surface of the compressed small interfering RNA self-assembled nanoparticles is modified with sp13c aptamers through electrostatic interaction and base complementary pairing, and the high affinity of sp13c with CKAP4, a surface membrane marker of bladder cancer cells, is used to obtain targeting to bladder cancer. Compared with a control group of unmodified sp13c aptamers, the efficiency of the nanoparticles being taken up by bladder cancer cells is significantly improved.

[0035] Example 1 Screening of siRNA sequences targeting ERCC2

[0036] In order to screen out the siERCC2 sequence with the highest gene silencing efficiency, fluorescent quantitative polymerase chain reaction was used to detect the knockdown effect of different siERCC2 sequences on the mRNA expression of ERCC2 after transfection of cells.

[0037] Three siRNAs targeting ERCC2 and one random scrambled siRNA without specific targeting were designed as a negative control and commissioned to Shenzhen BGI Genomics Co., Ltd. for chemical synthesis to obtain dry powder. The sequence of siERCC2-#1 is:

[0038] 5'-GGAAGACAGUAUCCCUGUU-3' (SEQ ID NO. 1).

[0039] The sequence of siERCC2-#2 is:

[0040] 5'-GAAGGACGUCGAUGGGAAA-3' (SEQ ID NO. 2).

[0041] The sequence of siERCC2-#3 is:

[0042] 5'-GAAAGUUGCUCAACUUCUA-3' (SEQ ID NO. 3).

[0043] The sequence of the scrambled siRNA is:

[0044] 5'-GACGAGCGGCACGUGCACAUU-3' (SEQ ID NO. 4).

[0045] Dissolve siRNA dry powder in pure water without nuclease. Take bladder cancer cisplatin-resistant cell line BIU-87 / DDP and plate 12-well plate, 1×10 5 Cells were incubated at 37°C, 5% CO2 for 12 hours. 200 pmol siRNA was diluted in 50 μL of Opti-MEM Reduced Serum Medium. 1 μL of Lipofectamine 2000 was diluted in 50 μL of Opti-MEM Reduced Serum Medium. Gently mix and incubate at room temperature for 15 minutes. The two were then gently mixed and incubated at room temperature for 15 minutes to form a complex, which was then added to the wells containing cells and medium. Gently mix by shaking the plate back and forth. Incubate the cells at 37°C in a humidified CO2 incubator for 24 hours. The supernatant of the culture medium was discarded. The cells were digested with trypsin (0.25%) for 3 minutes, followed by termination of digestion with complete medium and centrifugation at 4°C, 500g for 5 minutes. The supernatant was discarded and 1 mL of TRIZol lysis buffer was added to each well and lysed at room temperature for 5 minutes.

[0046] Extract total cell RNA: Add 0.2 mL of chloroform to 1 mL of Trizol cell lysis buffer, mix by violent inversion 10 times, and let stand for 2 minutes. Transfer the resulting mixture to a 1.5 mL EP tube and centrifuge at 12000g for 10 minutes in a 4°C centrifuge. At this time, the tube is divided into 3 layers. Only 400 μL of the upper aqueous phase is transferred to a nuclease-free 1.5 mL EP tube. Add 0.5 mL of isopropanol, mix by violent inversion 10 times, and let stand at room temperature for 10 minutes. Place in a 4°C centrifuge, centrifuge at 12000g for 10 minutes, and discard the supernatant. Add 1 mL of 75% ethanol and gently wash the precipitate. Centrifuge at 4°C, 7500g for 5 minutes, discard the supernatant, and repeat this washing step twice. Wipe the tube wall with dust-free paper, dry the precipitate, and add 65°C preheated RNase-free water to dissolve it. Measure the sample concentration by ultraviolet absorption at 260nm and 280nm.

[0047] Reverse transcription: Use the reverse transcription kit produced by Yisheng Biotechnology (Shanghai) Co., Ltd. Ⅲ1st Strand cDNA Synthesis SuperMix for qPCR was used to reverse transcribe the total RNA sample of the cell. Dissolve 1μg of RNA sample in 12μL of RNase-free water, add 3μL of 5×gDNA digester Mix, and react at 42℃ for 2min. Then add 5μL of 4×Hifair III SuperMix plus, mix well, and put into the PCR instrument for reverse transcription reaction. The temperature program was set to 25℃ for 5min; 55℃ for 15min; 85℃ for 5min. After the reaction, aliquot and store at -80℃ for later use.

[0048] Fluorescence quantitative polymerase chain reaction: The fluorescence quantitative polymerase chain reaction kit Hieff qPCR SYBR Green Master Mix produced by Yisheng Biotechnology (Shanghai) Co., Ltd. was used for detection. The primers for detecting ERCC2 and the internal reference gene GAPDH were commissioned to Shenzhen BGI Co., Ltd. for chemical synthesis. Among them:

[0049] The forward primer sequence of ERCC2 was AGCAGTTCTCCTACATGCGG (SEQ ID NO. 5), and the reverse primer sequence was CTCCAGCGGATATGCTCTCT (SEQ ID NO. 6);

[0050] The forward primer of the internal reference gene GAPDH was GGAGCGAGATCCCTCCAAAAT (SEQ ID NO. 7), and the reverse primer was GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 8).

[0051] According to the instructions of the reagents, the different components required for the reaction were mixed and added to the PCR tube, and the fluorescent quantitative polymerase chain reaction was performed according to the following reaction. Pre-denaturation at 95℃ for 1min; then the following temperature change reaction was repeated for 40 cycles: denaturation at 95℃ for 15s; annealing at 57℃ for 15s; extension at 72℃ for 15s. After the cycle, extension was performed at 72℃ for 2min.

[0052] Figure 1 The results showed that among the three siERCC2 tested, siERCC2-#3 had the best gene silencing efficiency, and the mRNA expression of ERCC2 in cells transfected with siERCC2-#3 was significantly lower than that of the other two candidate siECC2, reduced to 15.2% of the negative control expression. Therefore, siERCC2-#3 was selected as the sequence for preparing ERCC2 small interfering RNA microparticle templates.

[0053] Example 2 Preparation of ERCC2-targeted small interfering RNA microparticles by rolling circle transcription

[0054] A single-stranded linear DNA template (phosphorylated at the 5' end) encoding ERCC2 small interfering RNA and a single-stranded DNA primer containing a T7 promoter were designed and commissioned to Shenzhen BGI Co., Ltd. for chemical synthesis to obtain a dry powder (HPLC grade purity).

[0055] Dissolve the dry powder in pure water without nuclease, take 1μM linear template and mix with 0.5μM T7 promoter primer, heat at 95℃ for 2min to completely denature both, let stand at room temperature for 1h and wait for it to slowly cool down to 25℃, so that the two can fully hybridize to form a circle through base complementary pairing; connect the cut of circular DNA with T4 ligase (5U / μL) and react at 4℃ for 12h. After the connection is completed, add 7.5mM NTP, 2μL T7 RNA transcription polymerase, 10μL reaction buffer, add nuclease-free water to adjust the final volume to 100μL, and react at 37℃ for 18h. Add 1U DNase I and react at 37℃ for 30min to terminate transcription. The obtained reaction product is placed in a water bath for 5min. After the end of ultrasound, the solution is centrifuged at 3000g for 6min, the supernatant is discarded to remove the unreacted raw materials, and resuspended with nuclease-free water. Repeat the steps of ultrasound to resuspending the sample twice.

[0056] Among them, the DNA single-stranded linear template sequence encoding ERCC2 small interfering RNA is:

[0057] 5'-Phosphate-ATAGTGAGTCGTATTAACGTACCAACGAAAGTTGCTC AACTTCTAACTTGTAGAAGTTGAGCAACTTTCTAGAGGCATATCCCT-3' (SEQ ID NO. 9);

[0058] The sequence of the single-stranded DNA primer containing the T7 promoter is:

[0059] 5'-TAATACGACTCACTATAGGGAT-3' (SEQ ID NO. 10).

[0060] In order to determine the yield of the prepared microparticles, the product produced by rolling circle transcription without centrifugation purification was added to a 10kD ultrafiltration tube, centrifuged at 7500g for 1 min, and the filtrate was taken to measure the ultraviolet absorbance of free ribonucleotides at 280nm. Combined with the standard curve of ribonucleotide standards, the concentration of free ribonucleotides in the filtrate can be calculated. The total amount of ribonucleotides input minus the content of unreacted free ribonucleotides is used to obtain the ribonucleic acid content of the microparticles. In this embodiment, 120μg of microparticles can be prepared from 100μL of the reaction system.

[0061] Example 3 Compression of microparticles and surface target modification

[0062] The particle size of the reaction particles prepared in Example 2 is usually above the micrometer level, and it is necessary to add cationic polymer polyethyleneimine PEI (molecular weight 25kDa) to compress it to the nanometer scale. PEI (100μL, concentration 0.6μg / μL) was added to the particle reaction solution (100μL, concentration 1.2μg / μL) at a mass ratio of 0.5:1 (PEI: particle), and mixed and reacted at room temperature for 4h.

[0063] After the reaction, the supernatant was discarded after centrifugation at 15000g for 15min, the unreacted raw materials were removed, and then the mixture was resuspended in nuclease-free water (100μL) to obtain a compressed nanoparticle solution. The compressed nanoparticle solution (100μL, 1.8μg / μL) was mixed with the sp13c aptamer (100μL, 0.6μg / μL) at a mass ratio of 1:0.5, stirred at room temperature for 4h, centrifuged at 15000g for 15min, the supernatant was discarded, the unreacted sp13c aptamer was removed, and then the mixture was resuspended in nuclease-free water to assemble the surface-modified sp13c small interfering RNA self-assembled nanoparticles targeting bladder cancer ERCC2.

[0064] The sp13c aptamer sequence is:

[0065] 5'-ATAGTGAGTCGTATTAAGCCCTCGGGATTATCGGTGTTTATGGTGTCTGTCTATCACGTGGAGCT-3' (SEQ ID NO. 11).

[0066] Example 4 Drug loading and particle size potential determination

[0067] In order to measure the drug loading of small interfering RNA in the nanoparticles, the supernatant discarded by two centrifugations in Example 3 was recovered and used to determine the concentrations of unreacted PEI and unbound sp13c aptamer, respectively. The content of PEI and sp13c aptamer in the final product was obtained by subtracting the mass of unreacted free product from the total amount of raw materials put into the reaction.

[0068] The unreacted PEI content can be obtained by reacting with 0.1% methyl orange for 30 minutes and measuring its absorbance at 490 nm. The unreacted sp13c aptamer content can be obtained by measuring its ultraviolet absorbance at 280 nm.

[0069] In this embodiment, it is calculated that more than 96% of the PEI and more than 99% of the sp13c aptamers are successfully converted into components of nanoparticles. Combined with the mass ratio of the raw materials input in the reaction described in Example 2, it can be seen that in the final product, the mass ratio of microparticles: PEI: sp13c aptamers is about 2:1:1. According to the number of small interfering RNA sequence bases (38 bases) in the DNA single-stranded linear template sequence (84 bases) encoding ERCC2 small interfering RNA, the mass proportion of small interfering RNA in the microparticles can be obtained as: 38 / 84=45.2%. Therefore, the drug loading of small interfering RNA is 45.2%×2 / (2+0.96+0.99)=22.9%.

[0070] The prepared nanoparticle solution was centrifuged to remove the supernatant, and then resuspended in phosphate buffer (0.01M), and then the particle size was detected by NanoBrook / 90Plus PALS particle size potential analyzer, and each group was tested three times in parallel. After the particle size detection, phosphate buffer (0.01M) was added for appropriate dilution, and then ζ potential analysis was performed. The average particle size was 190.3nm and the polymer dispersion index (PDI) was 0.166 as determined by dynamic light scattering.

[0071] Example 5 Effect of surface high concentration target head modified nanoparticles on target head utilization

[0072] The particle size of the reaction particles prepared in Example 2 is usually above the micrometer level, and it is necessary to add cationic polymer polyethyleneimine PEI (molecular weight 25kDa) to compress it to the nanometer scale. PEI (100μL, concentration 0.6μg / μL) was added to the particle reaction solution (100μL, concentration 1.2μg / μL) at a mass ratio of 0.5:1 (PEI: particle), and mixed and reacted at room temperature for 4h.

[0073] After the reaction, the supernatant was discarded after centrifugation at 15000g for 15min, the unreacted raw materials were removed, and then the mixture was resuspended in nuclease-free water (100μL) to obtain a compressed nanoparticle solution. The compressed nanoparticle solution (100μL, 1.8μg / μL) was mixed with the sp13c aptamer (100μL, 5μg / μL) at a mass ratio of 1:5, stirred at room temperature for 4h, centrifuged at 15000g for 15min, the supernatant was discarded, the unreacted sp13c aptamer was removed, and then the mixture was resuspended in nuclease-free water to assemble the surface-modified sp13c small interfering RNA self-assembled nanoparticles targeting bladder cancer ERCC2.

[0074] In order to measure the drug loading of small interfering RNA in the nanoparticles, the supernatant discarded from the two centrifugations in the above reaction process was recovered and used to determine the concentrations of unreacted PEI and unbound sp13c aptamer, respectively. The content of PEI and sp13c aptamer in the final product was obtained by subtracting the mass of unreacted free product from the total amount of raw materials input into the reaction.

[0075] The unreacted PEI content can be obtained by reacting with 0.1% methyl orange for 30 minutes and measuring its absorbance at 490 nm. The unreacted sp13c aptamer content can be obtained by measuring its ultraviolet absorbance at 280 nm.

[0076] In this embodiment, it is calculated that more than 94.2% of the PEI input and only 11.5% of the sp13c aptamer input are successfully converted into the components of the nanoparticles. Combined with the mass ratio of the raw materials input in the reaction, it can be seen that in the final product, the mass ratio of microparticles: PEI: sp13c aptamer is about 2: 0.94: 1.16. According to the number of small interfering RNA sequence bases (38 bases) in the DNA single-stranded linear template sequence (84 bases) encoding the ERCC2 small interfering RNA, the mass proportion of small interfering RNA in the microparticles can be obtained as: 38 / 84 = 45.2%. Therefore, the drug loading of small interfering RNA is 45.2% × 2 / (2 + 0.94 + 0.12) = 22.0%.

[0077] Example 6 Effect of surface-modified sp13c aptamers on the uptake efficiency of small interfering RNA self-assembled nanoparticles by bladder cancer cells

[0078] (1) Preparation of fluorescent nanoparticles:

[0079] The preparation process of ERCC2 small interfering RNA self-assembled nanoparticles is the same as that in Example 3, wherein when adding NTP for in vitro transcription reaction, guanosine acid labeled with fluorescent group Cy5 (Cy5-UTP, 0.5 μM) is additionally added, and the other steps remain unchanged to obtain Cy5-NPs-AP.

[0080] (2) Preparation of fluorescent nanoparticles without sp13c modification:

[0081] The preparation steps were the same as those described in Example 3, except that the last step of adding the sp13c aptamer was omitted to obtain Cy5-NPs.

[0082] (3) Cellular uptake detection:

[0083] Normal human bladder epithelial cell line SV-HUC-1 and bladder cancer cisplatin-resistant cell line BIU-87 / DDP were plated in 12-well plates, with 1×10 5 cells, cultured at 37°C, 5% CO2 for 12h. At the same time, three treatment groups were set up in the two cell lines, namely, Cy5-labeled ERCC2 small interfering RNA (Cy5-siRNA, commissioned to Shenzhen BGI Co., Ltd. for synthesis) group, Cy5-NPs group and Cy5-NPs-AP group, and the drug concentration of the three was 4μg / mL. After continuing to culture for 12h, the culture supernatant was discarded. The cells were digested with trypsin (0.25%) for 3min, then digested with complete culture medium, and centrifuged at 4°C, 500g for 5min. The supernatant was discarded, the cells were resuspended with phosphate buffer, and the centrifugation-resuspension steps were repeated twice. Transferred to the flow tube in the flow cytometer (CytoFLEX, Beckman Coulter), and the flow cytometer was used to detect the proportion of Cy5 fluorescence-positive cells and the average fluorescence intensity.

[0084] The results are as follows Figure 2 As shown, Figure 2 In A, after the small interfering RNA was prepared into nanoparticles, regardless of whether it was modified with the sp13c aptamer, the proportion of positive cells taken up in the two cell lines was significantly increased by more than 10 times compared with the Cy5-siRNA group, confirming that the nanoformulation of the present invention can effectively increase the cellular entry efficiency of the small interfering RNA. Figure 2 In Figure B, in the normal bladder epithelial cell line SV-HUC-1, the average fluorescence intensity of positive cells in the Cy5-NPs-AP group was comparable to that in the Cy5-NPs group, while in the bladder cancer cell line BIU87 / DDP, the fluorescence intensity value of the former (12266) was further significantly increased by 42.5% compared with the latter (8605), confirming that the sp13c aptamer modification on the surface of the nanoparticles can effectively enhance the targeting of the nanoparticles to bladder cancer cells.

[0085] Example 7 Effect of low-concentration target head modification on the uptake efficiency of small interfering RNA self-assembled nanoparticles by bladder cancer cells

[0086] (1) Preparation of fluorescent nanoparticles:

[0087] The preparation process of ERCC2 small interfering RNA self-assembled nanoparticles was the same as that in Example 6, wherein when adding the sp13c aptamer, the compressed nanoparticle solution (100 μL, 1.8 μg / μL) and the sp13c aptamer (100 μL, 0.05 μg / μL) were adjusted to be mixed in a mass ratio of 30:1, and stirred at room temperature for 4 h. The other steps remained unchanged to obtain Cy5-NPs-AP-1.

[0088] (2) Preparation of fluorescent nanoparticles without sp13c modification:

[0089] The preparation steps are the same as those described in (1), except that the last step of adding the sp13c aptamer is omitted to obtain Cy5-NPs.

[0090] (3) Cellular uptake detection:

[0091] The bladder cancer cisplatin-resistant cell line BIU-87 / DDP was plated in a 12-well plate, with 1×10 5 cells, cultured at 37°C, 5% CO2 for 12h. Three treatment groups were set up at the same time, namely Cy5-labeled ERCC2 small interfering RNA (Cy5-siRNA, commissioned to Shenzhen BGI Co., Ltd. for synthesis), Cy5-NPs group and Cy5-NPs-AP-1 group, and the drug concentration of the three was 4μg / mL. After continuing to culture for 12h, the supernatant of the culture medium was discarded. The cells were digested with trypsin (0.25%) for 3min, and then the digestion was terminated with complete culture medium, and centrifuged at 4°C, 500g for 5min. The supernatant was discarded, the cells were resuspended with phosphate buffer, and the centrifugation-resuspension steps were repeated twice. Transferred to the flow tube in the flow cytometer (CytoFLEX, Beckman Coulter), and the average fluorescence intensity of Cy5 fluorescence-positive cells was detected by flow cytometry.

[0092] The results showed that in the bladder cancer cell line BIU87 / DDP, the average fluorescence intensity of positive cells in the Cy5-siRNA group was the lowest, at 2851±182, while the average fluorescence intensity of positive cells in the Cy5-NPs group and the Cy5-NPs-AP-1 group were 8321±93 and 8440±233, respectively. Both nanoparticles significantly increased the average fluorescence intensity of cell uptake by about 3 times compared with free siRNA, indicating that the nanoformulation can effectively increase the efficiency of small interfering RNA entering the cell. However, there was no significant difference between the Cy5-NPs group and the Cy5-NPs-AP-1 group. The sp13c aptamer modification on the surface of the nanoparticles in this embodiment did not significantly enhance the targeting effect of the nanoparticles on bladder cancer cells, indicating that not any addition of sp13c aptamers and nanoparticles can improve the targeting efficiency of bladder cancer cells.

[0093] In summary, the present invention discloses a small interfering RNA nanoparticle, a drug delivery carrier of small interfering RNA is prepared by a rolling circle transcription method, and sp13c aptamer is used as a targeting molecule for bladder cancer in a nano delivery system, which is compounded with small interfering RNA particles in a specific ratio, thereby significantly improving the conversion rate of sp13c aptamer and the efficiency of bladder cancer cell uptake, and effectively improving the targeting efficiency of small interfering RNA to bladder cancer cells.

[0094] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0095] Sequence Listing

[0096] SEQ ID NO.1

[0097] GGAAGACAGUAUCCCUGUU

[0098] SEQ ID NO.2

[0099] GAAGGACGUCGAUGGGAAA

[0100] SEQ ID NO.3

[0101] GAAAGUUGCUCAACUUCUA

[0102] SEQ ID NO.4

[0103] GACGAGCGGCACGUGCACAUU

[0104] SEQ ID NO.5

[0105] AGCAGTTCTCCTACATGCGG

[0106] SEQ ID NO.6

[0107] CTCCAGCGGATATGCTCTCT

[0108] SEQ ID NO.7

[0109] GGAGCGAGATCCCTCCAAAAT

[0110] SEQ ID NO.8

[0111] GGCTGTTGTCATACTTCTCATGG

[0112] SEQ ID NO.9

[0113] Phosphate-ATAGTGAGTCGTATTAACGTACCAACGAAAGTTGCTCAACTTCTAACTTG TAGAAGTTGAGCAACTTTCTAGGCATATCCCT

[0114] SEQ ID NO.10

[0115] TAATACGACTCACTATAGGGAT

[0116] SEQ ID NO.11

[0117] ATAGTGAGTCGTATTAAGCCCTCGGGATTATCGGTGTTTATGGTGTCTGTCTATCAC

[0118] GTGGAGCT

Claims

1. A small interfering RNA nanoparticle, characterized in that: It includes polyethyleneimine vector, small interfering RNA and sp13c aptamer; The nucleotide sequence of the small interfering RNA is shown in SEQ ID NO.3; The nucleotide sequence of the sp13c aptamer is shown in SEQ ID NO.11; The compounding ratio of the polyethyleneimine carrier, the small interfering RNA and the sp13c aptamer is (0.2-2): (0.5-5): (0.2-2).

2. The small interfering RNA nanoparticle according to claim 1, characterized in that The particle size of the small interfering RNA nanoparticles is 100-500 nm.

3. The small interfering RNA nanoparticle according to claim 1, characterized in that The drug loading amount of the small interfering RNA is 10-50 wt%.

4. The method for preparing small interfering RNA nanoparticles according to any one of claims 1 to 3, characterized in that: The steps include: (i) amplifying small interfering RNA using rolling circle transcription to produce small interfering RNA microparticles; (ii) compressing the small interfering RNA microparticles described in (i) into nanoparticles using polyethyleneimine; (iii) modifying the nanoparticles of (ii) using sp13c aptamers to obtain the small interfering RNA nanoparticles.

5. The preparation method according to claim 4, characterized in that: The step (i) is specifically as follows: The small interfering RNA template sequence is mixed with the T7 promoter, denatured to form a circular DNA molecule, connected with T4 ligase, and then subjected to rolling circle transcription and ultrasonic treatment to obtain small interfering RNA microparticles; The small interfering RNA template sequence is shown in SEQ ID NO.

9.

6. The preparation method according to claim 4, characterized in that: The step (iii) is specifically as follows: The nanoparticle solution (ii) is mixed with the sp13c aptamer, stirred and centrifuged, the supernatant is discarded, and the solution is resuspended in nuclease-free water.

7. The preparation method according to claim 4, characterized in that: The sequence of the T7 promoter is shown in SEQ ID NO.

10.

8. Use of the small interfering RNA nanoparticles according to any one of claims 1 to 3 in the preparation of drugs for treating bladder cancer.

Images