Application of HrpW protein and coding gene thereof in regulating resistance of bacterial fruit blotch of melons

Abstract

The invention discloses an application of an HrpW protein and a coding gene thereof in regulating resistance of bacterial fruit blotch of melons. The protein provided by the invention is named as HrpW protein, and is a protein as shown in the 41st-361th sites in SEQ ID NO: 1. Nucleic acid molecules for coding the HrpW protein also belong to the protection range of the invention. The invention also protects the application of the HrpW protein or the nucleic acid molecule for coding the HrpW protein in positively regulating the disease resistance and / or antibacterial property of plants. The invention also protects the application of the HrpW protein related biological material: the application of the HrpW protein related biological material in preparation of a product for improving the disease resistance and / or antibacterial property of plants; application in plant breeding; the invention is applied to preparation of an antibacterial agent. The invention has important significance for realizing fruit blotch resistant plant breeding and improving the broad-spectrum and lasting disease resistance of the plant to fruit blotch.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to application of HrpW protein and its encoding gene in regulating resistance to bacterial fruit spot of melons. Background Art

[0002] Paracidovorax citrulli is a pathogen that causes bacterial fruit blotch (BFB) in cucurbit crops. BFB is a serious seed-borne disease worldwide, causing significant economic losses worldwide.

[0003] At present, the main methods for preventing and controlling bacterial fruit spot are plant quarantine, breeding of disease-resistant varieties, chemical control, etc. Acidophilus aeruginosa is mainly transmitted through seeds, so strengthening the detection of bacteria in seeds to prevent the flow of infected seeds into the market is the key to avoiding large-scale BFB outbreaks. At present, breeding of disease-resistant varieties is the most economical and effective method for preventing and controlling pathogens, but no effective resistant materials have been found for bacterial fruit spot of melons. Summary of the invention

[0004] The purpose of the present invention is to provide application of HrpW protein and its encoding gene in regulating resistance to bacterial fruit spot of melons.

[0005] The protein provided by the present invention, named HrpW protein, is as follows (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6) or (a7) or (a8):

[0006] (a1) the protein shown at positions 41-361 in SEQ ID NO: 1;

[0007] (a2) the protein shown in SEQ ID NO: 1;

[0008] (a3) the protein shown in SEQ ID NO: 3;

[0009] (a4) a fusion protein having the protein described in (a1);

[0010] (a5) a protein associated with plant disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) or (a3);

[0011] (a6) a protein that has 98% or more identity with the protein described in (a1), (a2) or (a3) ​​and is associated with plant disease resistance;

[0012] (a7) a protein related to plant antibacterial activity obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) or (a3);

[0013] (a8) A protein having 98% or more identity with the protein described in (a1), (a2) or (a3) ​​and associated with plant antibacterial activity.

[0014] Specifically, the fusion protein (a4) may be a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein (a1).

[0015] Specifically, the fusion protein (a4) may be a fusion protein obtained by connecting a signal peptide to the N-terminus and / or C-terminus of the protein (a1).

[0016] Nucleic acid molecules encoding HrpW protein also fall within the protection scope of the present invention.

[0017] The nucleic acid molecule may be a DNA molecule or an RNA molecule.

[0018] Specifically, the nucleic acid molecule is as follows (b1) or (b2) or (b3):

[0019] (b1) a nucleic acid molecule whose coding region is shown in positions 121 to 1083 of SEQ ID NO: 2;

[0020] (b2) a nucleic acid molecule having 95% or more identity with (b1) and encoding the protein;

[0021] (b3) A nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under stringent conditions and encodes the protein.

[0022] The above stringent conditions can be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65°C and washing the membrane in a DNA or RNA hybridization experiment.

[0023] The nucleic acid molecule may be the HrpW gene.

[0024] Specifically, the HrpW gene may be a DNA molecule whose coding region is shown as positions 121-1083 in SEQ ID NO:2.

[0025] Specifically, the HrpW gene may be a DNA molecule whose coding region is shown in SEQ ID NO:2.

[0026] Specifically, the HrpW gene may be a DNA molecule whose coding region is shown in SEQ ID NO:4.

[0027] The expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule all fall within the protection scope of the present invention.

[0028] Specifically, the recombinant vector containing the nucleic acid molecule is a recombinant plasmid obtained by replacing the DNA fragment containing the CmR gene and ccdB gene from attR1 to attR2 in the vector pCPP5371 with a DNA fragment containing an exogenous DNA molecule (such as nucleotides 1-1083 in SEQ ID NO: 2). Specifically, the preparation method of the recombinant vector containing the nucleic acid molecule is as follows: using the double-stranded DNA molecule shown in SEQ ID NO: 2 as a template, using the primer pair consisting of HrpWattB1 and HrpWattB2 to perform PCR amplification to obtain a PCR amplification product. The PCR amplification product is then amplified with the Gateway TM pDON TM 221 vector was subjected to BP recombination to obtain an intermediate vector. The intermediate vector and vector pCPP5371 were subjected to LR recombination to obtain a recombinant plasmid pCPP5371-HrpW. Specifically, the recombinant vector containing the nucleic acid molecule is: a recombinant plasmid obtained by inserting the double-stranded DNA molecule represented by nucleotides 4-1083 in SEQ ID NO: 2 between the NdeI and XhoI restriction sites of the pET22b (+) vector.

[0029] Specifically, the recombinant microorganism containing the nucleic acid molecule is a recombinant bacterium obtained by introducing a recombinant vector containing the nucleic acid molecule into Pseudomonas fluorescens EtHAn. Specifically, the preparation method of the recombinant microorganism containing the nucleic acid molecule is: co-cultivating the HrpW gene donor bacteria, the pRK600 plasmid donor bacteria and Pseudomonas fluorescens EtHAn to obtain the recombinant Pseudomonas fluorescens containing the nucleic acid molecule. The recombinant plasmid pCPP5371-HrpW gene is introduced into the competent cells of Escherichia coli DH5α to obtain recombinant Escherichia coli, which is the HrpW gene donor bacteria. The pRK600 plasmid is introduced into the competent cells of Escherichia coli DH5α to obtain recombinant Escherichia coli, which is the pRK600 plasmid donor bacteria. Specifically, the recombinant microorganism containing the nucleic acid molecule is a recombinant bacterium obtained by introducing the recombinant vector containing the nucleic acid molecule into Escherichia coli BL21.

[0030] The present invention also protects the use of HrpW protein or nucleic acid molecules encoding HrpW protein in positively regulating the disease resistance and / or antibacterial property of plants.

[0031] Positive regulation means that the HrpW protein content increases and the plant's disease resistance and / or antibacterial ability increases.

[0032] Positive regulation means that the content of nucleic acid molecules encoding HrpW protein increases, and the disease resistance and / or antibacterial ability of the plant increases.

[0033] The present invention also protects the use of biological materials, which is as follows (c1) or (c2) or (c3):

[0034] (c1) Use in the preparation of products for improving the disease resistance and / or antibacterial properties of plants;

[0035] (c2) Application in plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0036] (c3) Application in the preparation of antibacterial agents.

[0037] The present invention also provides a product comprising a biological material;

[0038] The functions of the product are as follows (d1) or (d2) or (d3):

[0039] (d1) improving the disease resistance and / or antibacterial ability of plants;

[0040] (d2) Plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0041] (d3) Antimicrobial agents.

[0042] Any of the above biological materials can be HrpW protein, a nucleic acid molecule encoding HrpW protein, an expression cassette containing a nucleic acid molecule encoding HrpW protein, a recombinant vector containing a nucleic acid molecule encoding HrpW protein, or a recombinant microorganism containing a nucleic acid molecule encoding HrpW protein.

[0043] The present invention also provides a method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: introducing a nucleic acid molecule encoding the HrpW protein into a recipient plant to obtain a plant with improved disease resistance and / or antibacterial properties. Specifically, in the method, a recombinant vector containing the nucleic acid molecule or a recombinant microorganism containing the nucleic acid molecule is introduced into the recipient plant.

[0044] The present invention also provides a method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: increasing the content of HrpW protein in the plants to obtain plants with improved disease resistance and / or antibacterial properties.

[0045] The present invention also protects the use of any of the above methods in plant breeding. The goal of the plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties.

[0046] Specifically, the disease resistance is resistance to fruit spot disease.

[0047] Specifically, the disease resistance is resistance to bacterial fruit spot.

[0048] Specifically, the bacterial fruit spot disease is bacterial fruit spot disease of melons.

[0049] Specifically, the melons are watermelon and / or melon.

[0050] Specifically, the bacterial fruit spot disease is a bacterial fruit spot disease caused by Acidovorax citrullus.

[0051] Specifically, the antibacterial property is resistance to acidophages.

[0052] Specifically, the antibacterial property is resistance to Acidobacterium citrullum.

[0053] Specifically, the plant is a dicotyledon or a monocotyledon.

[0054] Specifically, the plant is a plant of the Cucurbitales order.

[0055] Specifically, the plant is a Cucurbitaceae plant.

[0056] Specifically, the plant is a plant of the genus Cucurbita.

[0057] Specifically, the plant is watermelon, such as Jingxin No. 4 watermelon.

[0058] After the plant (such as watermelon leaves) is pretreated with the biological material, an ETI reaction (ETI reaction: immune response triggered by effector factors) is triggered, thereby improving the disease resistance of the plant.

[0059] The present invention finds that HrpW protein is a Harpin protein that can stimulate plant immunity, can improve plant resistance to bacterial fruit spot pathogens, can inhibit bacterial fruit spot pathogens, and provides a theoretical and practical basis for disease resistance research of watermelon. The present invention is of great significance for achieving fruit spot disease resistance plant breeding and improving plant broad-spectrum and long-lasting disease resistance to fruit spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 For Gateway TM pDON TM Vector map of the 221 vector.

[0061] Figure 2 This is the vector map of vector pCPP5371.

[0062] Figure 3 This is the result of detecting salicylic acid content in water in step 2 of Example 2.

[0063] Figure 4 This is the result of detecting the expression of salicylic acid-regulated genes in step 2 of Example 2.

[0064] Figure 5 This is the disease resistance test result of Example 3.

[0065] Figure 6 This is the disease resistance test result of Example 4. DETAILED DESCRIPTION

[0066] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0067] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up with three repeated experiments, and the results are averaged. Escherichia coli DH5α competent cells: Tolo Biotech. products, product catalog number CC96102. Gateway TM pDON TM 221 vector: product of Invitrogen. The protein capable of stimulating plant immunity discovered in the present invention is HrpW protein, as shown in SEQ ID NO: 1. The gene encoding HrpW protein is named HrpW gene, and its open reading frame is shown in SEQ ID NO: 2. In SEQ ID NO: 1, amino acid residues at positions 1-40 constitute a signal peptide. In SEQ ID NO: 2, nucleotides at positions 1-120 encode the signal peptide.

[0068] The composition of each liter of liquid KB medium (pH 7.2) is: peptone 20g, glycerol 15mL, K2HPO4 1.5g, MgSO4·7H2O 1.5g, and the balance is water. Compared with liquid KB medium, the difference in the composition of each liter of solid KB medium is the addition of 15g agar.

[0069] The vector pCPP5371 is described in the following literature: Supramolecular Structure and Functional Analysis of the Type III Secretion System in Pseudomonas fluorescens 2P24; Frontiers in Plant Science (www.frontiersin.org), January 2016, Volume 6, Article 1190; doi: 10.3389 / fpls.2015.01190. The vector pCPP5371 has a gentamicin resistance gene.

[0070] Pseudomonas fluorescens EtHAn is described in the following document: A Bacterial Type Three Secretion-Based Delivery System for Functional Characterization of Sporisorium scitamineum Plant Immune Suppressing Effector Proteins; Molecular and Physiological Plant Pathology; DOI: 10.1094 / PHYTO-08-21-0326-R.

[0071] The pRK600 plasmid is described in the following literature: Involvement of hrpX and hrpG in the Virulence of Acidovorax citrulli Strain Aac5, Causal Agent of Bacterial Fruit Blotch in Cucurbits; Frontiers in Microbiology, March 2018, Volume 9, Article 507; doi: 10.3389 / fmicb.2018.00507.

[0072] The pBBR1MCS-2 plasmid is described in the following literature: Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes; Gene, 166 (1995) 175-176; DOI: 10.1016 / 0378-1119 (95) 00584-1. The pBBR1MCS-2 plasmid has a kanamycin resistance gene.

[0073] Example 1: Preparation of recombinant bacteria

[0074] 1. Construction of recombinant plasmid

[0075] The double-stranded DNA molecule shown in SEQ ID NO: 2 was used as a template and a primer pair consisting of HrpWattB1 and HrpWattB2 was used for PCR amplification to obtain a PCR amplification product. TM pDON TM 221 vector (vector map see Figure 1 ) to perform BP recombination to obtain an intermediate vector. The intermediate vector and vector pCPP5371 (vector map see Figure 2 ) was subjected to LR recombination to obtain the recombinant plasmid pCPP5371-HrpW. Compared with the vector pCPP5371, the difference of the recombinant plasmid pCPP5371-HrpW is that the DNA fragment containing the exogenous DNA molecule (as shown in nucleotides 1-1083 in SEQ ID NO: 2) replaces the DNA fragment containing the CmR gene and ccdB gene from attR1 to attR2 in the vector.

[0076] HrpWattB1:ggggacaagtttgtacaaaaaagcaggctATGCGACGCCGTGCATC;

[0077] HrpWattB2:ggggaccactttgtacaagaaagctgggtGACCGTCTGGATCGACTGGC.

[0078] 2. Prepare the recombinant bacterium EtHAn-HrpW using triparental hybridization.

[0079] 1. Introduce the recombinant plasmid pCPP5371-HrpW into E. coli DH5α competent cells to obtain recombinant E. coli, which is the HrpW gene donor bacteria. Introduce the pRK600 plasmid into E. coli DH5α competent cells to obtain recombinant E. coli, which is the pRK600 plasmid donor bacteria.

[0080] 2. The HrpW gene donor bacteria, pRK600 plasmid donor bacteria and Pseudomonas fluorescens EtHAn were mixed and inoculated on a pH 7.4 LB medium plate, co-cultured at 28°C for 8 h, and then the bacteria on the plate were collected with sterile water to obtain a bacterial liquid.

[0081] 3. Inoculate the bacterial solution obtained in step 2 onto a KB medium plate containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and culture at 28°C for 48 h.

[0082] 4. After completing step 3, single clones were picked from the plate for PCR identification, and the fluorescent Pseudomonas that were positive for PCR identification were selected as the recombinant bacteria EtHAn-HrpW.

[0083] PCR identification method: extract genomic DNA, use the primer pair consisting of F1 (GGTGGAGGTGAACAAACCCA) and R1 (CGAAGCGGAAGAGGAAGGAT) for PCR amplification. If an amplification product of about 530 bp is obtained, the identification result is positive.

[0084] 3. Preparation of recombinant bacteria EtHAn-EV.

[0085] Replace the recombinant plasmid pCPP5371-HrpW with the vector pCPP5371 and follow the procedure in step 2 to obtain the recombinant bacterium EtHAn-EV.

[0086] Example 2: Functional verification of HrpW protein

[0087] 1. Preparation of bacterial solution

[0088] The recombinant bacteria EtHAn-HrpW were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to the bacterial concentration of 5×10 8 cfu / mL, that is, the bacterial solution EtHAn-HrpW.

[0089] The recombinant bacteria EtHAn-EV were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nmThe value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to the bacterial concentration of 5×10 8 cfu / mL, that is, the bacterial solution EtHAn-EV.

[0090] 2. Functional verification of HrpW protein

[0091] Test bacterial solution: bacterial solution EtHAn-HrpW or bacterial solution EtHAn-EV prepared in step 1.

[0092] Normally cultivate Jingxin No. 4 watermelon, and inoculate the test bacteria solution 2-3 weeks after germination (at this time, the plant has two cotyledons and some true leaves). Inoculation method: Inject the test bacteria solution on the left and right sides of each cotyledon to fill the leaf. Then continue normal cultivation.

[0093] 1. Detection of salicylic acid content

[0094] The timing starts from the inoculation of the test bacterial solution, and the cotyledons are taken after 48 hours. The salicylic acid content in the cotyledons is detected using the Shanghai Jianglai Biological Plant Salicylic Acid ELISA Kit (Cat. No.: JL13803), that is, the salicylic acid content in the cotyledons per gram of fresh weight is in micrograms.

[0095] Results Figure 3 (Number of samples: N = 9). The salicylic acid content increased significantly after the HrpW gene was expressed in watermelon.

[0096] 2. Detection of salicylic acid-regulated gene expression

[0097] Start timing from the inoculation of the test bacteria solution, and take the cotyledons 6 hours later. Extract total RNA and reverse transcribe to obtain cDNA. Perform fluorescence quantitative PCR using cDNA as a template. Relative expression of the target gene = 2 -ΔΔCt The internal reference gene was Wactin gene, and the primer pair used to amplify the internal reference gene consisted of F2 (CCATGTATGTTGCCATCCAG) and R2 (GGATAGCATGGGGTAGAGCA). The target gene was ClPR1 gene, and the primer pair used to amplify the target gene consisted of F3 (TGTCGGCCCAACTGGTAATC) and R3 (AACCAGATCCAACACCCGTC).

[0098] Results Figure 4 (Number of samples: N=3). After expressing the HrpW gene in watermelon, the expression of the ClPR1 gene was significantly enhanced.

[0099] Example 3: Recombinant bacteria expressing HrpW protein improve the disease resistance of watermelon to bacterial fruit spot

[0100] 1. Preparation of antibacterial liquid

[0101] The recombinant bacteria EtHAn-HrpW were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5×10 6 cfu / mL of bacterial solution is the bacterial solution EtHAn-HrpW.

[0102] The recombinant bacteria EtHAn-EV were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5×10 6 cfu / mL of bacterial solution is the bacterial solution EtHAn-EV.

[0103] 2. Preparation of pathogenic bacteria solution

[0104] Acidovorax citrulli AAC00-1, its full name is Paracidovorax citrulli AAC00-1, and its NCBI number is GCA_000015325.1 (RefSeq: GCF_000015325.1).

[0105] The pBBR1MCS-2 plasmid was introduced into the watermelon acidophilus AAC00-1 to obtain the recombinant bacteria AAC00-1-pBBR1MCS2. The recombinant bacteria AAC00-1-pBBR1MCS2 were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL kanamycin, and cultured at 28°C and 200 rpm with shaking until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 2×10 8 cfu / mL of bacterial solution is pathogenic bacteria solution.

[0106] 3. Disease resistance testing

[0107] Test bacterial solution: bacterial solution EtHAn-HrpW or bacterial solution EtHAn-EV prepared in step 1.

[0108] Jingxin No. 4 watermelon was cultured normally, and the test bacteria solution was inoculated 2-3 weeks after germination (at this time, the plant had two cotyledons and some true leaves), and the pathogenic bacteria solution was inoculated 24 hours later. Then the normal culture was continued.

[0109] Inoculation method of the test bacterial solution: Each cotyledon is injected on the left and right sides of the main vein so that the test bacterial solution fills the leaf.

[0110] Inoculation method of pathogenic bacteria solution: spray the whole plant, spray 20mL of pathogenic bacteria solution on each plant.

[0111] The time starts from the time of inoculation with the pathogenic bacteria solution. The original leaves for inoculation are taken and photographed 2 days and 4 days later. Figure 5 Right picture.

[0112] The timing starts from the time of inoculation with the pathogenic bacteria solution, and the original inoculated leaves are taken after 2 days and 4 days respectively. Take the leaves, use a circular hole puncher with a diameter of 1 cm to punch holes for sampling, and obtain circular leaf samples with a diameter of 1 cm, called leaf discs. Take 2mL centrifuge tubes, add 6 leaf discs to each centrifuge tube, and then add 1mL of deionized water, mash the leaves, and then use sterile deionized water to perform 10-fold gradient dilutions to obtain dilutions of various dilutions. Take 10μL of each dilution and inoculate it on a KB culture medium plate containing 100μg / mL ampicillin and 50μg / mL kanamycin (set 6 culture medium plates for each dilution as biological replicates), culture at 28°C for 48h, and then count the number of pathogenic bacteria colonies. Calculate the number of cfu of pathogenic bacteria per square centimeter of leaves. Results are shown in Figure 5 Left figure of (sample size N=6).

[0113] The results showed that the disease resistance of the group inoculated with EtHAn-HrpW was higher than that of the group inoculated with EtHAn-EV.

[0114] Example 4: HrpW protein improves watermelon's resistance to bacterial fruit spot

[0115] 1. Preparation of HrpW protein

[0116] 1. Insert the double-stranded DNA molecule represented by nucleotides 4-1083 in SEQ ID NO: 2 between the NdeI and XhoI restriction sites of the pET22b(+) vector to obtain a recombinant plasmid. The exogenously inserted DNA molecule and part of the nucleotides on the vector form the fusion gene represented by SEQ ID NO: 4, and express the fusion protein represented by SEQ ID NO: 3.

[0117] 2. The recombinant plasmid obtained in step 1 was introduced into Escherichia coli BL21 competent cells to obtain recombinant bacteria.

[0118] 3. The recombinant bacteria obtained in step 2 were inoculated into liquid LB medium containing 100 μg / mL ampicillin and cultured at 37°C and 220 rpm until the bacterial concentration reached (4-6)×10 8cfu / mL, and then IPTG was added to make its concentration in the system 0.5mM, followed by shaking culture at 28°C and 220rpm for 4-5h, and then centrifuged at 4°C and 5000g for 15min to collect the bacterial precipitate.

[0119] 4. Resuspend the bacterial pellet obtained in step 3 with PBS buffer, and then disrupt the cells with an ultrasonic cell disruptor. Then centrifuge at 4°C and 14500g for 20 min and collect the supernatant.

[0120] 5. Take the supernatant obtained in step 4, use His-tag protein purification magnetic beads (Beaver Company, product number 70501-100) and follow the instructions to purify the target protein with a His6 tag, and then use an ultrafiltration tube to replace the buffer system in which the protein is located with PBS buffer (pH 7.2), which is the HrpW protein solution.

[0121] 2. Preparation of pathogenic bacteria solution

[0122] Same as step 2 of Example 3.

[0123] 3. Disease resistance testing

[0124] Experimental group: Jingxin No. 4 watermelon was cultivated normally. Two weeks after germination (when the plant had two cotyledons and some true leaves), the whole plant was sprayed with HrpW protein solution (when spraying, the protein concentration was adjusted to 100 nM with PBS buffer, and the spraying amount for each plant was 20 mL), then cultured at 28°C for 24 hours, and then sprayed with pathogenic bacteria solution (the spraying amount for each plant was 20 mL).

[0125] Control group: The HrpW protein solution was replaced with an equal volume of PBS buffer, and the rest was the same as the experimental group.

[0126] Five days after spraying the pathogenic bacteria solution, observe the disease and necrosis of the true leaves and assign a disease level, then calculate and count the disease index.

[0127] The disease grade assignment standards are shown in Table 1.

[0128] Table 1

[0129] 0 No disease 1 The percentage of diseased and necrotic area to leaf area is ≤ 25% 3 25%<The percentage of necrotic area to leaf area≤50% 5 50%<The percentage of necrotic area to leaf area≤75% 7 75%<The percentage of necrotic area to leaf area≤100% 9 Plant death

[0130] The calculation method of the disease index (DI) is as follows:

[0131] DI = ∑(A×B)×100 / (∑C×9)

[0132] A: Disease grade, which is 0, 1, 3, 5, 7 or 9;

[0133] B: The number of true leaves of the plant at this disease level;

[0134] C: The total number of true leaves of the plant.

[0135] See the sample photos Figure 6 The statistical results of the disease index are shown in Figure 6 The left picture shows that the disease resistance of watermelon was enhanced after spraying with low concentration of HrpW.

[0136] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6) or (a7) or (a8): (a1) the protein shown at positions 41-361 in SEQ ID NO: 1; (a2) the protein shown in SEQ ID NO: 1; (a3) the protein shown in SEQ ID NO: 3; (a4) a fusion protein having the protein described in (a1); (a5) a protein associated with plant disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) or (a3); (a6) a protein that has 98% or more identity with the protein described in (a1), (a2) or (a3) ​​and is associated with plant disease resistance; (a7) a protein related to plant antibacterial activity obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1) or (a2) or (a3); (a8) A protein having 98% or more identity with the protein described in (a1), (a2) or (a3) ​​and associated with plant antibacterial activity.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2) or (b3): (b1) a nucleic acid molecule whose coding region is shown at positions 121 to 1083 in SEQ ID NO: 2; (b2) a nucleic acid molecule having 95% or more identity with (b1) and encoding the protein; (b3) A nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under stringent conditions and encodes the protein.

4. An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2, or the nucleic acid molecule according to claim 3 in positively regulating the disease resistance and / or antibacterial property of a plant.

6. The use of biomaterials as described in (c1) or (c2) or (c3): (c1) Use in the preparation of products for improving the disease resistance and / or antibacterial properties of plants; (c2) Application in plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties; (c3) Application in the preparation of antibacterial agents; The biological material is the protein according to claim 1, the nucleic acid molecule according to claim 2, the nucleic acid molecule according to claim 3, the expression cassette according to claim 4, the recombinant vector according to claim 4 or the recombinant microorganism according to claim 4.

7. A product containing biological material; The functions of the product are as follows (d1) or (d2) or (d3): (d1) improving the disease resistance and / or antibacterial ability of plants; (d2) Plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties; (d3) antimicrobial agents; The biological material is the protein according to claim 1, the nucleic acid molecule according to claim 2, the nucleic acid molecule according to claim 3, the expression cassette according to claim 4, the recombinant vector according to claim 4 or the recombinant microorganism according to claim 4.

8. A method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: introducing the nucleic acid molecule according to claim 2 or 3 into a recipient plant to obtain a plant with improved disease resistance and / or antibacterial properties.

9. A method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the steps of: increasing the content of the protein according to claim 1 in the plants to obtain plants with improved disease resistance and / or antibacterial properties.

10. Use of the method according to claim 8 or 9 in plant breeding.

Images