Application of Afa04Dg76000 gene in resistance of oat herbicide

Abstract

The invention discloses application of an Afa04Dg76000 gene in resistance of an oat herbicide. The Afa04Dg76000 gene is knocked down to reduce the resistance of the oat herbicide, and the Afa04Dg76000 gene is overexpressed to improve the resistance of the oat herbicide; the nucleotide sequence of the Afa04Dg76000 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the Afa04Dg76000 gene is as shown in SEQ ID NO. 2. According to the application of the Afa04Dg76000 gene in the herbicide resistance of the oats, a gene knock-down and overexpression strain of the Afa04Dg76000 is constructed through a TRV virus-mediated gene silencing (VIGS) system and a genetic transformation system of the oats, the herbicide resistance function of the Afa04Dg76000 is proved, and a new target is provided for germplasm improvement of cultivated oats.

Description

Technical Field

[0001] The invention relates to the technical field of oat herbicide resistance genes, in particular to application of Afa04Dg76000 gene in oat herbicide resistance. Background Art

[0002] Wild oats (A.fatua) are one of the most serious weeds facing many crops in the world. They are widely known for their adaptability to a variety of extreme environments, especially their strong resistance to herbicides. They can grow not only in different climate zones from tropical to polar circles, but also on almost all types of soil. At the same time, wild oats are also considered a valuable resource for the improvement of cultivated oats, which is of great significance to the molecular breeding and variety improvement of oats.

[0003] Herbicide resistance in weeds is a global problem that threatens crop production. Extensive use of herbicides has led to a continuous and rapid increase in herbicide resistance in weeds, crop yield losses and increased production costs. Previous studies have shown that glutathione S-transferases (GSTs), which can conjugate glutathione to herbicide molecules, make the herbicides non-toxic. Enhancing GST activity or increasing GST expression can enhance crop herbicide resistance. However, due to limited genetic information on weeds, enzymes and related mechanisms associated with herbicide resistance have rarely been identified and elucidated.

[0004] Therefore, exploring the herbicide resistance mechanism and determining the key sites for building the herbicide tolerance of this variety will help develop new herbicides and cultivate herbicide-resistant oats and other crops. Summary of the invention

[0005] To solve the above problems, the present invention provides the application of the Afa04Dg76000 gene in oat herbicide resistance, constructs the Afa04Dg76000 gene knockdown and overexpression strains through the TRV virus-mediated gene silencing (VIGS) system and the oat genetic transformation system, proves the herbicide resistance function of Afa04Dg76000, and provides a new target for the germplasm improvement of cultivated oats.

[0006] To achieve the above object, the present invention provides an application of the Afa04Dg76000 gene in oat herbicide resistance, wherein knocking down the Afa04Dg76000 gene reduces the oat herbicide resistance, and overexpressing the Afa04Dg76000 gene improves the oat herbicide resistance;

[0007] The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.2.

[0008] A plant expression vector contains the above-mentioned Afa04Dg76000 gene.

[0009] Preferably, the plant expression vector is a pCambia3300 vector containing the Afa04Dg76000 gene.

[0010] A TRV2-mediated gene silencing vector contains a target site of the Afa04Dg76000 gene.

[0011] A method for preparing transgenic oats is constructed using the above-mentioned plant expression vector.

[0012] Preferably, the method comprises the following steps:

[0013] S1. Cultivation of embryonic callus of oats;

[0014] S2, preparing Agrobacterium cells containing the plant expression vector, and using the Agrobacterium cells containing the plant expression vector to prepare an impregnation solution;

[0015] S3, using the impregnation solution in step S2 to impregnate the callus tissue in step S1, and screening the surviving callus tissue;

[0016] S4. The callus selected in step S3 is transferred to a regeneration medium. After the leaves grown on the regenerated callus are cultured to a length of 3 to 5 cm, they are transferred to a rooting medium for rooting culture.

[0017] An application of the Afa04Dg76000 gene as described above in cultivating new oat germplasm.

[0018] The application of the Afa04Dg76000 gene of the present invention in oat herbicide resistance has the following beneficial effects:

[0019] (1) The herbicide resistance of the Afa04Dg76000 gene was evaluated by constructing VIGS knockdown strains and overexpression transgenic oat strains. It was determined that overexpression of the gene could enhance the herbicide resistance of oats, while knockdown reduced the herbicide resistance.

[0020] (2) It provides a reference for genetic improvement of cultivated oats using genetic engineering technology and a new target for breeding new oat varieties with strong herbicide resistance.

[0021] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the nucleotide sequence of the Afa04Dg76000 gene;

[0023] Figure 2 is the amino acid sequence of the Afa04Dg76000 gene;

[0024] Figure 3 The herbicide resistance phenotype of the Afa04Dg76000 knockdown strain, wherein part a is the identification of the Afa04Dg76000VIGS (V-Afa04Dg76000) strain, and part b is the herbicide resistance phenotype detection of the Afa04Dg76000VIGS (V-Afa04Dg76000) strain;

[0025] Figure 4 This is the herbicide resistance phenotype of Afa04Dg76000 overexpressing transgenic oats, among which, part a is the screening of Afa04Dg76000 overexpressing transgenic positive seedlings, part b is the identification of Afa04Dg76000 overexpressing transgenic strains, and part c is the detection of herbicide resistance phenotype of Afa04Dg76000 overexpressing transgenic strains. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages disclosed in the embodiments of the present invention clearer, the embodiments of the present invention are further described in detail in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the embodiments of the present invention and are not intended to limit the embodiments of the present invention. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application. Examples of the embodiments are shown in the accompanying drawings, where the same or similar reference numerals throughout represent the same or similar elements or elements with the same or similar functions.

[0027] It should be noted that the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method, system, product or server that includes a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units that are not explicitly listed or inherent to these processes, methods, products or devices.

[0028] Like reference numerals and letters denote similar items in the following drawings, and thus, once an item is defined in one drawing, further definition and explanation thereof is not required in subsequent drawings.

[0029] Embodiment 1

[0030] The Afa04Dg76000 gene is a GST protein gene associated with herbicide resistance unique to wild oats. The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.1 and Figure 1As shown, the amino acid sequence is shown in SEQ ID NO.2 and Figure 2 shown.

[0031] (1) Construction of gene knockdown (VIGS) and overexpression vectors

[0032] ① The cDNA of wild oat W1004 was used as a template to amplify the VIGS target site. The primer sequence was: primer-F:cagtggtctctgtccagtcctCATCCAGGACTCCCTGAC;

[0033] primer-R:cggtctcagcagaccacaagtTTGCTGAAGCACAACCC.

[0034] The TRV2::Afa04Dg76000 vector was constructed by NC cloning. A. tumefaciens strain (GV3101) carrying pTRV1 vector and different pTRV2 derivative vectors (TRV2 (control), TRV2::Afa04Dg76000) were mixed in a 1:1 ratio (bacterial concentration was OD = 2.0), and acetosyringone (AS) (19.62 mg / L), cysteine ​​(Cys) (400 mg / L), and Tween20 (5 mL / L) were added. The bud tips of wild oats W1004 at the early germination stage were infected by vacuum infection, and the vacuum condition was 40 kPa.

[0035] Nucleotide sequence of VIGS target such as SEQ ID As shown in NO.3, it is: TTGCTGAAGCACAACCCCATCCACCGGAAGGTCTCGGTGCTCCTCCACGGCGACCGACCAGCCATCTGCGAGTCGCTGGTCACCGTCGAGTACGTCGACGAGGCCTTCGACGGGCCGC TCCTCCTCCCTTCCGACCCCATCGCCCGCGCGGCCGCTCGGTTCTGGGCCAGCTTCATGGATAAGCAGCTGAACTGCATCAATGATACACATACAGCACACATGAATTTTTCAGGGAGTCCTGGATG.

[0036] TRV2 vector is a commercially available product from Nixing Biological Company.

[0037] ② The target gene was amplified using the gDNA of wild oat W1004 as a template, and the pUBI::Afa04Dg76000-GFP overexpression vector was constructed by homologous recombination. The structure of the pUBI::Afa04Dg76000-GFP overexpression vector is as follows: Figure 4as shown

[0038] The nucleotide sequence of the gDNA is as shown in SEQ ID NO.4: ATGTCCGAACCGGCGGTGAAGCTCACCGAGGTGGCCCTGCGTCTCAAGGGAGTATCCTACGAGCTCATCGAAGAAGATCTCGGCAGCAAGAGTGACTTGTTGCTGAAGCACAACCCCATCCACCGGAAGGTCTCGGTGCTCCTCCACGGCGACCGACCAGCCATCTGCGAGTCGCTGGTCACCGTCGAGTACGTCGACGAGGCCTTCGACGGGCCGCTCCTCCTCCCTTCCGACCCCATCGCCCGCGCGGCCGCTCGGTTCTGGGCCAGCTTCATGGATAAGCAGCTGAACTGCATCAATGATACACATACAGCACACATGAATTTTGTTGGATCAGCTCAATAACCGATTGCAATTTTCCTTGACCTTTTTGCTGCATATATACGCAGGTCAGGGAGTCCTGGATGGCGCTGTGGACGGACGGCGAGGCACAGGCGGCGTCCGCGAGGGAGACGATGGCAAACCTGATGCTCATCGAGGGGCAGCTGCCGGAGGGGAAAAGGTTCTTTGGAGGCCAGGCCATCGGATACCTAGACATAGCCCTCGGCGGGATTGCGCAGTGGATGGAGGTGTTTCAGGACATCACCGGGGTGCCACTGCTAACAGAGGAGGAGCACCCTGCCTTGTGCCAGTGGGCGAGAGAGTACACGGCGAACGAGATCGTGAGGCAATGCCTGCCGGACAGGGACCGCCTGCTTGCTGCCTTGGCGCCGAGTAGGGACGTATTCGTGTCCATTGCCAACACAATTGCCGCACAAAAATAG。

[0039] The nucleotide sequence of the intron region therein is: GTTGGATCAGCTCAATAACCGATTGCAATTTTCCTTGACCTTTTTGCTGCATATATACGCAGG。

[0040] (2) The VIGS strain was obtained by vacuum infection of germinated shoots, and the Afa04Dg76000 overexpression transgenic strain was obtained based on the genetic transformation system of oats.

[0041] The method for establishing the Afa04Dg76000 overexpression transgenic strain includes:

[0042] S1. Cultivating callus tissue: Using L3-M medium (containing 4.6 g / L L3 basal salt of vitamins, 30 g / L maltose, 4 g / L plant gum, 2 mg / L 2,4-D, and 1 mg / L Dicamba) to culture mature embryos of the oat variety 'Bayou 18' until embryonic callus tissue is produced.

[0043] S2. Preparation of infection solution: Agrobacterium strain GV3101 containing pUBI::afa04dg76000 was cultured in YEP medium at 28°C overnight. After centrifugation, the precipitate was resuspended to OD = 0.5 with WLS solution (4.30 g LS basal salt, 100 μL 1000xMS, 10 g glucose, 0.5 g MES, H2O was added to 1 LPH = 5.8) and mixed with Agrobacterium strain GV3101 carrying pUBI::taWOX5 in equal proportions.

[0044] S3. Infecting callus: Soak the selected embryonic callus in a mixed Agrobacterium tumefaciens strain for 30 minutes. Remove the embryonic callus and absorb the residual bacterial liquid with filter paper. Place the embryonic callus on filter paper containing 75μmolAs and culture in the dark for 3 days. Then culture the embryonic callus on Wls-res medium for 5 days. Use WLS-P5 medium (wls-res medium containing 5mg / LBasta) to screen out the surviving callus.

[0045] S4. Callus regeneration: The callus was transferred to a regeneration medium (4.6 g L3 basal salt, 5 mg zeatin, 20 g sucrose, 0.5 g MES, 200 μL 12.5 g / L CuSO4·5H2O, 4 g plant gum, add H2O to 1 L, pH = 5.8), and the leaves grown on the regenerated callus were cultured to a length of 3 to 5 cm.

[0046] S5. Rooting culture: Rooting culture was carried out on a rooting medium with the formula of: 4.6 g L3 basal salt, 0.2 mg / mL IBA, 15 g sucrose, 0.5 g MES, 4 g vegetable gum, and H2O added to 1 L, pH = 5.8.

[0047] Finally, four Afa04Dg76000 overexpressing transgenic strains were obtained, namely Afa04Dg76000 OE-1, Afa04Dg76000 OE-2, Afa04Dg7 6000 OE-3, and Afa04Dg76000 OE-4.

[0048] (3) Use a small sprayer to spray 340 / hm 2 Fenoxac-butyl (Huaxing, GB / T22618-2008) was used to detect the herbicide resistance phenotype of VIGS strains and overexpression transgenic strains to verify the role of the Afa04Dg76000 gene in herbicide resistance in oats.

[0049] like Figure 3 As shown, part a is the identification of Afa04Dg76000VIGS (V-Afa04Dg76000) strain, and part b is the herbicide resistance phenotype detection of Afa04Dg76000 VIGS (V-Afa04Dg76000) strain.

[0050] Depend on Figure 3 As shown in part a, the expression of Afa04Dg76000 gene in the Afa04Dg76000VIGS (V-Afa04Dg76000) line was significantly reduced, indicating that the Afa04Dg76000 VIGS (V-Afa04Dg76000) line was successfully constructed.

[0051] Figure 3 As can be seen from part b, knocking down the expression level of Afa04Dg76000 resulted in a phenotype that was less resistant to herbicides.

[0052] like Figure 4 As shown, part a is the screening of Afa04Dg76000 overexpression transgenic positive seedlings, part b is the identification of Afa04Dg76000 overexpression transgenic strains, and part c is the herbicide resistance phenotype detection of Afa04Dg76000 overexpression transgenic strains.

[0053] Depend on Figure 4 As can be seen from part b, the expression of Afa04Dg76000 gene in Afa04Dg76000 OE-1, Afa04Dg76000 OE-2, Afa04Dg76000 OE-3, and Afa04Dg76000 OE-4 was significantly higher than that in the pUBI::GFP group (negative control group, in which empty vector and TRV2::Afa04Dg76000 vector were transferred to form a control), indicating that Afa04Dg76000 overexpression transgenic oats was successfully established.

[0054] Depend on Figure 4As can be seen from part c, the Afa04Dg76000 overexpressing transgenic oats showed a more herbicide-resistant phenotype compared with the pUBI::GFP group oats.

[0055] Therefore, the present invention evaluates the herbicide resistance of the Afa04Dg76000 gene by constructing VIGS knockdown strains and overexpression transgenic oat strains, and determines that its overexpression can enhance the resistance of oats to herbicides, and knockdown reduces the resistance to herbicides; this provides a reference for genetic improvement of cultivated oats using genetic engineering technology, and provides a new target for breeding new oat varieties with strong herbicide resistance.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of Afa04Dg76000 gene in herbicide resistance of oats, characterized by: Knockdown of the Afa04Dg76000 gene reduced herbicide resistance in oats, and overexpression of the Afa04Dg76000 gene increased herbicide resistance in oats; The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.

2.

2. A plant expression vector, characterized in that: The plant expression vector contains the Afa04Dg76000 gene described in claim 1.

3. A plant expression vector according to claim 2, characterized in that: The plant expression vector is pCambia3300 vector containing Afa04Dg76000 gene.

4. A TRV2-mediated gene silencing vector, characterized in that: The TRV2-mediated gene silencing vector contains the target site of the Afa04Dg76000 gene.

5. A method for preparing genetically modified oats, characterized in that: The plant expression vector is constructed using the plant expression vector described in claim 2 or 3.

6. The method for preparing transgenic oats according to claim 5, characterized in that: The steps include: S1. Cultivation of embryonic callus of oats; S2, preparing Agrobacterium cells containing the plant expression vector, and using the Agrobacterium cells containing the plant expression vector to prepare an impregnation solution; S3, using the impregnation solution in step S2 to impregnate the callus tissue in step S1, and screening the surviving callus tissue; S4. The callus selected in step S3 is transferred to a regeneration medium. After the leaves grown on the regenerated callus are cultured to a length of 3 to 5 cm, they are transferred to a rooting medium for rooting culture.

7. Use of the Afa04Dg76000 gene as claimed in claim 1 in cultivating new oat germplasm.

Images