Brassica napus black rot resistance gene BnBR1 and application thereof

Abstract

The invention provides a brassica napus black rot resistance gene BnBR1 and application thereof, and belongs to the technical field of gene engineering. The brassica napus black rot resistance gene BnBR1 is separated and cloned from a brassica napus black rot high resistance variety 'ZS9mXccR-1', the nucleotide sequence of the brassica napus black rot resistance gene BnBR1 is shown as SEQ ID NO.1, and the sequence of protein coded by the gene is shown as SEQ ID NO.2. The BnBR1 gene can improve the resistance of the brassica napus to the black rot, and the resistance of the brassica napus variety to the black rot can be effectively improved by applying the BnBR1 gene to brassica napus breeding through genetic transformation or hybridization, so that the harm of the black rot is reduced, and the purposes of yield increase and stable yield are achieved. The invention provides a new gene source for excavation and molecular breeding of black rot functional genes, and has a wide application prospect in the aspect of enhancing the resistance of brassica napus to black rot.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a black rot resistance gene BnBR1 of Brassica napus and an application thereof. Background Art

[0002] Brassica napus is a plant of the genus Brassica in the family Cruciferae. It has high grain yield and is one of the important oil crops. It also has important value in feed, green manure, vegetables, energy, tourism and nectar sources.

[0003] Black rot is a plant disease caused by Xanthomonas campestrispv. campestris (Xcc). Xcc is the model bacteria of the genus Xanthomonas, and mainly harms Brassica crops such as cabbage, kale, and rapeseed. Rapeseed black rot is widely found in rapeseed producing areas. Due to changes in climate and cultivation methods, the incidence of rapeseed black rot has become more serious. The incidence rate in general diseased fields is 10% to 20%, and the incidence rate in severely diseased fields is 60% to 80%, causing a 30% to 50% reduction in rapeseed production, resulting in significant economic losses.

[0004] At present, black rot is prevalent in the world's Brassica crop producing areas and is one of the most serious diseases of Brassica crops. For a long time, the prevention and control of black rot has mainly relied on the application of chemical fungicides, including treating seeds with fungicides and applying chemical pesticides before and after the disease occurs. The frequent and large-scale use of pesticides to prevent and control black rot has increased farmers' production costs on the one hand, and on the other hand, chemical fungicides have also caused environmental and ecological problems such as poisoning non-target organisms and polluting the environment and food.

[0005] Planting resistant varieties is the main biological control measure for black rot. For a long time, the development and utilization of black rot resistant varieties have been considered the most economical and effective measure to control black rot. At present, 11 physiological races have been identified in Xcc that can infect Brassica plants, among which race 1 and race 4 are the most widely distributed and most harmful races. There are many reports on black rot resistance loci in cabbage crops, and 31 QTLs have been located, of which 21 QTLs are resistant to race 1. 39 QTLs have been located in cabbage, of which 8, 7, 9, and 11 QTLs are resistant to races 1, 3, 4, and 6, respectively. Only one QTL resistant to race 4 has been reported in Brassica napus. In summary, although so many QTLs have been located in Brassica crops, black rot resistance genes have not yet been cloned in Brassica crops. Summary of the invention

[0006] The object of the present invention is to provide a Brassica napus black rot resistance gene BnBR1 and its application to solve the above problems.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a black rot resistance gene BnBR1 of Brassica napus, and the nucleotide sequence of BnBR1 is shown as SEQ ID NO.1.

[0009] The present invention also provides a protein encoded by the Brassica napus black rot resistance gene BnBR1, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0010] The invention also provides a vector containing the black rot resistance gene BnBR1 of Brassica napus.

[0011] The invention also provides a cell containing the Brassica napus black rot resistance gene BnBR1.

[0012] The present invention also provides a method for improving the black rot resistance of Brassica napus. The method comprises overexpressing a black rot resistance gene BnBR1 in the rapeseed. The nucleotide sequence of the gene BnBR1 is shown in SEQ ID NO.1.

[0013] The present invention also provides a molecular marker for predicting or identifying the black rot resistance of Brassica napus, wherein the molecular marker is the A / T polymorphism at position 156 of the amplified fragment of primer pair 590-2F / R; the nucleotide sequences of primer pair 590-2F / R are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0014] The present invention also provides a primer pair for the molecular marker, including a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer 590-2F is shown in SEQ ID NO.6; and the nucleotide sequence of the reverse primer 590-2R is shown in SEQ ID NO.7.

[0015] The invention also provides application of the molecular marker in breeding black rot resistant Brassica napus.

[0016] The invention also provides application of the primer pair in breeding black rot resistant Brassica napus.

[0017] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention isolates and clones a Brassica napus black rot resistant gene BnBR1 from the Brassica napus black rot highly resistant variety "ZS9mXccR-1", the nucleotide sequence of which is shown in SEQ ID NO.1, and the protein sequence encoded by the gene is shown in SEQ ID NO.2. The BnBR1 gene can improve the resistance of Brassica napus to black rot. By applying BnBR1 to Brassica napus breeding through genetic transformation or hybridization, the resistance of Brassica napus varieties to black rot can be effectively improved, thereby reducing the harm of black rot and achieving the purpose of increasing and stabilizing production. The present invention provides a new gene source for the excavation of black rot functional genes and molecular breeding, and has broad application prospects in enhancing the resistance of Brassica napus to black rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The following is a graph showing the GWAS results for black rot resistance in 357 natural populations of Brassica napus; A is the Manhattan plot of GWAS, with the significance threshold set at 0.05 / number of markers, and the sites indicated by arrows are significant association sites; B is the QQ plot of GWAS.

[0019] Figure 2 These are the results of disease resistance identification between the resistant parent “ZS9mXccR-1” and the susceptible parent ZS9. Mock is the negative control without pathogen inoculation, and Race 3 is the control inoculated with black rot fungus race 3.

[0020] Figure 3 This is the result diagram of gene colinearity between the disease-resistant parent "ZS9mXccR-1" and the susceptible parent ZS9 within the positioning interval.

[0021] Figure 4 This is the plasmid map of the pCAMBIA1301-BnBR1 overexpression vector.

[0022] Figure 5 PCR identification of transgenic Brassica napus plants carrying the BnBR1 gene; + is a positive control, - is a negative control, M is a marker, and 35S::BnBR1-T0 is a T0 generation Brassica napus plant carrying the BnBR1 gene.

[0023] Figure 6 This is a statistical chart showing the resistance of transgenic BnBR1 gene Brassica napus plants to black rot.

[0024] Figure 7 The leaf surface picture of the BnBR1-transgenic Brassica napus plants. BnBR1-1, BnBR1-8 and BnBR1-12 are the T1 generation positive plants of the BnBR1-transgenic Brassica napus plants.

[0025] Figure 8This is the verification of the BnBR1 gene molecular marker in Example 5. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0027] The disease-resistant parent Brassica napus "ZS9mXccR-1" in the embodiment of the present invention is a rapeseed variety recorded in the document "Yang, L., Zhao, C., Bai, Z., et al. Comparative transcriptome analysis of compatible and incompatible Brassica napus-Xanthomonas campestris interactions. Front Plant Sci. 2022, 13, 960874."

[0028] Example 1. Cloning and sequencing of the black rot resistance gene BnBR1

[0029] The young leaves of the disease-resistant parent Brassica napus "ZS9mXccR-1" were taken and genomic DNA was extracted using the 2% CTAB extraction method. Primers were designed based on the genomic sequence of the BnBR1 gene, and the genomic sequence of the BnBR1 gene is shown in SEQ ID NO.3:

[0030] SEQ ID NO.3:

[0031]

[0032] Forward primer: ATGCAGCTTCTTCGACTCCTT (SEQ ID NO. 4);

[0033] Reverse primer: TTAGTCTAACTTGATTCGACC (SEQ ID NO. 5).

[0034] PCR amplification was performed with 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme (Nanjing Novozyme Biotechnology Co., Ltd.). The 50μL amplification reaction system included: 2×Phanta Max Master Mix (Dye Plus), 25.0μL; ddH2O, 20μL; 10μM primer, 2μL; and 50ng DNA template. The amplification reaction was performed on a BioerPCR instrument, and the reaction program was: 94℃3min; 94℃15s, 55℃15s, 72℃30s, 32 cycles; 72℃5min. After the fragment was recovered by agarose gel electrophoresis, it was ligated with pEASY-T1 Sample Cloning Vector (Bao Ri Yi Yi Biological Technology Co., Ltd.). Take 10μL of the ligation product, transform Escherichia coli DH5α competent cells by heat shock method, add 800μL liquid LB medium, recover for 1h, apply it on LB plate with ampicillin antibiotics, and culture at 37℃ for 14h. White monoclonal colonies were selected, amplified and cultured in liquid LB medium containing ampicillin antibiotics, and sequenced. According to sequencing analysis, the gene was 2521 bp in length, had 1 intron and 2 exons, and its CDS was in segments 1-1286 bp and 1873-2521 bp, respectively, with a total length of 1935 bp.

[0035] The young leaves of the disease-resistant parent rapeseed "ZS9mXccR-1" were taken, and the total RNA of rapeseed was extracted with TriZol Reagent (Thermo Fisher Scientific), and 2.0 μg of total RNA was used for reverse transcription. The reverse transcription kit used was Hifair III 1stStrand cDNA Synthesis Kit (Yisheng Biotechnology Shanghai Co., Ltd.), and the steps of the reverse transcription reaction refer to the instructions for use of the kit. The cDNA synthesized by the reverse transcription reaction was used as a template, SEQ ID NO.4 was used as a forward primer, SEQ ID NO.5 was used as a reverse primer, and 2×Phanta Max MasterMix (Dye Plus) high-fidelity enzyme (Nanjing Novozyme Biotechnology Co., Ltd.) was used for PCR amplification. The 50 μL amplification reaction system included: 2×Phanta Max MasterMix (DyePlus), 25.0 μL; ddH2O, 20 μL; 10 μM primer, 2 μL; and 50 ng cDNA template. The amplification reaction was carried out on a BioerPCR instrument, and the reaction program was: 94℃3min; 94℃15s, 55℃15s, 72℃30s, 32 cycles; 72℃5min. PCR amplification obtained a fragment with a length of 1935bp. Sanger sequencing analysis showed that the sequence contained a complete CDS sequence, as shown in SEQ ID NO.1, and its encoded protein contained 645 amino acids, and the amino acid sequence was shown in SEQ ID NO.2.

[0036] SEQ ID NO.1:

[0037]

[0038] SEQ ID NO.2:

[0039] .

[0040] Example 2. Molecular markers of black rot resistance gene BnBR1

[0041] By comparing the BnBR1 genome sequence with the genome sequence of the allele in the susceptible material-ZS9, the results showed that there was a base in the intron region of BnBR1 that was different from that of the susceptible material. In the resistant parent "ZS9mXccR-1", the length of the amplified fragment of marker 590-2 was 345bp, and the 156th base was A; in the susceptible parent ZS9, the length of the amplified fragment of marker 590-2 was 344bp, and the 156th base was T. Therefore, this molecular marker is expressed as a SNP polymorphism at the 156th base of the amplified sequence.

[0042] The primers for amplifying this sequence are as follows:

[0043] Forward primer 590-2F: GGTCCACCATCCGAATATC (SEQ ID NO. 6);

[0044] Reverse primer 590-2R: AAGAGGAACACGCCAATC (SEQ ID NO. 7).

[0045] If the Brassica napus strain is resistant to black rot, the amplified fragment is shown in SEQ ID NO.8:

[0046] GGTCCACCATCCGAATATCGTACGGCTGAGAGCTTATTACTATGCAGAGGACGAGAGGCTTTTGATCACGGATTCATACCGTAATGGCAGCTTGTACTCTGCTTTACATGGTAATGGTTGTTAACTTCATCATTAGTTTAACCACTAATTACAATAATTATTCTTTTATTTTG TTGTTTTGCTTTTACCTTTATGAGGTTTGATTGAGATTGAGAGAAGAGACAAGATTAGGTTTATTTTGGGAGTTAGTGTTATTGATCGAGTTGATGGTTGGATCTATGTATATAAAGTTTTTGTCTTTGAGTATTTGTTTGATTCTATTGTTTTGATTGGCGTGTTCCTCTT;

[0047] If the Brassica napus plant is susceptible to black rot, the amplified fragment is shown in SEQ ID NO.9:

[0048] GGTCCACCATCCGAATATCGTACGGTTGAGAGCTTATTACTATGCAGAGGACGAGAGGCTTTTGATCACGGATTACGTTCGTAATGGCAGCTTGTACTCTGCTTTACATGGTAATGGTTGTTAACTTCATCATTAGTTTAACCACTAATTACAATTATTATTCTTTTTTTGTTGTTTTGCTTT.ACCTTTATGAGGTTTGATTGAGATTGAGAGAAGAGAC AAGATTTGGTTTATTTTGGGAGTTAGTGTTATTGATCGAGTTGATGGTTGGATCTAT GTATATAAAGTTTTTGTCTTTGAGTCTTTGTTTGATTGTATTGTATTGATTGGCGTG TTCCTCTT.

[0049] Amplification is performed using the DNA of a black rot resistant variety or breeding material of Brassica napus as a template. If a 345 bp amplified fragment can be amplified using primers 590-2F / 2R and the 156th base is A, it indicates the presence of BnBR1, a black rot resistant gene of Brassica napus. The SNP molecular marker provided by the present invention has a high efficiency in identifying the presence of the BnBR1 resistance gene, and can predict the black rot resistance of Brassica napus plants, thereby accelerating the breeding process of black rot resistant Brassica napus varieties.

[0050] Example 3. Construction of BnBR1 gene overexpression vector and genetic transformation

[0051] 1. Amplify the target gene

[0052] The CDS sequence of the BnBR1 gene was amplified according to the method in Example 1.

[0053] 2. Ligation and construction of pCAMBIA1301-BnBR1 recombinant vector

[0054] The pCAMBIA1301 vector was digested with NcoI-BglII to obtain a linearized pCAMBIA1301 vector. The recovered PCR amplification product was then combined with the linearized pCAMBIA1301 vector according to IIOne Step Cloning Kit (Nanjing Novozyme Biotechnology Co., Ltd.) was used for ligation, and the reaction conditions were 50°C, 30 min. After sequencing verification, the next step was carried out.

[0055] 3. Sequencing of positive clones

[0056] Primers were designed for the pCAMBIA1301-BnBR1 vector, the BnBR1 gene was amplified, and agarose gel electrophoresis PCR was performed to identify the correctness of the BnBR1 gene in the pCAMBIA1301-BnBR vector; the primer sequences of the primers designed for the pCAMBIA1301-BnBR1 vector were:

[0057] Forward primer: AGAACACGGGGGACTCTTGAC (SEQ ID NO. 10);

[0058] Reverse primer: GAGAAAAACTAGAAATTTACC (SEQ ID NO. 11).

[0059] DH5α competent cells were used for transformation identification, and the specific process was as follows: first, E. co1i DH5α competent cells were taken from a -80°C refrigerator, placed on ice, and placed in an ice bath for 20 minutes; then, 2 μL of plasmid was aspirated from a -20°C refrigerator, 50 uL of competent cells were added, mixed and transferred to a 1.5 mL EP tube, and placed in an ice bath for 30 minutes; the EP tube was heat-shocked at 42°C for 90 seconds, and then quickly transferred to an ice bath for 2 minutes; 950 μL of LB medium without antibiotics was added to the above EP tube, mixed and placed in a constant temperature shaker at 37°C, 220 rpm, and shaken and cultured for 1 hour to allow the bacteria to recover; 50 μL was spread on an LB solid medium containing kanamycin (100 Lg / mL) and incubated at 37 ℃ inverted culture for 16 hours and stored at 4℃; pick a single colony and transfer it to 5mL LB medium (containing kanamycin) and culture it at 37℃ and 220rpm for 16 hours; pick 3 colonies from each plate and inoculate them into LB medium containing 50ug / mL kanamycin respectively, and culture them at 37℃ for 16 hours; after the culture, extract the plasmid by alkaline lysis method and verify it by sequencing; the plasmid with correct sequencing is re-transformed into competent cells DH5α, and the plasmid is extracted with a high-purity plasmid midi extraction kit for use, which is the plasmid overexpressing the BnBR1 gene.

[0060] 4. Transformation of Brassica napus with pCAMBIA1301-BnBR1 recombinant vector

[0061] Transfer the pCAMBIA1301-BnBR1 recombinant vector into Agrobacterium GV3101. Pick a single clone for expansion and culture, perform PCR verification, add an equal volume of 50% glycerol, mix well, and store at -70°C for later use. Use the Agrobacterium GV3101-mediated genetic transformation method to introduce the pCAMBIA1301-BnBR1 recombinant vector into the black rot susceptible variety ZS9. The specific method is as follows: After disinfecting the ZS9 seeds, inoculate them in germination culture bottles and culture them in the dark at 23°C for 5 days; cut the hypocotyls of the rapeseed seedlings into 0.4-0.6 cm segments, inoculate them in the preculture medium, and culture them in the light at 23°C for 2 days; pick Agrobacterium in the infection solution and prepare the OD 600 =0.2 Agrobacterium resuspension, inoculate the explants in the Agrobacterium suspension for infection for 10 minutes; inoculate the infected explants on sterile filter paper to dry, inoculate on co-culture medium, and culture in the dark at 23°C for 48-72 hours; inoculate the co-cultured explants on sterile culture medium, and culture under light at 23°C for 6 days; inoculate the sterilized explants on screening / differentiation medium, 30 explants per dish, culture under light at 23°C, change the plate every 15 days, inoculate the differentiated buds on rooting medium, and culture under light at 23°C until rooting.

[0062] Example 4. Verification of transgenic function of BnBR1 gene

[0063] After obtaining plants transformed with the BnBR1 gene overexpression vector, genomic DNA was extracted and amplified using BnBR1 gene-specific primers to obtain 14 positive transgenic plants ( Figure 5 ).

[0064] The BnBR1 gene-specific primers are as follows:

[0065] Forward primer 590-1F: TCCGTCGTGATCGGAGTAGT (SEQ ID NO. 12);

[0066] Reverse primer 590-1R: TCCGGTGAGCTTTGAGTAGC (SEQ ID NO. 13).

[0067] After the T1 generation seeds were harvested by self-pollination of bagged positive transgenic plants, the BnBR1 gene-specific primers were used to identify the T1 generation positive plants, and the leaf cutting inoculation method was used for disease resistance identification: when the seedlings grew to the four-leaf stage, they were inoculated with black rot fungi. The inoculation method was to first immerse the scissors in the suspension of black rot fungi for 2 seconds, and then use the scissors to cut a wound of about 2 cm at the tip of the fully expanded leaf in the direction perpendicular to the main vein. Dip the bacterial solution once after each cut, and inoculate sterile water as a control. Keep the seedlings moisturized before and after inoculation. The length of the "V"-shaped lesions was measured on the 8th day of inoculation. The average value after removing the extreme value of the lesion length was used as the disease resistance phenotype. The transgenic positive lines BnBR1-1, BnBR1-8 and BnBR1-12 were identified and statistically analyzed for black rot resistance. The results are as follows Figure 6 and Figure 7 As shown, the resistance of the three transgenic lines was significantly higher than that of the susceptible parent ZS9 ( Figure 6 ), confirming that the BnBR1 gene has the function of resisting black rot. Therefore, the black rot resistance gene BnBR1 can be used in Brassica napus and also in Brassica napus seeds, and can be used to cultivate Brassica napus varieties with black rot resistance.

[0068] Example 5. Verification of BnBR1 gene molecular markers

[0069] Materials: black rot-resistant parent "ZS9mXccR-1" (containing black rot-resistant gene BnBR1), black rot-susceptible Brassica napus varieties ZS9, ZS11, Westar, Mendel, and ZY821.

[0070] The primers for molecular markers are 590-2F and 590-2R.

[0071] Methods: Genomic DNA of Brassica napus samples was extracted by CTAB extraction. Sample DNA was amplified using primers 590-2F / R. The 50μL reaction system included: 2×Phanta Max MasterMix (Dye Plus), 25.0μL; ddH2O, 20μL; 10μM primers, 2μL; and 50ng DNA template. The amplification reaction was carried out on a BioerPCR instrument, and the reaction program was: 94℃3min; 94℃15s, 55℃15s, 72℃30s, 32 cycles; 72℃5min. The amplified product was recovered by agarose gel electrophoresis and ligated with pEASY-T1Sample Cloning Vector (Bao Ri Yi Yi Biotechnology Co., Ltd.). 10μL of the ligation product was taken and transformed into Escherichia coli DH5α competent cells by heat shock method, and 800μL of liquid LB medium was added for 1h of recovery, and then applied to LB plates containing ampicillin antibiotics and cultured at 37℃ for 14h. White monoclonal colonies were selected, amplified and cultured in liquid LB medium containing ampicillin antibiotics, and sequenced. The results were as follows: Figure 8shown.

[0072] The results showed that the strains that could amplify the corresponding 345bp or 344bp fragment using the 590-2 molecular marker primer and whose 156th base was T were susceptible to black rot, while the strains that amplified the corresponding 345bp fragment and whose 156th base was A were resistant to black rot. The molecular marker method provided by the present invention can accurately screen out the black rot resistance gene BnBR1, thereby greatly improving the breeding efficiency.

[0073] As can be seen from the above embodiments, the present invention provides a Brassica napus black rot resistance gene BnBR1 and its application. The BnBR1 gene can improve the resistance of Brassica napus to black rot. By applying BnBR1 to Brassica napus breeding through genetic transformation or hybridization, the resistance of Brassica napus varieties to black rot can be effectively improved, thereby reducing the harm of black rot and achieving the purpose of increasing and stabilizing yield.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The black rot resistance gene BnBR1 of Brassica napus, characterized in that: The nucleotide sequence of BnBR1 is shown in SEQ ID NO.

1.

2. The protein encoded by the Brassica napus black rot resistance gene BnBR1 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A vector containing the Brassica napus black rot resistance gene BnBR1.

4. A cell containing the Brassica napus black rot resistance gene BnBR1.

5. Use of the Brassica napus black rot resistance gene BnBR1 according to claim 1 in the following (1) and / or (2): (1) Application in improving the resistance of Brassica napus to black rot; (2) Application in molecular breeding of Brassica napus for resistance to black rot.

6. A method for improving the resistance of Brassica napus to black rot, characterized in that: The method comprises overexpressing the rapeseed black rot resistance gene BnBR1 according to claim 1 in rapeseed.

7. A molecular marker for predicting or identifying resistance of Brassica napus to black rot, characterized in that: The molecular markers are the A / T polymorphism at the 156th position of the amplified fragment of the primer pair 590-2F / R and the polymorphism of the amplified length; if the amplified fragment length is 345bp and the 156th base is A, it is resistant to black rot; if the amplified fragment length is 344bp and the 156th base is T, it is susceptible to black rot. The nucleotide sequences of the primer pair 590-2F / R are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

8. A primer pair for amplifying the molecular marker according to claim 7, characterized in that: The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer 590-2F is shown in SEQ ID NO.6; the nucleotide sequence of the reverse primer 590-2R is shown in SEQ ID NO.

7.

9. Use of the molecular marker according to claim 7 in breeding black rot resistant Brassica napus.

10. Use of the primer pair according to claim 8 in breeding black rot-resistant Brassica napus.

Images