Hybrid pig body height character multi-MNP molecular marker combination and application thereof

Abstract

The invention discloses a hybrid pig body height character multi-MNP molecular marker combination and application thereof, and relates to the technical field of biology, the multi-MNP molecular marker combination is composed of molecular markers numbered as MNP-1, MNP-2 and MNP-3, and the nucleotide sequences of the molecular markers are respectively shown as the nucleotide sequences from SEQ NO.1 to SEQ NO.3 in a sequence table. The invention provides an MNP molecular marker combination for the body height character of a binary hybrid pig, and designs a specific primer which can be used for early judgment of the body height character of the hybrid pig. According to the method, accurate gene selection can be realized, so that hybrid pigs with ideal body types can be efficiently bred, rapid and accurate genetic selection is realized in population improvement, genetic progress is accelerated, and economic benefits are improved. And a new tool is expected to be provided for early judgment and evaluation of the body height character.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a hybrid pig high-trait multi-MNP molecular marker combination and application thereof. Background Art

[0002] As consumers' demand for high-quality pork continues to grow, the importance of seed industry development has become increasingly prominent. In order to meet the market demand for high-quality pork, breeding new varieties has become a top priority in the breeding field. Local pigs have become the main target of high-quality genetic resource development with their unique genetic advantage of excellent meat quality, providing an ideal choice for the market to breed new varieties. However, in the actual production of local pig hybridization, the height trait of the hybrid new varieties did not reach the expected level. As one of the important morphological characteristics of pigs, the height trait has important reference value for its life function and economic value. Generally speaking, pigs with taller height tend to have larger skeletons and body volume, which can accommodate more muscles and internal organs, so that they can more efficiently ingest and utilize feed during growth, which is converted into weight gain. At the same time, good height traits can also help improve the quality of pork, such as muscle texture, tenderness and flavor.

[0003] Therefore, it is extremely important to select and breed hybrid pigs for their height traits, but traditional breeding methods are not ideal for quickly improving the height traits of new breeds. There is an urgent need for a new breeding technology to accelerate the process of genetic improvement. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides a multi-MNP molecular marker combination for body height traits of hybrid pigs and its application, which can help breeders select and cultivate new varieties with good body height traits more accurately and efficiently.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] Provided is a hybrid pig high trait multi-MNP molecular marker combination, which consists of molecular markers numbered MNP-1, MNP-2, and MNP-3, and the nucleotide sequences of the molecular markers are shown in SEQ NO.1 to SEQ NO.3 nucleotide sequences in the sequence table.

[0007] Furthermore, the hybrid pig is a binary hybrid pig bred by mating Rongchang pig and Laiwu pig.

[0008] Furthermore, the molecular marker MNP-1 contains the following four SNP sites:

[0009] I. The SNP site located at 37321687bp of chromosome 10 of pig is located at position 131 of the sequence shown in SEQ NO.1, and its polymorphism is T / G;

[0010] Ii, the SNP site located at 37321701bp of chromosome 10 of pig, located at position 145 of the sequence shown in SEQ NO.1, and its polymorphism is G / A;

[0011] iii. The SNP site located at 37321909bp of chromosome 10 of pig is located at position 352 of the sequence shown in SEQ NO.1, and its polymorphism is T / G;

[0012] Iv, a SNP site located at 37321933bp on chromosome 10 of pig, located at position 377 of the sequence shown in SEQ NO.1, and its polymorphism is G / A;

[0013] The molecular marker MNP-2 contains the following four SNP sites:

[0014] a. The SNP site located at 38648489bp of pig chromosome 10 is located at the 200th position of the sequence shown in SEQ NO.2, and its polymorphism is G / A;

[0015] b. The SNP site located at 38648524bp of chromosome 10 of pig is located at position 235 of the sequence shown in SEQ NO.2, and its polymorphism is G / A;

[0016] c. The SNP site located at 38648529bp of chromosome 10 of pig is located at position 240 of the sequence shown in SEQ NO.2, and its polymorphism is G / C;

[0017] d. The SNP site located at 38648677bp of pig chromosome 10 is located at position 388 of the sequence shown in SEQ NO.2, and its polymorphism is A / G;

[0018] The molecular marker MNP-3 includes the following three SNP sites:

[0019] ①, the SNP site located at 41505867bp of pig chromosome 13, located at the 118th position of the sequence shown in SEQ NO.3, and its polymorphism is T / C;

[0020] ②, the SNP site located at 41506107bp of pig chromosome 13, located at the 358th position of the sequence shown in SEQ NO.3, and its polymorphism is A / G;

[0021] ③. The SNP site located at 41506113bp of pig chromosome 13 is located at position 364 of the sequence shown in SEQ NO.3, and its polymorphism is A / G.

[0022] The present invention also provides a kit for identifying high-trait binary hybrid pigs prepared by using the primer pair composition.

[0023] The present invention also provides the use of the above-mentioned kit for identifying high-trait characteristics of binary hybrid pigs, including:

[0024] (1) Used for identification and genetic improvement of high-quality traits in binary hybrid pigs;

[0025] (2) Used for early prediction of high-quality traits in binary hybrid pigs;

[0026] (3) Molecular marker-assisted breeding related to high-quality traits of binary hybrid pigs.

[0027] The present invention also provides a method for determining the high traits of a binary hybrid pig using the above-mentioned kit for identifying high traits of a binary hybrid pig, comprising the following steps:

[0028] S1: Extract genomic DNA of the hybrid pig to be tested;

[0029] S2: using the genomic DNA of the hybrid pig to be tested as a template, using the primers in the kit to perform a PCR amplification reaction on the composition to obtain a PCR product;

[0030] S3: Sequence the PCR product to obtain its genotype;

[0031] S4: Determine the height trait of the hybrid pig to be tested based on the genotype.

[0032] Furthermore, step S4 is specifically as follows: when the SNP site polymorphism in the hybrid pig genotype to be tested is expressed as a minor allele, the individual has a better body height trait than the individual whose polymorphism is expressed as a major allele.

[0033] Furthermore, the major allele is an allele with a population frequency of ≥90% at the SNP site of the molecular marker, and the minor allele is an allele with a population frequency of ≤10% at the SNP site of the molecular marker.

[0034] The present invention also provides a method for genetic improvement of binary hybrid pig high traits, which is specifically: after determining the binary hybrid pig high traits, breeding and selecting hybrid pig individuals whose SNP site polymorphism is expressed as a minor allele; the minor allele is an allele with a frequency of ≤10% within the population at the SNP site of the molecular marker.

[0035] The beneficial effects of the present invention are:

[0036] The present invention proposes a combination of MNP molecular markers for the height trait of binary hybrid pigs, and designs specific primers that can be used for early judgment of the height trait of hybrid pigs. It can achieve accurate gene selection, thereby efficiently breeding hybrid pigs with ideal body shapes, achieving rapid and accurate genetic selection in population improvement, accelerating genetic progress, and thus improving economic benefits. It is expected to provide a new tool for early judgment and evaluation of height traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the Manhattan plot of height trait of hybrid pigs in GWAS analysis;

[0038] Figure 2 This is a box plot of the body height of 300 Rong-Lai hybrid pigs;

[0039] Figure 3 This is a box plot of body height of 100 6-month-old Rong-Lai hybrid pigs. DETAILED DESCRIPTION

[0040] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0041] Example 1 MNP molecular marker combination development Whole genome resequencing library construction process

[0042] The experimental subjects in this embodiment are Rong-Lai binary hybrid pigs (hereinafter referred to as hybrid pigs) obtained by mating Rongchang pigs and Laiwu pigs, which are from the Rongchang Pig National Breeding Farm in Rongchang District, Chongqing. 300 hybrid pigs aged 60 days were randomly selected, half of which were male and half were female.

[0043] In the breeding process of hybrid pigs, regardless of whether the Rongchang pigs are female or male, the Rong-Lai binary hybrid pigs obtained can use the same combination of multi-MNP molecular markers to evaluate and identify their height traits. This is because these molecular markers can stably reflect the genetic information of the height trait and are not affected by the gender of the parents.

[0044] 5 mL of venous blood was collected from each hybrid pig, and DNA was extracted using the traditional CTAB method. The quality of the extracted genomic DNA was tested using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was between 1.8 and 2.0 and the A260 / 230 ratio was around 1.7 and 1.9.

[0045] The concentration of the DNA samples that met the standards was diluted to 50 ng / μl, and each DNA sample was resequenced at a low depth using the HiSeqXTen sequencer platform of Illumina (the average sequencing depth was about 7.8×). All the double-end reads obtained were aligned to the 11.1 version of the International Swine Genome using BWA software, and then the genotype data of each individual was obtained using SAMTools, GATKv4.1.7.0 and other software. Plink1.9 was used to perform quality control on the obtained genotype data, and individuals with minor allele frequency (MAF) < 0.03 and family Mendelian error rate > 0.1 were eliminated. The Hardy-Weinberg equilibrium (HWE) 1×10-6 was used as the threshold for quality control, and finally it was determined that there were 39,082,688 molecular markers in the Rong-Lai hybrid pig population;

[0046] The GEMMA (Genome-wide Efficient Mixed Model AssoGiation algorithm, version 0.98.3) software was used for genome-wide association analysis. The molecular marker information of the Rong-Lai hybrid population obtained by the second-generation resequencing technology and the corresponding height traits of 300 individuals were subjected to GWAS analysis. The GWAS analysis model is as follows: y = Xβ + Zu + p + e. Among them, y is the phenotypic vector; X is the fixed effect design matrix, and Z is the random effect design matrix; β is the fixed effect vector, which mainly includes field, year, and season effects; p is the covariate, which is the result of the first five PCs; u is the random effect vector, and it conforms to u~N(0,Gσu2), where G is the genomic kinship matrix; e is the residual vector, and it conforms to e~N(0,Iσ e 2 ), where σ e 2 is the residual variance, and I is the identity matrix.

[0047] The results of the association analysis were visualized using R software. Figure 1 This study used the Bonferroni method to perform multiple hypothesis testing correction to determine the association significance value, and regarded sites with values ​​less than 0.05 / (NSnp) as significant sites at the genome level, and sites with values ​​less than 1 / total SNP number as significant sites at the chromosome level, and obtained the nucleotide sequences shown in SEQ NO.1, SEQ NO.2 and SEQ NO.3 in the sequence list.

[0048] For the convenience of representation, the polymorphism of the MNP molecular marker combination as the major allele is called the wild type (Wild Type, WT), and the polymorphism as the minor allele is called the mutant type (Mutant Type, MT). WT / WT: indicates that at this SNP site, the individual is wild type, with two major alleles. WT / MT: indicates that at this SNP site, the individual is heterozygous, with one major allele and one minor allele. MT / MT: indicates that at this SNP site, the individual is mutant, with two minor alleles.

[0049] The vertical distance from the scutum to the ground of each hybrid pig was measured using a height measuring tape. The statistical results are shown in Table 1.

[0050] Table 1

[0051] Characteristics Number of individuals Maximum Minimum average value Standard Deviation Coefficient of dispersion body height 300 62 46.3 54.04 5.42 10.03％

[0052] Combining the high phenotypic data, we can see that Figure 2 As shown, among the 300 Rong-Lai hybrid pigs, the number of pigs with the genotype of WT / WT was 158, and the phenotypic values ​​of body height mainly ranged from 46 to 54.5 cm; the number of pigs with the genotype of WT / MT was 95, and the phenotypic values ​​of body height mainly ranged from 54.5 to 60.5 cm; the number of pigs with the genotype of MT / MT was 47, and the phenotypic values ​​of body height mainly ranged from 60.5 to 65 cm.

[0053] Example 2 Primer design and verification

[0054] Specific primers were designed according to the nucleotide sequence obtained in Example 1, and the primer sequences are as follows:

[0055] SEQ NO.1-F:CCCCATGCATCTGCTTCTGTA;

[0056] SEQ NO.1-R: GTGTCTGCTGCTACGGCAA;

[0057] SEQ NO.2-F:GGGGCTTTACCTGGGGAGTTTC;

[0058] SEQ NO.2-R: CAGACCACCTTGCTCCTTTGA;

[0059] SEQ NO.3-F:TCCTCAGCCAGACAAGAAGGA;

[0060] SEQ NO.3-R: GTACCATCTGTTCCTCCCCAC;

[0061] DNA of 100 60-day-old hybrid pigs to be tested was collected, and the collected DNA template was amplified by PCR using the above-mentioned specific primer combination; specifically, the DNA was diluted to 100 ng / μl, and the primers were diluted to 10 μmol / L; the amplification system was shown in Table 2, and the amplification program was shown in Table 3 to obtain PCR products; the PCR products of the hybrid pigs to be tested were purified and recovered by electrophoresis on 2% agarose.

[0062] Table 2

[0063] Components Volume (μl) SYBR 10 Forward primer 1 Reverse primer 1 gDNA 2 <![CDATA[RNase Free H 2 The]]> 6 Total 20

[0064] Table 3

[0065]

[0066] The sequencing results were statistically analyzed to determine the genotypes of the polymorphic sites of the multi-MNP molecular marker combination in hybrid pigs. Among the 100 hybrid pigs tested, 53 had the genotype WT / WT, 28 had the genotype WT / MT, and 19 had the genotype MT / MT.

[0067] The above 100 hybrid pigs were raised under the same conditions until they were 6 months old, and the phenotypic values ​​of body height were measured. Figure 3 As shown in Table 4, the prediction accuracy of the genotype of WT / WT, WT / MT and MT / MT reached 98.11%, 92.86% and 94.74% respectively, among the 100 Rong-Lai hybrid pigs tested, was compared with the predicted height range according to the genotype at 60 days of age to verify the accuracy of the multi-MNP molecular marker combination in the early judgment and evaluation of the height trait of Rong-Lai hybrid pigs.

[0068] Table 4

[0069] genotype Number (head) Number of heads within the reference range Phenotypic value reference range (cm) Accuracy (%) WT / WT 53 52 46-54.5 98.11 WT / MT 28 26 54.5-60.5 92.86 MT / MT 19 18 60.5-65 94.74

Claims

1. A binary hybrid pig high trait multi-MNP molecular marker combination, characterized in that: The multi-MNP molecular marker combination consists of molecular markers numbered MNP-1, MNP-2, and MNP-3, and the nucleotide sequences of the molecular markers are shown in the nucleotide sequences SEQ NO.1 to SEQ NO.3 in the sequence list, respectively.

2. The high-trait multi-MNP molecular marker combination for binary hybrid pigs according to claim 1, characterized in that: The hybrid pig is a binary hybrid pig obtained by mating and breeding Rongchang pig and Laiwu pig.

3. The binary hybrid pig high trait multi-MNP molecular marker combination according to claim 1, characterized in that: The molecular marker MNP-1 comprises the following four SNP sites: I. The SNP site located at 37321687bp of chromosome 10 of pig is located at position 131 of the sequence shown in SEQ NO.1, and its polymorphism is T / G; Ii, the SNP site located at 37321701bp of chromosome 10 of pig, located at position 145 of the sequence shown in SEQ NO.1, and its polymorphism is G / A; iii. The SNP site located at 37321909bp of chromosome 10 of pig is located at position 352 of the sequence shown in SEQ NO.1, and its polymorphism is T / G; Iv, a SNP site located at 37321933bp on chromosome 10 of pig, located at position 377 of the sequence shown in SEQ NO.1, and its polymorphism is G / A; The molecular marker MNP-2 comprises the following four SNP sites: a. The SNP site located at 38648489bp of pig chromosome 10 is located at the 200th position of the sequence shown in SEQ NO.2, and its polymorphism is G / A; b. The SNP site located at 38648524bp of chromosome 10 of pig is located at position 235 of the sequence shown in SEQ NO.2, and its polymorphism is G / A; c. The SNP site located at 38648529bp of chromosome 10 of pig is located at position 240 of the sequence shown in SEQ NO.2, and its polymorphism is G / C; d. The SNP site located at 38648677bp on chromosome 10 of pig is located at position 388 of the sequence shown in SEQ NO.2, and its polymorphism is A / G; The molecular marker MNP-3 includes the following three SNP sites: ①, the SNP site located at 41505867bp of pig chromosome 13, located at the 118th position of the sequence shown in SEQ NO.3, and its polymorphism is T / C; ②, the SNP site located at 41506107bp of pig chromosome 13, located at the 358th position of the sequence shown in SEQ NO.3, and its polymorphism is A / G; ③. The SNP site located at 41506113bp of pig chromosome 13 is located at the 364th position of the sequence shown in SEQ NO.3, and its polymorphism is A / G.

4. A primer pair composition for amplifying the binary hybrid pig high trait multi-MNP molecular marker combination according to any one of claims 1 to 3, characterized in that: Included are primer pairs for amplification of MNP-1: SEQ NO.1-F:CCCCATGCATCTGCTTCTGTA; SEQ NO.1-R: GTGTCTGCTGCTACGGCAA; Primer pairs used to amplify MNP-2: SEQ NO.2-F:GGGGCTTTACCTGGGGAGTTTC; SEQ NO.2-R: CAGACCACCTTGCTCCTTTGA; Primer pairs used to amplify MNP-4: SEQ NO.3-F:TCCTCAGCCAGACAAGAAGGA; SEQ NO. 3-R: GTACCATCTGTTCCTCCCCAC.

5. A kit for identifying high-trait binary hybrid pigs prepared using the primer pair composition described in claim 4.

6. The use of the kit for identifying high-trait binary hybrid pigs according to claim 5, characterized in that: include: (1) Used for identification and genetic improvement of high-quality traits in binary hybrid pigs; (2) Used for early prediction of high-quality traits in binary hybrid pigs; (3) Used for molecular marker-assisted breeding related to high-quality traits in binary hybrid pigs.

7. A method for determining high traits of binary hybrid pigs using the kit for identifying high traits of binary hybrid pigs according to claim 5, characterized in that: The steps include: S1: Extract genomic DNA of the hybrid pig to be tested; S2: using the genomic DNA of the hybrid pig to be tested as a template, using the primers in the kit to perform a PCR amplification reaction on the composition to obtain a PCR product; S3: Sequence the PCR product to obtain its genotype; S4: Determine the height trait of the hybrid pig to be tested based on the genotype.

8. The method for determining high-quality traits of binary hybrid pigs according to claim 7, characterized in that: The step S4 is specifically as follows: when the SNP site polymorphism in the hybrid pig genotype to be tested is expressed as a minor allele, the individual has a better body height trait than the individual whose polymorphism is expressed as a major allele.

9. The method for determining high-quality traits of binary hybrid pigs according to claim 8, characterized in that: The major allele is an allele with a frequency of ≥90% in a population at the SNP site of the molecular marker, and the minor allele is an allele with a frequency of ≤10% in a population at the SNP site of the molecular marker.

10. A method for genetic improvement of high-quality traits of binary hybrid pigs, characterized in that: Specifically, after determining the high traits of binary hybrid pigs, the hybrid pig individuals whose SNP site polymorphism is expressed as minor alleles are bred and selected; the minor alleles are alleles with a population frequency of ≤10% at the molecular marker SNP site.

Images