Transformation method and application of zymoprotein

Abstract

The invention discloses a zymoprotein modification method and application thereof, an amino acid extension method, an amino acid truncation method or a proline replacement method is used to successfully modify an alpha helical interdomain linker sequence of zymoprotein, and then the alpha helical interdomain linker sequence of the zymoprotein is systematically modified to obtain the zymoprotein with the alpha helical interdomain linker sequence. According to the present invention, the protein structure of the functional enzyme containing the sequence is modified, the functional enzyme containing the alpha spiral inter-domain connection sequences with different lengths is obtained, and the functional enzyme has different enzyme activity and stability, such that the protein modification is achieved so as to regulate and control the enzyme activity and the stability. The modification method of the zymoprotein can be used for directional design and modification of the functional enzyme containing the alpha-spiral inter-domain connection.

Description

Technical Field

[0001] The present invention relates to functional enzymes, and in particular to a method for modifying enzyme proteins and applications thereof. Background Art

[0002] As biological catalysts, enzymes are far superior to chemical catalysts in terms of catalytic activity and environmental friendliness. However, natural enzymes have disadvantages such as limited catalytic substrate types and low stability. Designing and modifying natural enzymes is of great value in improving their industrial and medical applications.

[0003] Molecular modification technology provides an effective means for studying enzyme substrate specificity and catalytic active sites, improving enzyme thermal stability, and increasing enzyme action temperature. Through molecular modification, enzymes that meet industrial needs can be obtained quickly and directionally. Directed evolution and rational design are the main technical means for enzyme molecular modification, and are also hot topics in the current enzyme engineering field. Directed evolution is to simulate the natural evolution mechanism through random mutation, gene recombination and other methods to modify enzyme genes in vitro, and to screen out the desired mutant enzymes in a targeted manner. Rational design is to accurately design the mutation site of the enzyme based on a deep understanding of the structure, function and catalytic mechanism of the enzyme, and to modify the sequence of the natural enzyme by genetic engineering to obtain a new enzyme with the desired properties.

[0004] At present, many scholars have successfully transformed various enzymes using rational design technology and have made remarkable progress. In the modification method of enzyme protein, the functional area related to the performance of the enzyme is generally selected for mutation. For example, by designing and modifying the catalytic pocket (substrate binding and reaction area) of the biological enzyme, most of them can achieve good results (improving the stability, tolerance or enzyme activity of the enzyme). For example, in order to improve the catalytic activity of Aspergillus terreus lipase, Zhang X et al. conducted site-directed mutations on several amino acids in the lid domain and substrate binding pocket of acid lipase ATL through rational design. The mutants ATLLid and ATLV218W obtained showed higher hydrolysis activity for substrates such as p-nitrophenyl laurate, and their Kcat values ​​were 39.37 times and 50.79 times that of the wild-type lipase, respectively, and the Kcat / Km values ​​were 2.85 and 8.48 times higher than the wild-type; Yaacob N et al. mutated the amino acids in the lid 1 region of Pseudomonas fluorescens AMS8 lipase to obtain two mutants, T52Y and G55Y. Compared with the wild type, both mutants showed better catalytic function; in order to improve the catalytic activity and thermal stability of lipase MAS1, Zhao G et al. replaced the eight amino acids with larger side chains in the substrate binding pocket of lipase MAS1 with alanine, and finally obtained a mutant with a half-life five times longer than that of the wild type. Summary of the invention

[0005] Different from the prior art that rationally designs and modifies protein domains, the present invention provides a new method and application for modifying enzyme proteins, modifying the α-helical interdomain linker (α-linker) sequence to achieve targeted regulation and rational design of the activity and thermal stability of functional enzymes containing this type of α-linker. This modification method can be used to obtain a modified target protein.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for modifying an enzyme protein is performed on a functional enzyme containing an α-helical protein domain connection, wherein the α-helical protein domain connection (α-linker) in the functional enzyme is located between the N-terminal domain of the protein and the C-terminal domain of the protein, and the α-helical protein domain connection sequence is composed of an α-linker start segment, an α-linker linker segment, and an α-linker termination segment; wherein the α-linker start segment is a start sequence composed of 3 to 5 amino acids, the α-linker linker segment is an arbitrary amino acid sequence of 0 to 25 amino acids excluding glycine and proline, and the α-linker termination segment is an arbitrary amino acid sequence combination capable of terminating an α-helical structure; the method for modifying the enzyme protein comprises: performing any one of the following modifications (i) to (iii) on the α-helical protein domain connection sequence;

[0008] (i) using an amino acid modification method to add several amino acids into the linker segment of the α-helical protein domain linker (α-linker) sequence;

[0009] (ii) removing several amino acids in the linker segment of the α-helical protein domain linker (α-linker) sequence using an amino acid modification method;

[0010] (iii) using amino acid point mutation method to mutate any two consecutive amino acids in the linker segment of the α-helical protein domain linker (α-linker) sequence into two proline.

[0011] In some specific examples of the present invention, in (i), the number of the increased amino acids is 1 to 15.

[0012] In some specific examples of the present invention, the modifications (i) to (iii) are as follows:

[0013] (i) selecting the amino acid site to be modified in the linker segment of the α-helical protein domain linker sequence, extending the DNA sequence within 5 to 15 bp before and after the site as a homology arm, adding the corresponding modification sequence to design a recombination primer, and using the primer to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with an extended α-helical protein domain linker sequence;

[0014] (ii) selecting the amino acid site to be modified in the linker segment of the α-helical protein domain linker sequence, truncating the DNA sequence within 5 to 15 bp before and after the site as a homology arm, adding the corresponding modification sequence to design a recombination primer, and using the primer to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with a truncated α-helical protein domain linker sequence;

[0015] (iii) selecting the amino acid site to be mutated within the linker segment of the α-helical protein domain linker (α-linker) sequence, designing double mutation primers for PCR amplification and site-directed mutagenesis, and mutating the selected site to proline to obtain the target functional enzyme having a proline-modified α-helical protein domain linker sequence.

[0016] In the present invention, the above enzyme protein modification method is used to perform protein modification and performance analysis on the exopolyphosphatase of Deinococcus radiodurans (DrPPX). The sequence characteristics of the α-helical protein domain linker sequence in the DrPPX are: DrPPX protein N-terminal domain-[α-linker start segment]-[α-linker linker segment]-[α-linker termination segment]-DrPPX protein C-terminal domain; wherein the α-linker start segment is composed of five consecutive amino acids with a sequence of N ALREG C (SEQ ID No. 1), the α-linker linker segment is composed of 15 amino acids with a sequence of NMLIEELAQVQTFSLA C (SEQ ID No. 2), and the α-linker termination segment is composed of three amino acids with a sequence of N LST C.

[0017] The following modifications were made to DrPPX:

[0018] In some specific examples of the present invention, the LAQTFSLA sequence (SEQ ID No. 5) is added to the C-terminus of the α-linker segment in the DrPPX using an amino acid modification method, so that the linker segment sequence becomes NMLIEELAQVQTFSLALAQTFSLA C (SEQ ID No. 6) to obtain a DrPPX (+7AA) modified body.

[0019] In some specific examples of the present invention, the amino acid modification method is used to remove TFSLA (SEQ ID No. 11) in the α-linker linker sequence of the DrPPX, so that the linker sequence becomes N MLIEELAQVQ C (SEQ ID No. 12), and the DrPPX (-5AA) modified body is obtained.

[0020] In some specific examples of the present invention, the amino acid modification method is used to remove QVQTFSLA (SEQ ID No. 15) in the α-linker linker sequence of the DrPPX, so that the linker sequence is changed to N MMLIEELA C (SEQ ID No. 16), thereby obtaining the DrPPX (-8AA) modified body.

[0021] In some specific examples of the present invention, the amino acid point mutation method is used to mutate the 13th and 14th SL amino acids in the linker sequence into consecutive proline (P), so that the linker sequence becomes N MLIEELAQVQTF C (SEQ ID No. 19) to obtain the DrPPX (SL / PP) modified body.

[0022] In some specific examples of the present invention, the amino acid point mutation method is used to mutate the 9th and 10th VQ amino acids in the linker sequence into consecutive proline (P), so that the linker sequence becomes N MLIEELAQ C (SEQ ID No. 22) to obtain the DrPPX (VQ / PP) modified body.

[0023] In some specific examples of the present invention, the amino acid point mutation method is used to mutate the LA amino acids at positions 6 and 7 in the linker sequence into consecutive prolines (P), so that the linker sequence becomes N MLIEE C (SEQ ID No. 25) to obtain the DrPPX (LA / PP) modified body.

[0024] That is, the modified DrPPX proteins obtained by the above method include: DrPPX(+7AA), DrPPX(-5AA), DrPPX(-8AA), DrPPX(SL / PP), DrPPX(VQ / PP) or DrPPX(LA / PP), and their common feature is that there is a modified α-helical protein domain connecting sequence between the N-terminal domain and the C-terminal domain of the DrPPX protein.

[0025] The enzyme activity and thermal stability of the modified DrPPX protein obtained above were analyzed by UREA-PAGE method, and it was found that:

[0026] When DrPPX(+7AA), DrPPX(-5AA) and DrPPX(-8AA) modified by amino acid modification method were compared with wild-type DrPPX(WT), the enzyme activity was: DrPPX(-8AA)>DrPPX(-5AA)>DrPPX(WT)>DrPPX(+7AA), that is, the enzyme activity of PPX protein increased with the shortening of ɑ-linker and decreased by the extension of ɑ-linker.

[0027] Comparing DrPPX(SL / PP), DrPPX(VQ / PP) and DrPPX(LA / PP) modified by proline (P) replacement method (or amino acid point mutation method) with wild-type DrPPX(WT), it was also shown that the enzymatic activity of PPX protein was negatively correlated with the length of α-linker.

[0028] The experimental results on thermal stability showed: DrPPX(LA / PP)>DrPPX(VQ / PP)>DrPPX(SL / PP)>DrPPX(WT), which means that PPX protein with shorter ɑ-linker has higher stability at high temperature, that is, the thermal stability of PPX protein is negatively correlated with the length of ɑ-linker.

[0029] The above results confirm the inventor's prediction that the activity and thermal stability of the enzyme containing it can be regulated based on the modification of the α-linker sequence. Changes in the α-linker sequence located at the junction between the N-terminal and C-terminal domains of the functional enzyme can change the activity and thermal stability of the corresponding functional enzyme. The α-linker structure exists between the N-terminal and C-terminal domains of many functional enzymes. Therefore, this means that the above-mentioned method of modifying the enzyme protein containing the α-linker functional enzyme by modifying the α-linker sequence can be applied to the design of many functional enzymes containing similar structural features to directionally regulate the activity and thermal stability of the functional enzyme.

[0030] Moreover, the modification of the α-helical interdomain connection can be used not only in the field of directional design of microbial enzymes in nature, but also in the field of design and modification of artificial proteins. After two domains with independent functions are connected using the α-helical interdomain connection of the present invention, the interaction between adjacent domains may be affected by modifying the α-helical interdomain connection sequence to construct an artificial fusion protein with special functions and effects.

[0031] Therefore, in some embodiments of the present invention, the functional enzyme is a natural enzyme or an artificial enzyme.

[0032] In some specific examples of the present invention, the functional enzyme is a natural microbial enzyme or an artificial fusion enzyme.

[0033] Compared with the prior art, the present invention has the following beneficial technical effects:

[0034] The present invention proposes for the first time a method for modifying a functional enzyme based on interdomain connections. By changing the interdomain connection sequence of an α-helical protein structure, the protein structure of the functional enzyme containing it is modified, thereby achieving the purpose of regulating the enzyme activity and stability of the protein.

[0035] The present invention successfully transforms the α-helical interdomain linking sequence by using an amino acid extension method, an amino acid truncation method and a proline (P) replacement method, thereby achieving protein transformation of a functional enzyme containing an α-helical interdomain linking sequence, and obtaining functional enzymes containing α-helical interdomain linking sequences of different lengths.

[0036] Based on the modification method of the enzyme protein of the present invention, the directional design and modification of the functional enzyme containing α-helical domain connections can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of DrPPX (WT) expression plasmid.

[0038] Figure 2 Schematic diagram of the sequence characteristics of DrPPX(+7AA) plasmid transformation.

[0039] Figure 3 Schematic diagram of the sequence characteristics of DrPPX(-5AA) plasmid modification.

[0040] Figure 4 Schematic diagram of the sequence characteristics of DrPPX(-8AA) plasmid modification.

[0041] Figure 5 Schematic diagram of the sequence characteristics of DrPPX (SL / PP) plasmid modification.

[0042] Figure 6Schematic diagram of the sequence characteristics of DrPPX (VQ / PP) plasmid modification.

[0043] Figure 7 Schematic diagram of the sequence characteristics of DrPPX (LA / PP) plasmid modification.

[0044] Figure 8 This is the α-linker structure and enzyme activity analysis of the DrPPX modified body after amino acid modification method.

[0045] Fig. 9 This is the α-linker structure and enzyme activity analysis of the DrPPX transformant after proline replacement method.

[0046] Fig.10 This is the thermal stability analysis of DrPPX modified by proline replacement method. DETAILED DESCRIPTION

[0047] The specific principles and implementation schemes of the present invention are described in detail below in conjunction with the accompanying drawings and specific examples. It should be understood that these embodiments are only used to illustrate the present invention and should not be considered to limit the scope of the present invention.

[0048] α-helical interdomain linker (α-linker) is a protein domain linker with an α-helical structure, which exists in many biological functional enzymes.

[0049] The α-helical protein domain connection (α-linker) in the functional enzyme is located between the N-terminal domain and the C-terminal domain of the protein, and is composed of a starting segment, a connecting segment and a terminating segment. Its structural characteristics in the functional enzyme are as follows: protein N-terminal domain (i.e., the N-terminal domain of the functional enzyme) - [α-linker starting segment] - [α-linker connecting segment] - [α-linker terminating segment] - protein C-terminal domain (i.e., the C-terminal domain of the functional enzyme).

[0050] In the sequence of α-linker,

[0051] The α-linker start segment is a start sequence consisting of 3 to 5 amino acids, and its main feature is that these amino acids can form an α-helical structure through hydrogen bonding forces;

[0052] The α-linker linker segment is an arbitrary amino acid sequence of 0 to 25 amino acids excluding glycine (G) and proline (P), and its main feature is that the sequence can continue the α-helical structure of the above-mentioned α-linker starting segment;

[0053] The α-linker termination segment is any combination of amino acid sequences that can terminate the α-helical structure. These amino acids terminate the α-helical structure continued by the above-mentioned α-linker connection segment by destroying the hydrogen bonding force of the α-helical structure.

[0054] The inventors discovered that by modifying the sequence of an α-linker in a functional enzyme containing an α-helical protein domain linker (α-linker), the activity and thermal stability of the functional enzyme can be directionally regulated, thereby achieving the directed design and modification of the target functional enzyme.

[0055] The method for modifying the functional enzyme by modifying the α-linker sequence containing the α-helical protein domain structure may be any one of the following (i) to (iii):

[0056] (i) using an amino acid modification method to add several amino acids into the linker segment of the α-helical protein domain linker (α-linker) sequence;

[0057] (ii) removing several amino acids in the linker segment of the α-helical protein domain linker (α-linker) sequence using an amino acid modification method;

[0058] (iii) using amino acid point mutation to mutate any two consecutive amino acids in the linker segment of the α-helical protein domain linker (α-linker) sequence into two prolines, which can destroy the hydrogen bonding force of the α-helical secondary structure and achieve premature termination of the α-linker.

[0059] In (i), the number of amino acids added may be 1 to 15.

[0060] In order to more clearly illustrate the above-mentioned transformation method, the polyphosphate degrading enzyme (DrPPX protein) of Deinococcus radiodurans will be used as a template / example for the transformation of a functional enzyme containing an α-helical protein domain connection for specific demonstration.

[0061] Ingredients

[0062] DH5α competent cells, BL21 competent cells, DNA marker, FastPfu Fly DNA Polymerase and dNTP were purchased from TransGen Biotech; restriction endonucleases and T4 DNA ligase were purchased from Takara; sodium chloride, yeast powder, peptone, kanamycin sulfate, Tris-HCl buffer, PMSF, DTT, lysozyme, MgCl 2Common reagents such as the following were purchased from Shanghai Shenggong Company; plasmid extraction kit was purchased from AXYGEN Company; protein 26616 Marker was purchased from Thermo Fisher Company; genome extraction kit was purchased from Tiangen Company; 2×MultiF Seamless Assembly Mix homologous recombination kit was purchased from AbClonal Company; Wizard SV gel recovery and PCR recovery kits were purchased from Promega Company; polyphosphates (polyP) used in enzyme activity detection was donated by Professor Adolfo Saiardi of University College London. Escherichia coli was cultured in LB medium (1% Yeast extract, 0.5% Tryptone, 1% Sodium chloride, solid medium plus 1.5% agar powder) at 37°C. The concentration of antibiotic-kanamycin used for Escherichia coli screening was 50μg / ml. Primer synthesis and DNA sequencing were completed by Hangzhou Qingke Biotechnology Co., Ltd.

[0063] In the following examples, μM refers to μmol / L, mM refers to mmol / L, and M refers to mol / L.

[0064] Structure of the polyphosphate-degrading enzyme (DrPPX) protein from Deinococcus radiodurans

[0065] In the polyphosphate degrading enzyme (DrPPX) of Deinococcus radiodurans, α-linker is located between the N-terminal domain of DrPPX protein and the C-terminal domain of DrPPX protein. The α-linker sequence is composed of the α-linker start segment, the α-linker linker segment and the α-linker termination segment. Its sequence characteristics in DrPPX are as follows: DrPPX protein N-terminal domain-[α-linker start segment]-[α-linker linker segment]-[α-linker termination segment]-DrPPX protein C-terminal domain. Among them, the α-linker start segment is NALREG C (SEQ ID No. 1), and the hydrogen bond force formed by the conserved amino acid REG plays a key role in the initiation process of the α-helical structure; the α-linker linker segment is N MLIEELAQVQTFSLA C (SEQ ID No. 2); the α-linker termination segment is NLST C.

[0066] Method for modifying the polyphosphate degrading enzyme (DrPPX) protein of Deinococcus radiodurans

[0067] Protein modification can be carried out by any of the following methods (i) to (iii).

[0068] (i) selecting the amino acid site to be modified in the linker segment of the α-helical protein domain linker sequence, using the DNA sequence within 5 to 15 bp before and after the extension site as the homology arm, adding the corresponding modification sequence to design the recombination primer, using the primer to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with an extended α-helical protein domain linker sequence;

[0069] (ii) selecting the amino acid site to be modified in the linker segment of the α-helical protein domain linker sequence, using the DNA sequence within 5 to 15 bp before and after the truncation site as the homology arm, adding the corresponding modification sequence to design the recombination primer, using the primer to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with the truncated α-helical protein domain linker sequence;

[0070] (iii) After selecting two amino acid sites to be mutated in the linker segment of the α-helical protein domain linker (α-linker) sequence, double mutation primers are designed to perform PCR amplification and site-directed mutagenesis, and the two selected sites are mutated to proline to obtain the target functional enzyme having a proline-modified α-helical protein domain linker sequence.

[0071] The above-mentioned DNA sequence within 5 to 15 bp before and after the site refers to the DNA sequence within 5 to 15 bp upstream and downstream of the amino acid site to be modified.

[0072] The following will explain in detail several modification methods of DrPPX one by one.

[0073] Construction of wild-type DrPPX (WT) expression plasmid

[0074] First, the whole genome of Deinococcus radiodurans was extracted using a genome extraction kit. The genome was used as a template and the gene fragment of DrPPX (WT) was amplified using the following primer pair 1 (DrPPX-F and DrPPX-R) with restriction sites:

[0075] DrPPX-F:GGAATTCCATATGATGCGGGTCGCCGTCGC (SEQ ID No. 3);

[0076] DrPPX-R:CGGGATCCTCAGGTGGCTTTGGCCTCTGCC (SEQ ID No. 4);

[0077] TransStart FastPfu Fly DNA Polymerase from Transgen was used for amplification. The amplification system included: 1 μl FastPfu Fly DNA Polymerase, 10 μl Fly Buffer, 6 μl 2.5 mM dNTPs, 30 μl deionized water, 1 μl each primer, and 1 μl template. The PCR program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 30 seconds; (3) 58°C, 30 seconds; (4) 72°C, 2 minutes; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 5 minutes. The amplified DNA product was recovered by gel extraction using Wizard SV gel recovery and PCR recovery kit.

[0078] Subsequently, the recovered product was double-digested with NdeI and BamHI. The digestion system was: 43 μl DNA, 1 μl NdeI, 1 μl BamHI, 5 μl cut buffer. The digestion procedure was: digestion at 37°C for 5 hours. After digestion, the product was directly recovered using WizardSV gel recovery and PCR recovery kits.

[0079] After the product is recovered, the digested product is drawn and connected to the pET28A vector with sticky ends. The specific system for the connection is: 2 μl of pET28A, 6 μl of digested product, 1 μl of T4 DNA ligase and 1 μl of T4 buffer. The connection procedure is: 16°C for 16 hours.

[0080] Add all the ligated products to DH5α competent cells, place in an ice bath for 30 minutes, heat shock in a 42°C water bath for 75 seconds, add 500 μL of LB liquid culture medium, culture at 37°C shaker at 220 rpm for two hours, spread on LB culture medium plates containing kanamycin, culture at 37°C inverted for 24 hours, pick bacteria for sequencing, and after picking out the correct colony, the construction of DrPPX (WT) expression plasmid is completed. The plasmid map of DrPPX (WT) is shown in the figure. Figure 1 shown.

[0081] 1. The first modification of DrPPX protein

[0082] The LAQTFSLA sequence (SEQ ID No. 5) was added to the C-terminus of the α-linker segment of the DrPPX protein using the amino acid extension method, so that the segment sequence became N MLIEELAQVQTFSLALAQTFSLA C (SEQ ID No. 6), and the DrPPX (+7AA) transformant was obtained, as follows:

[0083] (1) Construction of DrPPX (+7AA) expression plasmid:

[0084] Using the DrPPX (WT) expression plasmid as a template, primer pair 2 (DrPPX (+7AA)-F and 28A-R) and primer pair 3 (28A-F and DrPPX (+7AA)-R) were used to amplify two DNA fragments with homology arms of the mutation site, respectively.

[0085] Primer pair 2:

[0086] DrPPX(+7AA)-F:cagggccaggctgaaggtctgGAGCGCCAAGCTGAAAGTCTG(SEQ IDNo.7);

[0087] 28A-R: CGCGATCGCTGTTAAAAGGACAATTACAAACAGG (SEQ ID No. 8)

[0088] Primer pair 3:

[0089] 28A-F: CCTGTTTGTAATTGTCCTTTTAACAGCGATCGCG (SEQ ID No. 9);

[0090] DrPPX(+7AA)-R:cagaccttcagcctggccctgAGCACCCGCCAGCGCAGC(SEQ IDNo.10)

[0091] TransStart FastPfu Fly DNA Polymerase from Transgen was used for amplification. The amplification system included: 1 μl FastPfu Fly DNA Polymerase, 10 μl Fly Buffer, 6 μl 2.5 mM dNTPs, 30 μl deionized water, 1 μl each primer, and 1 μl template. The PCR program was as follows: (1) 95°C, 3 min; (2) 95°C, 30 sec; (3) 58°C, 30 sec; (4) 72°C, 2 min; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 5 min.

[0092] The amplified DNA product was recovered by gel cutting using Wizard SV gel recovery and PCR recovery kit. One-step cloning was performed using AbClonal's 2×MultiF Seamless Assembly Mix homologous recombination kit. The two DNA fragments were mixed at a molecular weight of 1:1, and an equal amount of 2×MultiF Seamless Assembly Mix was added to connect in a 50°C water bath for 1 hour. After cooling on ice for 5 minutes, 10 μl was aspirated and added to DH5α competent cells, ice bathed for 30 minutes, heat-shocked in a 42°C water bath for 75 seconds, 500 μl of LB liquid culture medium was added, and cultured at 37°C in a shaker at 220 rpm for two hours, and then spread on an LB culture medium plate containing kanamycin. After inverted culture at 37°C for 24 hours, bacteria were picked for sequencing. After the correct colony was picked, the construction of the DrPPX (+7AA) expression plasmid was completed. The sequence characteristics of the DrPPX (+7AA) plasmid modification are shown in the following figure. Figure 2 shown.

[0093] (2) Construction of E. coli expression strain and protein induced expression

[0094] Pipette 200 ng of the above DrPPX (+7AA) expression plasmid and add it to BL21 competent cells. Incubate on ice for 30 minutes, heat shock in a water bath at 42°C for 75 seconds, add 500 μl of LB liquid medium, culture at 37°C in a shaker at 220 rpm for two hours, and spread on LB medium plates containing kanamycin for growth, and culture inverted at 37°C overnight.

[0095] Select the monoclonal colony on the plate, transfer it to 5 ml of culture medium, and culture it in a 37°C shaker for 16 hours. Then, take 1 ml of the bacterial solution and transfer it to 500 ml of culture medium. Culture it in a 37°C shaker until OD 600 The cells were in the logarithmic growth phase of 0.6-0.8, and then placed in an ice bath for 30 minutes. IPTG was added at a final concentration of 0.2 mM and induced at 37°C for 4 hours to induce protein expression. After protein expression was completed, the cells were centrifuged at 8000 rpm for 3 minutes to collect the bacteria.

[0096] (3) Purification of PPX protein

[0097] The collected bacteria were resuspended in 35 ml of lysis buffer (20 mM Tris-HCl, pH 8.0, 1 mM PMSF, 500 mM NaCl, 5% glycerol, 20 μg / ml lysozyme), and the bacteria were broken using an ultrasonic disruptor (3.5 s working time, 9.9 s interval time, power 600 W, working time 60 min). The completely lysed bacterial solution was placed in an ultracentrifuge and centrifuged at 4 ° C, 15000 g for 30 min. After centrifugation, the supernatant protein was aspirated, filtered through a 0.45 μm filter membrane, and injected into the AKTA protein liquid chromatography for protein purification. First, nickel affinity chromatography was used for preliminary purification of the protein. Buffer A (20mM Tris-HCl, pH 8.0, 500mM NaCl, 5% glycerol) was used to balance the purification system at a flow rate of 3ml / min. After all protein samples flowed through the nickel column, 5%, 10%, 30%, and 100% buffer B (20mM Tris-HCl, pH 8.0, 500mM NaCl, 5% glycerol, 500mM Imidazole) were used to elute the protein. All eluted proteins were analyzed by SDS-PAGE gel electrophoresis to detect the elution position and purity of the target protein. The target protein purified by the nickel affinity column was concentrated using an ultrafiltration tube, and the protein was further purified using molecular sieves. Buffer C (20mM Tris-HCl, pH 8.0, 250mM NaCl) was used to inject and elute the protein at a flow rate of 0.5ml / min. The OD280 was then measured using NanoDrop to obtain the protein concentration.

[0098] 2. The second modification of DrPPX protein

[0099] The amino acid truncation method was used to remove TFSLA (SEQ ID No. 11) in the α-linker sequence of the DrPPX protein, so that the sequence of the linker sequence became N MLIEELAQVQ C (SEQ ID No. 12), and the DrPPX (-5AA) modified body was obtained. The details are as follows:

[0100] (1) Construction of DrPPX(-5AA) expression plasmid:

[0101] Using DrPPX(WT) plasmid as template, the following primer pair 4 (DrPPX(-5AA)-F and 28A-R) and primer pair 5 (28A-F and DrPPX(-5AA)-R) were used to amplify two DNA fragments with homology arms of the mutation site, respectively.

[0102] Primer pair 4:

[0103] DrPPX(-5AA)-F:ggcgggtgctAGTCTGGACCTGAGCGAGTTCCT(SEQ IDNo.13);

[0104] 28A-R: CGCGATCGCTGTTAAAAGGACAATTACAAACAGG (SEQ ID No. 8).

[0105] Primer pair 5:

[0106] 28A-F: CCTGTTTGTAATTGTCCTTTTAACAGCGATCGCG (SEQ ID No. 9);

[0107] DrPPX(-5AA)-R: ggtccagactAGCACCCGCCAGCGCAGC (SEQ ID No. 14).

[0108] TransStart FastPfu Fly DNA Polymerase from Transgen was used for amplification. The amplification system included: 1 μl FastPfu Fly DNA Polymerase, 10 μl Fly Buffer, 6 μl 2.5 mM dNTPs, 30 μl deionized water, 1 μl each primer, and 1 μl template. The PCR program was as follows: (1) 95°C, 3 min; (2) 95°C, 30 sec; (3) 58°C, 30 sec; (4) 72°C, 2 min; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 5 min.

[0109] The amplified DNA product was recovered by gel cutting using Wizard SV gel recovery and PCR recovery kit. One-step cloning was performed using AbClonal's 2×MultiF Seamless Assembly Mix homologous recombination kit. The two fragments were mixed at a molecular weight of 1:1, and an equal amount of 2×MultiF Seamless Assembly Mix was added to connect in a 50°C water bath for 1 hour. After cooling on ice for 5 minutes, 10 μl was aspirated and added to DH5α competent cells, ice bathed for 30 minutes, heat-shocked in a 42°C water bath for 75 seconds, 500 μl of LB liquid culture medium was added, and cultured at 37°C in a shaker at 220 rpm for two hours, spread on an LB culture medium plate containing kanamycin, and cultured inverted at 37°C for 24 hours, and then bacteria were selected for sequencing. After the correct colony was selected, the construction of the DrPPX(-5AA) expression plasmid was completed. The sequence characteristics of the DrPPX(-5AA) plasmid modification are shown in the following figure. Figure 3 shown.

[0110] The DrPPX(-5AA) expression plasmid was used to replace the DrPPX(+7AA) expression plasmid, and the same method as steps (2) and (3) in the aforementioned “I. The first modification of the DrPPX protein” was used to perform (2) construction of the Escherichia coli expression strain and induced expression of the protein and (3) purification of the PPX protein.

[0111] 3. The third modification of DrPPX protein

[0112] The amino acid truncation method was used to remove QVQTFSLA (SEQ ID No. 15) in the α-linker sequence of the DrPPX protein, so that the sequence of the linker sequence became N MLIEELA C (SEQ ID No. 16), and the DrPPX (-8AA) transformant was obtained, as follows:

[0113] (1) Construction of DrPPX(-8AA) expression plasmid:

[0114] Using DrPPX(WT) plasmid as template, primer pair 6 (DrPPX(-8AA)-F and 28A-R) and primer pair 7 (28A-F and DrPPX(-8AA)-R) were used to amplify two DNA fragments with homology arms of the mutation site, respectively.

[0115] Primer pair 6:

[0116] DrPPX(-8AA)-F:ggcgggtgctCTGAGCGAGTTCCTCGATCAGCATCC(SEQ IDNo.17);

[0117] 28A-R: CGCGATCGCTGTTAAAAGGACAATTACAAACAGG (SEQ ID No. 8).

[0118] Primer pair 7:

[0119] 28A-F: CCTGTTTGTAATTGTCCTTTTAACAGCGATCGCG (SEQ ID No. 9);

[0120] DrPPX(-8AA)-R: actcgctcagAGCACCCGCCAGCGCAGC (SEQ ID No. 18).

[0121] TransStart FastPfu Fly DNA Polymerase from Transgen was used for amplification. The amplification system included: 1 μl FastPfu Fly DNA Polymerase, 10 μl Fly Buffer, 6 μl 2.5 mM dNTPs, 30 μl deionized water, 1 μl each primer, and 1 μl template. The PCR program was as follows: (1) 95°C, 3 min; (2) 95°C, 30 sec; (3) 58°C, 30 sec; (4) 72°C, 2 min; steps (2) to (4) were repeated for 35 cycles; (5) 72°C, 5 min.

[0122] The amplified DNA product was recovered by gel cutting using Wizard SV gel recovery and PCR recovery kit. Then, one-step cloning was performed using AbClonal's 2×MultiF Seamless Assembly Mix homologous recombination kit. The two fragments were mixed at a molecular weight of 1:1, and an equal amount of 2×MultiF Seamless Assembly Mix was added to connect in a 50°C water bath for 1 hour. After cooling on ice for 5 minutes, 10 μl was aspirated and added to DH5α competent cells, ice bathed for 30 minutes, heat-shocked in a 42°C water bath for 75 seconds, and 500 μl of LB liquid culture medium was added. The cells were cultured at 37°C at 220 rpm for two hours, and then spread on LB culture plates containing kanamycin. After inverted culture at 37°C for 24 hours, bacteria were selected for sequencing. After the correct colonies were selected, the construction of the DrPPX(-8AA) expression plasmid was completed. The sequence characteristics of the DrPPX(-8AA) plasmid modification are shown in the following figure. Figure 4 shown.

[0123] The DrPPX(-8AA) expression plasmid was used to replace the DrPPX(+7AA) expression plasmid, and the same method as steps (2) and (3) in the aforementioned “I. The first modification of the DrPPX protein” was used to perform (2) construction of the Escherichia coli expression strain and induced expression of the protein and (3) purification of the PPX protein.

[0124] 4. The fourth modification of DrPPX protein

[0125] Using the proline (P) replacement method, the 13th and 14th SL amino acids in the α-linker linker sequence of the DrPPX protein were mutated into consecutive prolines (P) using the amino acid point mutation method. This consecutive proline pair PP was used as a new termination segment to perform related functions, so that the α-linker linker sequence of the functional enzyme was transformed into NMLIEELAQVQTF C (SEQ ID No. 19), and the DrPPX (SL / PP) modified body was obtained.

[0126] (1) Construction of DrPPX (SL / PP) expression plasmid

[0127] Using DrPPX (WT) plasmid as template and point mutation primer pair 8, the expression vector product with the mutation site was amplified.

[0128] Primer pair 8:

[0129] DrPPX(SL / PP)-F: CTCGCTCAGGTCCAGACTTTCCCCCCGGCGCTCAGCA (SEQ ID No. 20);

[0130] DrPPX(SL / PP)-R: GGGGGGAAAGTCTGGACCTGAGCGAGTTC (SEQ ID No. 21).

[0131] The amplification system includes: 1 μl of FastPfu Fly DNA Polymerase, 10 μl of Fly Buffer, 6 μl of 2.5 mM dNTPs, 30 μl of deionized water, 1 μl of each primer, and 1 μl of template.

[0132] The PCR program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 30 seconds; (3) 58°C, 30 seconds; (4) 72°C, 5 minutes; steps (2) to (4) were repeated for 25 cycles; (5) 72°C, 10 minutes.

[0133] The amplified product was digested with restriction endonuclease DpnI to remove the residual template. The digestion reaction system was: 17 μl of amplified product, 1 μl of DpnI, 2 μl of cut buffer, and the digestion program was: digestion at 37°C for 5 hours.

[0134] Add all the digested products to DH5α competent cells, place in an ice bath for 30 minutes, heat shock in a 42°C water bath for 75 seconds, add 500 μL of LB liquid culture medium, culture at 37°C shaker at 220 rpm for two hours, spread on LB culture medium plates containing kanamycin, culture at 37°C inverted for 24 hours, and select bacteria for sequencing. After selecting the correct colony, the construction of DrPPX (SL / PP) expression plasmid is completed. The sequence characteristics of DrPPX (SL / PP) plasmid transformation are shown in Figure 1. Figure 5 shown.

[0135] The DrPPX(SL / PP) expression plasmid was used to replace the DrPPX(+7AA) expression plasmid, and the same method as steps (2) and (3) in the aforementioned “I. The first modification of the DrPPX protein” was used to perform (2) construction of the Escherichia coli expression strain and induced expression of the protein and (3) purification of the PPX protein.

[0136] 5. The fifth modification of DrPPX protein

[0137] Using the proline (P) replacement method, the 9th and 10th VQ amino acids in the α-linker sequence of the DrPPX protein were mutated into consecutive prolines (P) using the amino acid point mutation method, and the consecutive prolines were used as new termination segments to perform related functions, so that the α-linker segment sequence of the functional enzyme was transformed into NMLIEELAQ C (SEQ ID No. 22), and the DrPPX (VQ / PP) modified body was obtained. The details are as follows:

[0138] (1) Construction of DrPPX (VQ / PP) expression plasmid

[0139] Using DrPPX (WT) plasmid as template and point mutation primer pair 9, the expression vector product with the mutation site was amplified.

[0140] Primer pair 9:

[0141] DrPPX(VQ / PP)-F:

[0142] TGCTGATCGAGGAACTCGCTCAGCCCCGACTTTCAGCT(SEQ ID No.23)

[0143] DrPPX(VQ / PP)-R:

[0144] GGGGGCTGAGCGAGTTCCTCGATCAGCATC (SEQ ID No. 24).

[0145] The amplification system included: FastPfu Fly DNA Polymerase 1 μl, Fly Buffer 10 μl, 2.5 mM dNTPs 6 μl, deionized water 30 μl, primers 1 μl each, template 1 μl. The PCR program was as follows: (1) 95°C, 3 min; (2) 95°C, 30 sec; (3) 58°C, 30 sec; (4) 72°C, 5 min; steps (2) to (4) were repeated for 25 cycles; (5) 72°C, 10 min.

[0146] The amplified product was digested with restriction endonuclease DpnI to remove the residual template. The digestion reaction system was: 17 μl of amplified product, 1 μl of DpnI, 2 μl of cut buffer, and the digestion program was: digestion at 37 degrees Celsius for 5 hours.

[0147] All digested products were added to DH5α competent cells, placed in an ice bath for 30 minutes, heat-shocked in a 42°C water bath for 75 seconds, added with 500 μL of LB liquid culture medium, cultured at 37°C in a shaker at 220 rpm for two hours, spread on LB culture plates containing kanamycin, cultured at 37°C inverted for 24 hours, and then selected for sequencing. After the correct colony was selected, the construction of the DrPPX (VQ / PP) expression plasmid was completed. The sequence characteristics of the DrPPX (VQ / PP) plasmid transformation are shown in Figure 1. Figure 6 shown.

[0148] The DrPPX(VQ / PP) expression plasmid was used to replace the DrPPX(+7AA) expression plasmid, and the same method as steps (2) and (3) in the aforementioned “I. The first modification of the DrPPX protein” was used to perform (2) construction of the Escherichia coli expression strain and induced expression of the protein and (3) purification of the PPX protein.

[0149] VI. The Sixth Modification of DrPPX Protein

[0150] Using the proline (P) replacement method, the LA amino acids at positions 6 and 7 in the α-linker sequence of the DrPPX protein were mutated into consecutive prolines (P) using the amino acid point mutation method. This consecutive proline pair PP was used as a new termination segment to perform related functions, so that the α-linker sequence of the functional enzyme was transformed into NMLIEE C (SEQ ID No. 25), and the DrPPX (LA / PP) modified body was obtained. The details are as follows:

[0151] (1) Construction of DrPPX (LA / PP) expression plasmid

[0152] Using DrPPX (WT) plasmid as template and point mutation primer pair 10, the expression vector product with the mutation site was amplified.

[0153] Primer pair 10:

[0154] DrPPX(LA / PP)-F:GGGATGCTGATCGAGGAACCCCCTCAGGTCCAG (SEQ ID No. 26);

[0155] DrPPX(LA / PP)-R:GGGGTTCCTCGATCAGCATCCCTTCGC (SEQ ID No. 27).

[0156] The amplification system includes: 1 μl of FastPfu Fly DNA Polymerase, 10 μl of Fly Buffer, 6 μl of 2.5 mM dNTPs, 30 μl of deionized water, 1 μl of each primer, and 1 μl of template.

[0157] The PCR program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 30 seconds; (3) 58°C, 30 seconds; (4) 72°C, 5 minutes; steps (2) to (4) were repeated for 25 cycles; (5) 72°C, 10 minutes.

[0158] The amplified product was digested with restriction endonuclease DpnI to remove the residual template. The digestion reaction system was: 17 μl of amplified product, 1 μl of DpnI, 2 μl of cut buffer, and the digestion program was: digestion at 37 degrees Celsius for 5 hours.

[0159] All digested products were added to DH5α competent cells, placed in an ice bath for 30 minutes, heat-shocked in a 42°C water bath for 75 seconds, added with 500 μL of LB liquid culture medium, cultured at 37°C in a shaker at 220 rpm for two hours, spread on LB culture plates containing kanamycin, cultured at 37°C inverted for 24 hours, and then selected for sequencing. After the correct colony was selected, the construction of the DrPPX (LA / PP) expression plasmid was completed. The sequence characteristics of the DrPPX (LA / PP) plasmid transformation are shown in Figure 1. Figure 7 shown.

[0160] The DrPPX(LA PP) expression plasmid was used to replace the DrPPX(+7AA) expression plasmid, and the same method as steps (2) and (3) in the aforementioned “I. The first modification of the DrPPX protein” was used to perform (2) construction of the Escherichia coli expression strain and induced expression of the protein and (3) purification of the PPX protein.

[0161] VII. Structural analysis of DrPPX protein modifications

[0162] Use the Google-Colab AlphaFold 2 online version (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb) to predict the structure of the modified protein: input the amino acid sequence to be predicted, select the number of calculations to be 5, and finally select the protein structure with the highest residue confidence score (pLDDT).

[0163] AlphaFold 2 was used to analyze the structural characteristics of PPX proteins modified by amino acid modification. The results showed that in the DrPPX (+7AA) modification, the α-linker region was indeed extended by 7 amino acids. Similarly, for the DrPPX (-5AA) and DrPPX (-8AA) modifications, their analysis results showed that the α-linker region was shortened by 5 and 8 amino acids, respectively. This shows that PPX proteins with different lengths of α-linkers can be successfully obtained through amino acid modification methods.

[0164] After using AlphaFold 2 to analyze the structure of PPX proteins modified by the proline replacement method, the results showed that the mutant DrPPX (SL / PP), DrPPX (VQ / PP) and DrPPX (LA / PP) modified bodies all had an α-linker shorter than the wild-type DrPPX, and the α-linkers of the three proteins showed a trend of gradually shortening.

[0165] 8. Enzyme activity and thermal stability test of DrPPX protein modification

[0166] Urea-polyacrylamide gel electrophoresis (UREA-PAGE) was used to analyze the enzyme activity of PPX protein (DrPPX or PPX modified body). The specific method of UREA-PAGE is as follows: premix the reaction solution, the reaction system is: 100μM polyP (P100), 2mM MgCl 2 , 2 μg PPX protein, the total reaction volume was 20 μl. The reaction procedure was: 15 min in a water bath at 37°C. The reaction products were electrophoresed on a 12% (wt / vol) urea-polyacrylamide gel containing 7 M urea, stained with DAPI, and then imaged using a UV gel imager.

[0167] For the thermal stability test of PPX protein (DrPPX or PPX variant), we also selected the above reaction system, but changed the reaction temperature to 55°C and 70°C.

[0168] The results of the enzymatic activity experiments on the protein modifications obtained by the amino acid modification method confirmed that after the α-linker extension modification, the DrPPX (+7AA) modification exhibited weaker polyphosphate cleavage activity; and the PPX modification with a truncated α-linker had stronger enzymatic activity than the wild-type DrPPX protein, and the DrPPX (-8AA) modification with the shortest α-linker structure had the strongest enzymatic activity (e.g. Figure 8This result shows that the amino acid modification method to modify the length of protein α-linker to regulate its enzyme activity is effective. After modification, the protein with a shorter α-linker has stronger enzyme activity; after modification, the protein with a longer α-linker has weaker enzyme activity.

[0169] The results of enzyme activity analysis of the PPX protein modified bodies obtained by the proline replacement method showed that the α-linker structure interrupted near the N-terminal position was shorter, resulting in a significant increase in the PPX enzymatic activity. Among them, DrPPX (LA / PP) with the shortest α-linker showed the strongest activity (e.g. Fig. 9 The results show that the proline replacement method can also effectively modify the length of the α-linker of the PPX protein, thereby directionally regulating the activity of the PPX protein.

[0170] The thermostability analysis of the PPX protein modified bodies obtained by the proline replacement method was performed. The results of the thermostability experiment showed that DrPPX (WT) with a longer α-linker could completely degrade the substrate at 37°C for 30 minutes, while DrPPX (WT) almost completely lost its activity at 55°C and 70°C; for various DrPPX modified bodies with truncated α-linkers, DrPPX (VQ / PP) and DrPPX (LA / PP) still retained most of the polyP cleavage activity at 55°C, but were completely inactivated at 70°C (e.g. Fig.10 This confirms that the modification to shorten the α-linker can improve the high temperature environment stability of DrPPX. This result shows that the method of the present invention for directionally regulating the thermal stability of DrPPX protein by modifying the α-linker is accurate and effective.

[0171] From the above results, it can be seen that the method adopted by the present invention to carry out directed design and modification of functional enzymes containing α-linkers by modifying the interdomain linker sequence of α-helical protein structure is very effective in DrPPX protein.

[0172] The PPX proteins with different α-linker lengths modified by amino acid extension or truncation and proline replacement have different enzymatic activities and thermal stability. The PPX proteins with shorter α-linkers have higher enzymatic activity and thermal stability. This means that the directional design of functional enzymes based on the modification of the linker sequence between protein domains has been achieved.

[0173] The α-linker structure exists between the N-terminal and C-terminal domains of many functional enzymes, so the application scenarios involved in this invention are by no means limited to the PPX protein in the above embodiment. Under the design rules of the present invention, other functional enzymes with similar α-linker structures may use the method described in the present invention to modify the α-linker structure to directionally regulate the function and characteristics of the functional enzyme.

[0174] At the same time, the α-helical interdomain linker sequence disclosed in the present invention can be used not only in the field of directional design of microorganisms in nature, but also in the field of design and modification of artificial proteins. After two domains with independent functions are connected using the α-helical interdomain linker sequence of the present invention, the interaction between adjacent domains may be affected by modifying the α-helical interdomain linker sequence to construct an artificial fusion protein with special functions and effects.

[0175] Therefore, the application of the above-mentioned method for designing and modifying functional enzymes based on protein domain linker sequences includes, but is not limited to: being used in the field of directed design and modification of natural biological enzymes; being used in the field of design and modification of artificial enzymes.

[0176] It can be seen that the purpose of the present invention has been completely and effectively achieved. The functional and structural principles of the present invention have been demonstrated and explained in the embodiments. Without departing from the principles, the implementation methods can be modified arbitrarily. Therefore, the present invention includes all modified implementation methods based on the spirit and scope of the claims.

Claims

1. A method for modifying an enzyme protein, which is performed on a functional enzyme containing an α-linker, wherein the α-linker in the functional enzyme is located between the N-terminal domain of the protein and the C-terminal domain of the protein, and the α-linker sequence consists of an α-linker start segment, an α-linker linker segment, and an α-linker stop segment; wherein, The α-linker starting segment is a starting sequence consisting of 3 to 5 amino acids, the α-linker connecting segment is an arbitrary amino acid sequence of 0 to 25 amino acids excluding glycine and proline, and the α-linker terminating segment is an arbitrary amino acid sequence combination capable of terminating the α-helical domain; characterized in that the enzyme protein modification method comprises: performing any one of the following modifications (i) to (iii) on the α-linker sequence; (i) using amino acid modification methods to add several amino acids into the linker segment of the α-linker sequence; (ii) removing several amino acids in the linker segment of the α-linker sequence using an amino acid modification method; (iii) using amino acid point mutation method to mutate any two consecutive amino acids in the linker segment of the α-linker sequence into two proline.

2. The method for transforming an enzyme protein according to claim 1, characterized in that: The number of the increased amino acids is 1 to 15.

3. The method for modifying an enzyme protein according to claim 1 or 2, wherein: The transformations (i) to (iii) are as follows: (i) selecting the amino acid site to be modified in the linker segment of the α-linker sequence, extending the DNA sequence within 5 to 15 bp before and after the site as a homology arm, adding the corresponding modification sequence to design a recombination primer, and using the primer to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with an extended α-linker sequence; (ii) selecting the amino acid site to be modified in the linker segment of the α-linker sequence, truncating the DNA sequence within 5 to 15 bp before and after the site as the homology arm, adding the corresponding modification sequence to design recombination primers, and using the primers to amplify and recombinant the wild-type protein expression plasmid to obtain the target functional enzyme with a truncated α-linker sequence; (iii) selecting the amino acid site to be mutated in the linker segment of the α-linker sequence, designing double mutation primers for PCR amplification and site-directed mutagenesis, and mutating the selected site to proline to obtain the target functional enzyme with a proline-modified α-linker sequence.

4. The method for modifying an enzyme protein according to claim 1 or 2, wherein: The functional enzyme is a natural enzyme or an artificial enzyme.

5. The method for transforming an enzyme protein as claimed in claim 4, characterized in that: The natural enzyme is DrPPX, and the sequence characteristics of the α-linker sequence in the DrPPX are: DrPPX protein N-terminal domain-[α-linker starting segment]-[α-linker connecting segment]-[α-linker ending segment]-DrPPX protein C-terminal domain; wherein the α-linker starting segment is composed of five consecutive amino acids with a sequence of NALREG C, the α-linker connecting segment is composed of 15 amino acids with a sequence of NMLIEELAQVQTFSLA C, and the α-linker ending segment is composed of three amino acids with a sequence of NLST C.

6. The method for transforming an enzyme protein according to claim 5, characterized in that: The amino acid modification method was used to add the LAQTFSLA sequence to the C-terminus of the α-linker adapter segment in the DrPPX, so that the sequence of the α-linker adapter segment became NMLIEELAQVQTFSLALAQTFSLA C.

7. The method for transforming an enzyme protein according to claim 5, characterized in that: The amino acid modification method is used to remove the TFSLA part in the α-linker linker sequence in the DrPPX, so that the sequence of the α-linker linker becomes NMLIEELAQVQ C; or, the amino acid modification method is used to remove the QVQTFSLA part in the α-linker linker sequence in the DrPPX, so that the sequence of the α-linker linker becomes NMLIEELA C.

8. The method for transforming an enzyme protein according to claim 5, wherein: The SL amino acids at positions 13 and 14 in the α-linker linker sequence of DrPPX are mutated into consecutive prolines using an amino acid point mutation method, so that the sequence of the α-linker linker sequence becomes NMLIEELAQVQTF C; or, The amino acid point mutation method is used to mutate the 9th and 10th VQ amino acids in the α-linker linker sequence of the DrPPX into consecutive prolines, so that the sequence of the α-linker linker becomes N MLIEELAQ C; or, The amino acid point mutation method was used to mutate the 6th and 7th LA amino acids in the α-linker linker sequence of the DrPPX into consecutive prolines, so that the sequence of the α-linker linker became N MLIEE C.

9. An enzyme protein modification obtained by the method according to any one of claims 1 to 4, characterized in that: Between the functional enzyme protein N-terminal domain and the functional enzyme protein C-terminal domain is a modified alpha helical protein domain connection sequence.

10. An enzyme protein modification obtained by the method according to any one of claims 5 to 8, characterized in that: Between the N-terminal domain of the DrPPX protein and the C-terminal domain of the DrPPX protein is a modified alpha-helical protein domain connection sequence.

Images