Application of a passion fruit PeHSF1 gene in negatively regulating passion fruit drought resistance and salt tolerance

Abstract

The present invention provides a passion fruit PeHSF1 gene, and the nucleotide sequence thereof is shown in SEQ ID NO: 1. The present invention provides a passion fruit PeHSF1 gene cloned from passion fruit for the first time, and studies show that the gene can also significantly reduce the viability of yeast under drought stress and high salt stress, and under drought stress and high salt stress, the germination rate of transgenic PeHSF1 gene plants is significantly reduced, indicating that the PeHSF1 gene can significantly reduce the ability of plants to resist drought stress and high salt stress, and can inhibit plant growth, slow down plant growth, etc. The present invention provides a new candidate gene for research on yeast and plant stress resistance, regulation of plant growth, etc.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to an application of a passion fruit PeHSF1 gene in negatively regulating the drought resistance and salt tolerance of passion fruit. Background Art

[0002] Passion fruit is a perennial evergreen climbing woody vine. It is a fragrant and delicious fruit and is known as the "king of juice". It is also called passion fruit, Brazil nut, vine peach, heart lotus, western chrysanthemum, branch lotus, sour eggplant flower, and clock grass. Its natural original juice is bright in color, with a unique and rich aromatic flavor and rich nutrition. Passion fruit is not only of high nutritional value, but also has the effect of preventing diseases and keeping fit. According to measurements, passion fruit juice contains more than 60 volatile compounds, with a soluble solid content of up to 10-14%, and rich in organic acids, amino acids, vitamins and mineral elements. It can be used as a raw material to process into juice, fruit dew, jam, jelly and other products, which have the effects of beauty, heat relief, appetite, fatigue elimination, refreshing, anti-inflammatory and freckle removal, lipid and blood pressure reduction, and prevention of arteriosclerosis. As the application of passion fruit becomes more and more extensive, its molecular biology research has also continued to deepen and develop, and gene expression analysis has gradually been applied to reveal the mechanism of gene expression and regulation of passion fruit. Therefore, the localization, cloning, and function of genes for important traits in Passiflora are of great significance to the comprehensive development and utilization of Passiflora, and have a positive role in promoting the improvement of Passiflora's resistance to abiotic stresses and the research on the regulation function of plant development. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of a passion fruit PeHSF1 gene in negatively regulating the drought resistance and salt tolerance of passion fruit.

[0004] The first aspect of the present invention is to provide a passion fruit PeHSF1 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0005] The second aspect of the present invention is to provide a protein encoded by the Passiflora PeHSF1 gene of the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the passion fruit PeHSF1 gene coding region described in the first aspect of the present invention.

[0007] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector adopts pMD 19-T vector, pCAMBIA1304 expression vector and pYES 2 expression vector, but it should be understood that the present invention can also use other plasmids, or viruses, etc.

[0008] Preferably, the original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the coding region of the passion fruit PeHSF1 gene is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

[0009] Preferably, the original vector of the recombinant vector is a pYES 2 expression vector, and the coding region of the passion fruit PeHSF1 gene is located between two restriction endonuclease sites, HinIII and BamHI, of the pYES 2 expression vector.

[0010] The fourth aspect of the present invention is to provide a host bacteria containing the passion fruit PeHSF1 gene coding region described in the first aspect.

[0011] The fifth aspect of the present invention is to provide an expression cassette containing the passion fruit PeHSF1 gene coding region described in the first aspect of the present invention.

[0012] The sixth aspect of the present invention is to provide the use of the passion fruit PeHSF1 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in reducing the drought resistance and / or salt resistance of yeast.

[0013] The seventh aspect of the present invention is to provide the use of the passion fruit PeHSF1 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in slowing plant growth.

[0014] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0015] The eighth aspect of the present invention is to provide the use of the passion fruit PeHSF1 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in reducing plant drought resistance and / or salt resistance.

[0016] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0017] The ninth aspect of the present invention is to provide the use of the passion fruit PeHSF1 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in reducing the germination rate of plants under drought stress and / or high salt stress.

[0018] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0019] The tenth aspect of the present invention is to provide a primer pair, wherein the primer pair is F': ATGAACCCCGAAGACAATAAG and R': TTATATATTCTTGGACGAAT; or the primer pair is F': CCATGGATGAACCCCGAAGACAATAAG and R': ACTAGTTATATTCTTGGACGAAT; or the primer pair is F': AAGCTTATGAACCCCGAAGACAATAAG and R': GGATCCTATATTCTTGGACGAAT.

[0020] The invention provides a passion flower PeHSF1 gene cloned from passion flower for the first time, and the gene is transformed into Arabidopsis. The results show that compared with the wild type, the PeHSF1 transgenic Arabidopsis grows slower and is smaller than the transgenic Arabidopsis of the same period. At the same time, under the growth conditions simulating drought and high salt stress, the germination rate of the transgenic Arabidopsis is lower than that of the wild type. It shows that the PeHSF1 gene can significantly reduce the ability of plants to resist drought stress and high salt stress, and can inhibit plant growth, slow down plant growth, etc. It is transformed into yeast, and the study shows that PeHSF1 inhibits the growth of yeast and can significantly reduce the survival ability of yeast under drought stress and high salt stress. The above results are combined to show that PeHSF1 may play a negative regulatory role in abiotic stress. The invention provides a new candidate gene for studying yeast and plant stress resistance, regulating plant growth, etc., and lays a foundation for the passion flower PeHSF1 gene in abiotic stress and plant development regulation function. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 These are the phenotypes of normal growth (control), drought stress, and high salt stress in transgenic PeHSF1 Arabidopsis, where L1 and L2 are transgenic PeHSF1 Arabidopsis.

[0022] Figure 2 The growth of PeHSF-1 transgenic yeast under drought stress.

[0023] Figure 3 The growth of PeHSF-1 transgenic yeast under high salt stress. DETAILED DESCRIPTION

[0024] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0025] Example 1: Cloning of the Passiflora edulis PeHSF1 gene

[0026] Total RNA was extracted from the seedlings of passion fruit, and the first chain of cDNA was obtained by reverse transcription. The first chain of cDNA was used as a template and the PCR primers shown in Table 2 were used to perform PCR amplification reaction. The reaction system is shown in Table 1. The PCR amplification program is: 95 °C pre-denaturation for 3 min, 95 °C for 40 s, 72 °C for 5 min, 35 cycles, and 72 °C inactivation for 10 min. The annealing temperature, time and primers for each gene are shown in Table 2. The amplified product was recovered and sequenced to obtain the nucleotide sequence of the passion fruit PeHSF1 gene as shown in SEQ ID NO: 1.

[0027] Table 1 PeHSF-1 PCR reaction system

[0028] Name of each component Usage cDNA 1µl Primer-F 1µl Primer-R 1µl 2×FastTaq Premix 12.5µl <![CDATA[H2O]]> 9.5µl Total volume 25µl

[0029] Table 2 PeHSF-1 full-length primers and PCR amplification procedures

[0030]

[0031] The obtained plasmid of pCAMBIA1304-PeHSF-1 expression vector was transferred into Agrobacterium GV3101 competent cells, and the Agrobacterium was spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After the colonies grew, PCR identification was performed, and the PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0032] Embodiment 2: PeHSF1 The impact of genes on plants

[0033] Transgenic Agrobacterium tumefaciens with PeHSF-1 gene

[0034] Total RNA in purple passion fruit seedlings is extracted, and reverse transcription is used to obtain the first cDNA chain. Using the first cDNA chain as a template, CCATGGATGAACCCCGAAGACAATAAG and ACTAGTTATATTCTTGGACGAAT as primers, PCR amplification reaction is performed, and the reaction system and reaction procedure are referred to Example 1 to obtain the PeHSF-1 full-length sequence with NcoI and SpeI restriction sites. The pCAMBIA1304 empty vector and the PeHSF-1 full-length sequence with added restriction sites are double-digested with NcoI and SpeI, and then the two fragments are connected, and the Escherichia coli competence is transformed, and it is coated in LB solid medium, and positive PCR detection is performed after a single bacterium is grown, and the pCAMBIA1304-PeHSF-1 expression vector is obtained.

[0035] 2. Transgenic Arabidopsis

[0036] Arabidopsis thaliana is planted in vermiculite as the substrate, the temperature is controlled at 21-23℃, the light duration is 8h per day during the vegetative growth period, the light duration is 16h per day during the reproductive growth period, the light intensity is 2000lx, and the relative humidity in the culture room is 70%-90%. When the seedlings grow true leaves, they can be transplanted and cultured until the seedlings grow new leaves, the flower mosses grow to 5-10cm, the side mosses are pulled out, and the Arabidopsis thaliana flowers are not fully opened for transformation.

[0037] The PeHSF-1 gene-transfected Agrobacterium bacterial solution was propagated using YEB medium and shaken to OD600≈1. The bacterial solution was centrifuged at 5000rpm for 10min, and the supernatant was discarded and resuspended in 50g / L sugar water to OD≈0.8. The Arabidopsis inflorescence in step 1 was completely immersed in the bacterial solution resuspended in sugar water for 1min. The infected Arabidopsis inflorescence was wrapped with plastic wrap and placed in a 0-light incubator for 12h, then cultured under normal light. After the fruit pods grew, the Arabidopsis T0 generation seeds were harvested.

[0038] The infected Arabidopsis was cultured normally until seeds were obtained. The seeds were soaked in 75% alcohol + 2.5% Tween 100 for 1 min, repeated three times, washed once with sterile water, and sown in MS solid medium with hygromycin (25µg / ml) after thorough sterilization. After vernalization in a refrigerator at 4°C for three days, positive plants were cultured normally to obtain positive plants. The planting and sowing process was repeated three times until transgenic Arabidopsis with stable inheritance was obtained.

[0039] 3. Phenotypic and drought and salt tolerance testing of transgenic Arabidopsis

[0040] Wild-type and transgenic Arabidopsis were sown in MS (control), MS+200 mg / L mannitol (simulated drought), and MS+150 mM NaCl (simulated high salt) culture media, respectively. After 8 days of growth, the phenotype was observed and the germination rate was calculated. A high germination rate indicates strong drought and salt resistance. Figure 1 As shown in the figure, the transgenic type grows slower than the wild type. Under drought stress, the germination rate of the wild type is 82%, while the germination rates of the transgenic plants L1 and L2 are 6% and 2%, respectively. Under high salt stress, the germination rate of the wild type is 81%, while the germination rates of the transgenic plants L1 and L2 are 15% and 12%, respectively. The results show that PeHSF1 transgenic Arabidopsis grows more slowly and is more sensitive to drought and high salt stress. It is speculated that this gene plays a negative regulatory role in plant drought and high salt stress.

[0041] Embodiment 4: PeHSF1 Functional verification of genes under drought stress in yeast

[0042] Total RNA was extracted from the seedlings of Passiflora edulis and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and AAGCTTATGAACCCCGAAGACAATAAG and GGATCCTATATTCTTGGACGAAT were used as primers to perform PCR amplification. The reaction system and reaction procedure were as described in Example 1 to obtain a cDNA with HinIII and BamHI restriction sites. PeHSF1 The full-length sequence was obtained by inserting the pYES2 empty vector and the PeHSF1 The full-length sequence was double-digested with HinIII and BamHI, and the two fragments were connected and transformed into competent E. coli. The competent cells were spread on LB solid medium, and a positive PCR test was performed after a single colony was grown to obtain pYES2- PeHSF1 Plasmid.

[0043] (1) Take 100 µl of INVSc1 competent cells melted on ice and add the pre-cooled target plasmids (pYES2 empty vector, pYES2- PeHSF1) 2 µg, pre-treated Carrier DNA 10 µl (place the Carrier DNA in a 95℃ water bath for 3 min and then quickly put it in ice for 1 min, treat twice), PEG / LiAc 500 µl and mix by pipetting several times, and bathe at 30℃ for 30 min (invert 6-8 times at 15 min to mix).

[0044] (2) Place the tube in a 42°C water bath for 15 min (invert 6-8 times at 7.5 min to mix).

[0045] (3) Centrifuge at 5000 rpm for 40 s and discard the supernatant. Resuspend the sample in 400 µl of ddH2O and centrifuge for 30 s and discard the supernatant.

[0046] (4) Resuspend in 50 µl ddH2O and apply to SD-U medium for plasmid screening. Incubate at 29°C for 48-96 h.

[0047] (5) Select bacteria and verify the successful transformation of competent yeast by colony PCR.

[0048] (6) The successfully transformed yeast was subjected to drought stress treatment and treated with 8M sorbitol for 6 h, 12 h, 24 h, 36 h, and 48 h. The treated yeast was diluted 10 -1 , 10 -2 Then take 3µl of each spot and culture it on SD-Ura solid plate at 29℃ until obvious colonies grow for observation. Figure 2 As shown ( Figure 2 1×, 10×, and 100× respectively represent diluting the bacterial solution by 1, 10, and 100 times. Under drought stress, the growth of the control was better than that of PeHSF1 ,illustrate PeHSF1 Can reduce the drought resistance of transgenic yeast.

[0049] (7) The successfully transformed yeast was subjected to high salt stress treatment with 5M NaCl for 12 h and 24 h. The treated yeast was diluted 10 -1 , 10 -2 , 10 -3 After the test, 3 μl of each sample was placed on a SD-Ura solid plate and cultured at 29°C until obvious colonies grew for observation. Figure 3 As shown ( Figure 3 1×, 10×, 100×, and 1000× respectively represent diluting the bacterial solution by 1, 10, 100, and 1000 times. Under high salt stress, the growth of the control was better than that of PeHSF1 ,illustrate PeHSF1 Can reduce the ability of transgenic yeast to resist salt stress.

[0050] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A passion fruit PeHSF1 gene, characterized in that Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the Passiflora edulis PeHSF1 gene as claimed in claim 1.

3. A recombinant vector or host bacteria or expression cassette containing the passion fruit PeHSF1 gene coding region of claim 1.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the passion fruit PeHSF1 gene coding region is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

5. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is a pYES 2 expression vector, and the passion fruit PeHSF1 gene coding region is located between two restriction endonuclease sites, HinIII and BamHI, of the pYES 2 expression vector.

6. Use of the passion fruit PeHSF1 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in reducing the drought resistance and / or salt resistance of yeast.

7. Use of the passion fruit PeHSF1 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in slowing the growth of plants, wherein the plant is Arabidopsis thaliana.

8. Use of the passion fruit PeHSF1 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in reducing plant drought resistance and / or salt resistance, wherein the plant is Arabidopsis thaliana.

9. Use of the passion fruit PeHSF1 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in reducing plant germination rate under drought stress and / or high salt stress, wherein the plant is Arabidopsis thaliana.

Images