Optimized citric acid production strain construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to an optimized citric acid production strain construction method and application thereof.The optimized citric acid production strain construction method comprises the steps that an endogenous active polypeptide is used for producing citric acid in microorganisms through fermentation, and the polypeptide is characterized in that the amino acid sequence is shown as any one of SEQ ID NO: 1 to SEQ ID NO: 4; or the amino acid sequence of the polypeptide has more than 98% of homology with the amino acid sequence of the polypeptide.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an optimized citric acid strain construction method and application thereof. Background Art

[0002] Citric acid is a very important organic acid, a natural preservative and food additive, widely used in industry, food and cosmetics. It is mainly produced by microbial fermentation, and its main production strains include yeast and Aspergillus niger. Aspergillus niger is the most competitive industrial strain in the citric acid industry. The global annual production of citric acid produced by Aspergillus niger reaches 2 million tons, with an output value of more than 2 billion US dollars, and it is increasing at an annual rate of 5%.

[0003] Due to the difficulty of genetic modification of Aspergillus niger, early research mainly focused on the optimization of fermentation process to improve the yield of Aspergillus niger, such as the continuous optimization of fermentation conditions such as carbon source, nitrogen source, pH, etc. In recent years, with the development of metabolic engineering and the continuous development of Aspergillus niger genetic manipulation tools, reports on increasing citric acid production through genetic engineering have also appeared one after another, and the targets of modification include increasing the supply of its substrate acetyl-CoA, increasing the efflux of citric acid, increasing respiratory chain regulation, etc. These genetic modifications have increased the yield of citric acid in Aspergillus niger to varying degrees. However, with the growing demand for citric acid in the global market, how to find new modification targets, construct efficient Aspergillus niger engineered strains to increase the yield of citric acid, and further reduce production costs are problems that need to be solved in this area. Summary of the invention

[0004] In order to overcome the deficiencies in the prior art, the present invention is based on the genome data mining of Aspergillus niger M202 strain, and found that the inactivation of four proteins can increase the production of citric acid in Aspergillus niger. Further analysis found that the coding genes of these four proteins belong to a gene cluster with unknown function, and the inactivation of this gene cluster can also promote the production of citric acid, significantly improving the acid production level of the strain; in addition, the activity of the citric acid transporter CexA in the production strain is enhanced, resulting in enhanced citric acid efflux, further increasing the production of citric acid. Therefore, the primary purpose of the present invention is to provide a use of an endogenous active polypeptide in the production of citric acid.

[0005] The purpose of the present invention is to provide a method for constructing a citric acid producing strain.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: In a first aspect of the present invention, a method for constructing an optimized citric acid production strain is provided, comprising fermenting citric acid in a microorganism using an endogenous active polypeptide, wherein the polypeptide is: (A) the amino acid sequence is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4; or (B) has more than 98% homology with the amino acid sequence of the polypeptide described in (A) and is derived from Aspergillus niger and has the same activity as the polypeptide described in (A).

[0007] Preferably, the amino acid sequence of the endogenous active polypeptide is shown in any one of SEQ ID NOs: 1-4.

[0008] In one aspect of the present invention, the activity of one endogenous active polypeptide in (A) or (B) is reduced or completely eliminated.

[0009] In one aspect of the present invention, the citric acid producing strain is modified: the citric acid producing strain 1) causes the activity of the endogenous active polypeptide to be weakened or completely removed, wherein the endogenous active polypeptide is (A) the amino acid sequence is shown in any one of SEQ ID NOs: 1-4; or (B) has an amino acid sequence homology of more than 98% with the polypeptide described in (A) and is derived from Aspergillus niger and has the same activity as the polypeptide described in (A); or, 2) Inactivating a gene cluster, wherein the gene cluster is: (A) the nucleotide sequence is shown in SEQ ID NO:5; or (B) has more than 98% homology with the nucleotide sequence of (A) and is derived from Aspergillus niger.

[0010] Preferably, the activity reduction or complete removal of the endogenous polypeptide can be achieved by one or a combination of the following methods: partial knockout or complete knockout of the polypeptide encoding gene; mutation of the encoding gene; changing the promoter, translation regulatory region or coding region codon of the encoding gene to weaken its transcription or translation; changing the coding gene sequence to weaken its mRNA stability or destabilize the structure of the encoded protein.

[0011] In a preferred embodiment, the gene coding sequence is subjected to frameshift mutation, missense mutation, deletion, start codon change, etc.

[0012] Further preferably, the activity of the endogenous active polypeptide in the citric acid-producing strain is weakened relative to that of the unmodified endogenous active polypeptide, which means that the transcription and expression of the encoding gene of the endogenous active polypeptide is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or completely disappears; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or completely disappears.

[0013] Furthermore, the activity of the citric acid transporter in the citric acid producing strain is enhanced. Preferably, the citric acid transporter is a polypeptide having an amino acid sequence as shown in SEQ ID NO:6.

[0014] Preferably, the citric acid producing strain includes but is not limited to any one of Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichoderma reesei, Ustilagomaydis or Myceliophthorathermophila strains, preferably Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae or Trichoderma reesei, most preferably Aspergillus niger.

[0015] In one aspect of the present invention, the method for constructing the optimized citric acid production strain comprises genetically modifying: 1) weakening or completely removing the activity of an endogenous active polypeptide, wherein the endogenous active polypeptide is (A) an amino acid sequence as shown in any one of SEQ ID NOs: 1-4; or (B) has an amino acid sequence homology of more than 98% with the polypeptide described in (A) and is derived from Aspergillus niger and has the same activity as the polypeptide described in (A); or, 2) Inactivating a gene cluster, wherein the gene cluster is: (A) the nucleotide sequence is shown in SEQ ID NO:5; or (B) has more than 98% homology with the nucleotide sequence of (A) and is derived from Aspergillus niger.

[0016] Preferably, the activity reduction or complete removal of the endogenous polypeptide can be achieved by one or a combination of the following methods: partial knockout or complete knockout of the polypeptide encoding gene; mutation of the encoding gene; changing the promoter, translation regulatory region or coding region codon of the encoding gene to weaken its transcription or translation; changing the coding gene sequence to weaken its mRNA stability or destabilize the structure of the encoded protein.

[0017] In a preferred embodiment, the gene coding sequence is subjected to frameshift mutation, missense mutation, deletion, start codon change, etc.

[0018] Further preferably, in the above-mentioned optimized citric acid-producing strain construction method, the weakening of the activity of endogenous active polypeptides in the citric acid-producing strain relative to the unmodified protein means that the transcription and expression of the coding gene of the endogenous active polypeptide is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or completely disappears; or the activity of the endogenous active polypeptide is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or completely disappears.

[0019] Furthermore, the activity of the citrate transporter in the citrate producing strain is enhanced.

[0020] Preferably, the citrate transporter is a polypeptide having an amino acid sequence as shown in SEQ ID NO:6.

[0021] Preferably, the citric acid producing strain includes but is not limited to any one of Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichoderma reesei, Ustilagomaydis or Myceliophthorathermophila strains, preferably Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae or Trichoderma reesei, most preferably Aspergillus niger.

[0022] In a specific embodiment of the present invention, the endogenous active polypeptide is an amino acid sequence as shown in any one of SEQ ID NOs: 1-4, or the nucleotide sequence of the gene cluster is as shown in SEQ ID NO: 5.

[0023] In a second aspect of the present invention, there is provided a use of a gene cluster in producing citric acid by microbial fermentation, wherein the gene cluster is: (A) the nucleotide sequence is shown in SEQ ID NO:5; or (B) has more than 98% homology with the nucleotide sequence of (A) and is derived from Aspergillus niger.

[0024] Preferably, the nucleotide sequence of the gene cluster is shown in SEQ ID NO:5.

[0025] Preferably, in the above use, the entire gene cluster in (A) or (B) is inactivated.

[0026] In one aspect of the present invention, the endogenous active polypeptide is an amino acid sequence as shown in any one of SEQ ID NOs: 1-4, or the nucleotide sequence of the gene cluster is as shown in SEQ ID NO:5.

[0027] In a third aspect of the present invention, a method for producing citric acid is provided, comprising: (1) culturing a citric acid-producing strain to produce citric acid; and (2) optionally isolating citric acid from step (1).

[0028] In a fourth aspect of the present invention, provided is the use of the citric acid producing strain obtained by the aforementioned optimized citric acid producing strain construction method in citric acid production.

[0029] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention is based on the genome data mining of Aspergillus niger M202 strain, and it is found that the inactivation of 4 proteins can improve the output of Aspergillus niger citric acid. Further analysis shows that the coding genes of these 4 proteins belong to a gene cluster with unknown function, and the inactivation of the gene cluster can also promote the production of citric acid, significantly improve the acid production level of the strain, and compared with the wild-type strain containing endogenous polypeptides, the citric acid output of the citric acid production strain can be increased to 30%. In addition, the activity of the citric acid transporter in the citric acid production strain is enhanced, resulting in the strengthening of citric acid efflux, further improving the output of citric acid, and the citric acid output increase range is between 3.43-3.57 times. Therefore, it can be used for microbial fermentation to produce citric acid in practice, and the production cost of citric acid can be further reduced, which has good industrial application prospects.

[0030] 2. The present invention has found through screening that the inactivation of a gene cluster with unknown function can increase the production of citric acid in the engineered strain, providing a new idea for the genetic modification of Aspergillus niger. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0032] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0033] The "gene cluster" used in the present invention specifically refers to a gene cluster derived from Aspergillus niger as shown in SEQ ID NO: 5, whose function is unknown. The four proteins in the gene cluster are a putative non-ribosomal peptide synthase (NRPS), a fatty acid synthesis-related protein (FAS), a putative polyketide synthase (PKS1), and a putative polyketide synthase (PKS2), which have the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0034] The "citrate transporter" used herein refers to an efflux protein capable of transporting intracellular citrate to the extracellular space.

[0035] For example, the citrate efflux protein of the present invention has the amino acid sequence of SEQ ID NO: 6, or a derivative protein or polypeptide formed by replacing, deleting or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 6 and still having the function of a citrate efflux protein.

[0036] The terms "polypeptide", "active polypeptide" and "protein" of the present invention are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other operation, such as conjugation with a labeling component).

[0037] The term "expression" of the present invention includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0038] The term "exogenous" used in the present invention refers to the inclusion of substances that did not originally exist in a system. For example, if a coding gene that did not originally exist in a strain is introduced into the strain through transformation, the gene is "exogenous" to the strain.

[0039] As used herein, the terms "unmodified," "wild type," "endogenous," and "naturally occurring" refer to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in the laboratory is naturally occurring.

[0040] The term "native state" as used herein refers to the activity of a polypeptide in an unmodified state in a microorganism, ie, the activity in the natural state.

[0041] In some embodiments, the wild-type strain in the present invention refers to a strain containing an endogenous polypeptide, the endogenous polypeptide is a polypeptide having an amino acid sequence as shown in any one of SEQ ID NO:1-SEQ ID NO:4, or a polypeptide having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with any one of SEQ ID NO:1-SEQ ID NO:4; or, the wild-type strain in the present invention refers to a strain containing a gene cluster, the gene cluster being: (A) a nucleotide sequence as shown in SEQ ID NO:5; or (B) having more than 98% homology with the nucleotide sequence described in (A) and derived from Aspergillus niger.

[0042] The "polynucleotide" mentioned in the present invention generally refers to polyribonucleotides and polydeoxyribonucleotides, which can be unmodified RNA or DNA or modified RNA or DNA.

[0043] Example 1 Construction of sgRNA expression plasmid for genes with unknown functions Based on the genome data mining of Aspergillus niger M202 strain (purchased from the strain resource library of Shanghai Institute of Microorganisms and Engineering Technology Co., Ltd., with public accession number M202), the present invention predicts the functions of four unknown genes, and predicts the protein shown in SEQ ID NO:1 as a non-ribosomal peptide synthase (NRPS), the protein shown in SEQ ID NO:2 as a fatty acid synthesis-related protein (FAS), the protein shown in SEQ ID NO:3 as a polyketide synthase (PKS1), and the protein shown in SEQ ID NO:4 as a polyketide synthase (PKS2). The specific amino acid sequences are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0044] Using SEQ ID NO: 5 of the genome of Aspergillus niger M202 as a template, upstream and downstream primers for constructing the sgRNA expression cassette were designed, and the 5SrRNA of Aspergillus niger itself was used as a promoter. The GoldenGate method was used to construct the expression plasmid of sgRNA.

[0045] The GoldenGate reaction product was transformed into Escherichia coli Trans-T1, and the corresponding recombinant plasmids were extracted. After restriction digestion and sequencing verification, the expression plasmids pNRPS-sgRNA1, pNRPS-sgRNA2, pFAS-sgRNA1, pFAS-sgRNA, pPKS1-sgRNA1, pPKS1-sgRNA2, pPKS2-sgRNA1, and pPKS2-sgRNA2 of each protein sgRNA were obtained. The specific primer sequences are shown in Table 1.

[0046] Table 1- Primers for construction of sgRNA expression plasmids

[0047] Example 2 Construction of gene-inactivated strains The Cas9 protein expression vector pCas9 (see Zhang L, et al. Microb Cell Fact. 2020Mar 24; 19(1):76), the sgRNA expression cassette fragment and the donor DNA fragment were co-transformed into the protoplast cells of Aspergillus niger M202 to construct strains with inactivated genes. The specific operations are as follows: (1) Preparation of sgRNA expression cassette fragment 5S-Fm (SEQ ID NO: 23: GGTTGGAGATTCCAGACTCAG) and sgRNA-Rm (SEQ ID NO: 24: AAAAAAGCACCGACTCGGTGCCAC) were used as primers, and the sgRNA expression plasmids constructed in Example 1 were used as templates for PCR amplification to obtain the sgRNA expression cassette fragments NRPS-sgRNA1 / NRPS-sgRNA2, FAS-sgRNA1 / FAS-sgRNA2, PKS1-sgRNA1 / PKS1-sgRNA2, and PKS2-sgRNA1 / PKS2-sgRNA2 used for each gene knockout. The PCR reaction system was 5×FastPfubuffer 10μL, 10mMdNTPs 1μL, upstream / downstream primers 2.5μL each, DNA template 0.5μL, FastPfu (TransGene) 1.5μL, and ultrapure water 32μL.

[0048] The PCR reaction conditions were: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 45 sec, 35 cycles; and finally 72°C extension for 10 min. The PCR product was purified and then subjected to PEG-mediated protoplast transformation.

[0049] (2) Preparation of donor DNA fragments The preparation of donor DNA fragments was completed by a one-step PCR method. Upstream and downstream primers containing four gene homology arms were designed, and PCR amplification was performed using plasmid pSilent-1 (see Nakayashiki H et al. Fungal Genet Biol. 2005; 42: 275–83) as a template to obtain donor DNA fragments for four gene knockouts, which were named MH-NRPS-sgRNA1 / NRPS-sgRNA2, MH-FAS-sgRNA1 / FAS-sgRNA2, MH-PKS1-sgRNA1 / PKS1-sgRNA2, and MH-PKS2-sgRNA1 / PKS2-sgRNA2. The PCR reaction system and reaction conditions were the same as above, and the relevant primer sequences are shown in Table 2.

[0050] Table 2 - Primers used for donor DNA preparation

[0051] 3) PEG-mediated protoplast transformation The preparation of Aspergillus niger M202 protoplast suspension refers to patent CN112250740A. Take 100 μL of protoplast suspension, 2 μg of pCas9, 2 μg of sgRNA expression cassette fragment and 2 μg of donor DNA, add 1 mL of solution C (Tris-HCl 10 mM, CaCl 2 5.54g / L, PEG6000 50% (w / v), pH7.5) in an ice bath for 10 min, 2mL solution B and mix well. Mix well with the preheated upper medium MMSH containing hygromycin, and then spread on the lower medium MMSH plate. Incubate the plate in a 30℃ incubator for 3-5 days until transformants grow.

[0052] (4) Genotype verification of gene-inactivated strains The genomic DNA of the transformants after secondary subculture and purification was extracted using the Tiangen new plant genome extraction kit DP350. Then, the extracted genomic DNA was used as a template to perform gene PCR verification on the transformants using the genomic upper and lower verification primers of each gene. The specific sequences of the primers are shown in Table 3.

[0053] Table 3- Validation primers for each gene inactivated strain

[0054] The PCR reaction system and PCR reaction conditions were the same as above. The PCR amplification products were subjected to 1% agarose gel electrophoresis (150V voltage, 20 minutes), the gene amplification bands were observed under the gel imaging system, and each PCR product was sequenced and verified, and finally four strains with knockout genes encoding predicted proteins were obtained, which were named AnSM1, AnSM2, AnSM3 and AnSM4.

[0055] Example 3 Citric acid fermentation of gene-inactivated strains Each gene-inactivated strain AnSM1, AnSM2, AnSM3 and AnSM4 and the control strain M202 were inoculated on PDA medium and cultured at 30°C for 5 days, then spores were collected with 0.9% saline and counted using a hemocytometer. The inoculum was inoculated into citric acid fermentation medium (corn starch medium, total sugar content 12%) at an inoculum size of 106 / mL and cultured at 34°C, 250 r / min for 96 hours.

[0056] The fermentation supernatant was collected by rapid filtration, diluted 10 times, heated and boiled for 10 minutes, filtered through a filter membrane and tested for citric acid content by HPLC. The specific test conditions refer to patent CN112250740A. The results showed that the inactivation of each gene can significantly promote the production of citric acid. Compared with the control strain, the citric acid fermentation levels of AnSM1, AnSM2, AnSM3 and AnSM4 increased by 15-25%, 20-30%, 15-30% and 15-25%, respectively.

[0057] Example 4 Citric acid fermentation of a strain with inactivated whole gene cluster Further analysis of the above four genes revealed that they were all located in a gene cluster of unknown function. An09g01690 was the first gene in this gene cluster, and An09g01930 was the last gene in this gene cluster. The entire gene cluster was 67,885 bp in length and included 24 genes. Its nucleotide sequence is shown in SEQ ID NO:5.

[0058] The method of Examples 1 and 2 was used to construct a strain with the entire gene cluster inactivated. The pNRPS-sgRNA1 and pPKS2-sgRNA2 expression plasmids constructed in Example 1 were used as templates, and 5S-Fm and sgRNA-Rm in Example 2 were used as primers to amplify the sgRNA expression cassette fragment NRPS-sgRNA1 / PKS2-sgRNA2 of the entire gene cluster; MH-NRPS-sgRNA1-F and MH-PKS2-sgRNA2-R were used as primers, and plasmid pSilent-1 was used as a template to amplify the donor DNA fragment MH-NRPS-sgRNA1 / PKS2-sgRNA2 of the entire gene cluster; 2 μg pCas9, 2 μg sgRNA expression cassette fragments and 2 μg donor DNA were transformed into Aspergillus niger M202 using the method of Example 2, and NRPS-gF and PKS2-gR were used as primers to perform PCR verification on the transformants, and finally the engineered strain AnSMc with the entire gene cluster inactivated was obtained. The method of Example 3 was used to perform fermentation verification on the engineered strain AnSMc and the control strain M202. The results showed that the inactivation of the entire gene cluster could also significantly increase the yield of citric acid by 15-30%.

[0059] Example 5 Gene (cluster) inactivation and citric acid efflux enhancement to improve citric acid fermentation level The overexpression plasmid pGm-CexA (see patent CN112250740A) of citric acid efflux protein was transformed into Aspergillus niger strain M202 using the method of Example 2 to obtain the overexpression strain AnCex of citric acid efflux protein. Then, the methods of Examples 1 to 4 were used to knock out the four genes and the entire gene cluster in the citric acid high-yield strain AnCex, respectively, to obtain inactivated strains AnCSM1, AnCSM2, AnCSM3, AnCSM4 and AnCSMc. The above strains were fermented and verified using the method in Example 3, while the wild-type strain M202 was used as a control. It was found that the citric acid fermentation level of AnCSM1, AnCSM2, AnCSM3, AnCSM4 and AnCSMc can be increased to 3.43-3.57 times that of the control strain, indicating that on the basis of citric acid efflux enhancement, the inactivation of the unknown function gene cluster or the related proteins therein can further increase the yield of citric acid.

[0060] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for constructing an optimized citric acid production strain, characterized in that: The method comprises fermenting and producing citric acid in a microorganism using an endogenous active polypeptide, wherein the polypeptide is: (A) the amino acid sequence is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4; or (B) has more than 98% homology with the amino acid sequence of the polypeptide described in (A) and is derived from Aspergillus niger and has the same activity as the polypeptide described in (A).

2. The method for constructing an optimized citric acid producing strain according to claim 1, characterized in that: The citric acid producing strain was modified: 1) weakening or completely removing the activity of an endogenous active polypeptide, wherein the endogenous active polypeptide is (A) an amino acid sequence as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4; or (B) has an amino acid sequence homology of more than 98% with the polypeptide described in (A) and is derived from Aspergillus niger and has the same activity as the polypeptide described in (A); or, 2) Inactivating a gene cluster, wherein the gene cluster is: (A) the nucleotide sequence is shown in SEQ ID NO:5; or (B) has more than 98% homology with the nucleotide sequence of (A) and is derived from Aspergillus niger.

3. The method for constructing an optimized citric acid producing strain according to claim 2, characterized in that: The activity reduction or complete removal of the endogenous polypeptide can be achieved by one or a combination of the following methods: partial or complete knockout of the polypeptide encoding gene; mutation of the encoding gene; changing the promoter, translation regulatory region or coding region codon of the encoding gene to weaken its transcription or translation; changing the coding gene sequence to weaken the stability of its mRNA or destabilize the structure of the encoded protein.

4. The method for constructing an optimized citric acid producing strain according to claim 2, characterized in that: The activity of the citrate transporter in the citrate producing strain is enhanced; and the citrate transporter is a polypeptide having an amino acid sequence as shown in SEQ ID NO:

6.

5. The method for constructing an optimized citric acid producing strain according to claim 2, characterized in that: The citric acid producing strain is any one of Aspergilus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichoderma reesei, Ustilagomaydis or Myceliophthorathermophila strains.

6. Use of the citric acid producing strain obtained by the optimized citric acid producing strain construction method according to any one of claims 1 to 5 in citric acid production.

Images