Fluorescence sensor based on allosteric transcription factor and application of fluorescence sensor in lead ion detection

Abstract

The invention discloses a fluorescence sensor based on an allosteric transcription factor and application of the fluorescence sensor in lead ion detection, and belongs to the technical field of biochemistry. The invention adopts a fluorescence sensor based on an allosteric transcription factor. The fluorescence sensor comprises an identification element, a target, a transmission element, a light source and spectrum detection equipment, the identification element is aTF; the aTF is PbrR; the transmission element is an optical fiber; the optical fiber comprises an optical fiber probe; the surface of the optical fiber probe is modified with a PbrR-QD compound; the detection method has the advantages of one-step rapid detection, portability, simplicity, reusability and easiness in field quantification.

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry, and in particular to a fluorescent sensor based on an allosteric transcription factor and application thereof in lead ion detection. Background Art

[0002] At present, global environmental pollution is becoming more and more serious, causing great harm to human health. There are various types of pollution in the environment, such as heavy metals, antibiotics, microplastics, polyfluoroalkyl substances, nitrogen oxide pollution, etc. In the face of these problems, the detection of pollutants is necessary. Commonly used methods for detecting pollutants in the environment include liquid chromatography-mass spectrometry, high performance liquid chromatography, atomic absorption spectroscopy and electrical coupling, etc. However, the relevant methods require expensive instruments and complex operations, are time-consuming and costly, and are difficult to achieve on-site quantitative detection. Optical fiber is widely used as a carrier for environmental detection due to its small size and high detection accuracy. However, the detection steps of traditional immunofluorescence sensors usually include incubation, which takes a long time, greatly limiting the application of immunofiber fluorescence sensors in on-site detection. Constructing a sensor with one-step rapid detection, portability and simplicity, reusability and easy on-site quantification for pollutant detection has become a technical problem that needs to be solved at this stage. Summary of the invention

[0003] Based on the above technical problems to be solved by the present invention, the present invention proposes a fluorescent sensor based on allosteric transcription factors and its application in lead ion detection. The detection method has the advantages of one-step rapid detection, portability and simplicity, reusability and easy on-site quantification.

[0004] One of the purposes of the present invention is to provide a fluorescence sensor based on an allosteric transcription factor, the fluorescence sensor comprising a recognition element, a target, a transmission element, a light source and a spectrum detection device;

[0005] The recognition element is aTF;

[0006] The aTF is PbrR;

[0007] The transmission element is an optical fiber;

[0008] The optical fiber includes an optical fiber probe;

[0009] The surface of the optical fiber probe is modified with a PbrR-QD complex;

[0010] The PbrR sequence is shown in SEQ ID NO: 1;

[0011] The target DNA sequence is shown in SEQ ID NO: 2;

[0012] The light source is a fluorescent light source.

[0013] Further, the PbrR is connected to the optical fiber surface through DNA recognition;

[0014] The surface of the optical fiber probe is covalently modified with a PbrR-QD complex;

[0015] The optical fiber is a sensing optical fiber.

[0016] Further, the fluorescent light source includes one of ultraviolet light, high pressure mercury lamp, xenon lamp, metal halide lamp, LED light, and laser;

[0017] The sensing optical fiber is one of quartz glass optical fiber, silicon optical fiber and plastic optical fiber.

[0018] The second purpose of the present invention is to provide an application of a fluorescent sensor based on an allosteric transcription factor in lead ion detection.

[0019] Furthermore, the main steps of the lead ion detection include:

[0020] (1) Preparation of PbrR-QD complexes:

[0021] EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with PbrR and incubated in the dark at room temperature; free PbrR was removed and washed with ddH2O to obtain the PbrR-QD complex;

[0022] (2) Covalent modification of optical fiber surface:

[0023] The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30%-50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, taken out, ultrasonicated, and blown dry with nitrogen to form hydroxyl groups; the optical fiber probe part is placed in a mixture of APTES, isopropanol and ammonia water, stirred, and dried; the dried optical fiber probe part is placed in a glutaraldehyde solution, magnetically stirred, and washed with Tris-HCl to obtain an optical fiber probe with an aldehyde group introduced;

[0024] (3) DNA modification:

[0025] The fiber optic probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber optic probe and PbrR-QD complex was obtained, and then washed with ddH2O; and the surface of the fiber optic probe was observed.

[0026] Further, the fluorescent sensor PbrR can bind to or separate from the target DNA sequence, and when no target is present, the PbrR is connected to the optical fiber surface through DNA recognition;

[0027] The ultraviolet light activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum;

[0028] After the target is added, the PbrR binds to the target and changes its conformation, causing the PbrR-QD complex to dissociate from the fiber probe and the fluorescence intensity to decrease;

[0029] The lead ion concentration in the solution was detected by the change of fluorescence intensity.

[0030] Further, the optical fiber probe is connected to the spectrum detection device through a jumper and a rotary joint;

[0031] During detection, the optical fiber probe is inserted into a sample tube containing a sample, and then taken out to collect the fluorescence signal;

[0032] Record the changes in fluorescence spectrum and detect the lead ion concentration in the solution.

[0033] Further, the final concentrations of EDC, NHS and QD-COOH added to BBS buffer were 0.8 mg / ml to 1.6 mg / ml, 1.4 mg / ml to 2.2 mg / ml and 1.2 μM to 2.0 μM, respectively;

[0034] The free PbrR was removed by a 30 kDa ultrafiltration tube.

[0035] Further, the concentration of the HF solution is 20% to 40%;

[0036] The piranha solution is 98% H2SO4:30% H2O2 in a volume ratio of 3:1;

[0037] The APTES concentration is 2%;

[0038] The volume ratio of 2% APTES, isopropanol and ammonia water = 5:5:1;

[0039] The fiber optic probe was incubated in dsDNA-NH2 overnight at 37°C.

[0040] Furthermore, under the excitation of the fluorescent light source, a signal output is collected, and the signal value is ΔS (S1-S2).

[0041] Compared with the prior art, the present invention proposes a fluorescent sensor based on an allosteric transcription factor and its application in lead ion detection.

[0042] The present invention uses aTF-QD complex as a recognition element and optical fiber as a carrier to propose a method for Pb2+ and Pb 2+The sensor for detection realizes the development of one-step fluorescent biological on-site sensing, greatly shortening the detection time; the sensor has high selective sensitivity and repeatability, greatly reducing the cost; the fluorescent optical fiber sensing detection method based on allosteric transcription factors realizes the construction of an optical fiber sensor based on aTF for the first time. As a universal detection platform, it can detect other substances according to different aTF categories and characteristics, providing a reference for one-step on-site rapid detection by optical fiber sensing. The sensor and the corresponding detection method have the following beneficial effects:

[0043] 1. The fluorescent sensor proposed in the present invention uses aTF as the recognition element. Since aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, it realizes one-step rapid detection; the sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes.

[0044] 2. The present invention uses optical fiber as a carrier, covalently modifies PbrR-QD on the surface of the optical fiber, collects and transmits signals through the optical fiber, and outputs the signal data to a computer by a spectrometer. Since optical fiber has the characteristics of high sensitivity, strong anti-interference and fast transmission, and the spectrometer is small and easy to carry, it avoids complex and expensive instruments and equipment, and can achieve on-site quantification in complex environments with scarce resources.

[0045] 3. The sensor proposed in the present invention is reusable and can be reused after being treated. It can be soaked in 0.5% SDS for 5 minutes and prepared again. It can be reused at least 5 times without affecting its performance, which greatly reduces the cost.

[0046] 4. The detection method of the present invention can be mass-produced after the preliminary preparation of the optical fiber probe. Each optical fiber probe is equivalent to a sensor. In actual application, it is only necessary to add 1 ml of sample into a 1.5 ml ep tube and immerse the sensor probe into the test liquid to complete the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 A schematic diagram of a signal acquisition device according to an embodiment of the present invention is shown;

[0048] Figure 2 A typical signal spectrum diagram of an embodiment of the present invention is shown;

[0049] Figure 3 A linear relationship diagram of a PbrR-QD composite fluorescent optical fiber sensor in an embodiment of the present invention at 0.1nM to 500nM is shown;

[0050] Figure 4A selectivity characterization diagram of a PbrR-QD composite fluorescent optical fiber biosensor according to an embodiment of the present invention is shown, wherein (A) ΔS of the PbrR-QD optical fiber biosensor to various metal ions; (B) ΔS of the PbrR-QD optical fiber biosensor to mixed metal ions;

[0051] Figure 5 A repeatability characterization diagram of a PbrR-QD composite fluorescent optical fiber biosensor according to an embodiment of the present invention is shown. DETAILED DESCRIPTION

[0052] The exemplary embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0053] In the following examples, unless otherwise specified, the technical means adopted are conventional means well known to those skilled in the art, and the reagents and materials in the present invention are obtained from the market or other public channels.

[0054] The experimental materials and equipment involved in the present invention mainly include but are not limited to:

[0055] Reagents:

[0056] The raw materials of hydrogen peroxide (H2O2, 30%), concentrated sulfuric acid (H2SO4, 98%), isopropanol (C3H80, 99.7%), ammonia (NH3·H2O, 25%), and anhydrous ethanol (C2H5OH, 99.7%) were obtained from Shanghai Sinopharm Chemical Reagent Co., Ltd., China. Water-soluble CdSe / ZnS carboxylated quantum dots (QD-COOH, 8 μM in H2O), N-hydroxysuccinimide (NHS, 98%), and hydrofluoric acid (HF, 40%) were provided by Aladdin (Shanghai, China). (3-Aminopropyl)triethoxysilane (APTES, 99%) and glutaraldehyde (50% in H2O) were purchased from Macklin (Shanghai, China). Borate buffer solution (BBS, 0.05 mol / L, pH = 7.4) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were purchased from Yuanye (Shanghai, China) and Sangon Biotech (Shanghai, China), respectively. Phosphate buffer, protein (BSA) and Tris-HCl were purchased from Solarbio (Beijing, China), Beyotime Biotechnology (Shanghai, China) and Absin (Shanghai, Chain), respectively.

[0057] instrument:

[0058] Scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), fluorescence microscope (BX63, Obvious, Tokyo, Japan), optical microscope (DM500, Leica, Wetzlar, Germany), and spectrometer (Maya2000 Pro, Ocean Optics, Florida, USA).

[0059] The present invention discloses a fluorescent sensor based on allosteric transcription factor and its application in lead ion detection, which combines allosteric transcription factor (aTF) with optical fiber sensing to construct an aTF-quantum dot (QD) composite fluorescent optical fiber biosensor for Pb 2+ The prepared biosensor can detect Pb in 5 min. 2+ The quantitative detection of tetracycline was performed with a detection limit of 0.14 nM in the linear range of 0.1 to 500 nM. The biosensor was also found to have excellent selectivity and could be reused at least 5 times by regeneration. In actual samples, the recovery rate of tetracycline detection by the biosensor was 98.69% to 104.01%. Therefore, the prepared biosensor has the advantages of fast detection speed, high sensitivity and good selectivity.

[0060] The technical principle of the present invention mainly includes: based on allosteric transcription factors (aTFs) as a transcriptional regulatory protein that can specifically recognize targets. The PbrR-QD composite fluorescent optical fiber biosensor proposed by the present invention, under different conditions, PbrR can bind to or separate from a specific DNA sequence. When there is no target substance, PbrR is connected to the optical fiber surface through DNA recognition; UV activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum; after the target is added, PbrR binds to the target and changes its conformation, resulting in the dissociation of the PbrR-QD complex from the fiber probe and a decrease in fluorescence intensity.

[0061] Based on the above principle, the present invention proposes a fluorescent sensor based on an allosteric transcription factor and its application in lead ion detection, and the specific steps mainly include:

[0062] S1. Preparation of PbrR-QD complexes:

[0063] EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with PbrR and incubated in the dark at room temperature; the free PbrR was removed and washed with ddH2O, and the obtained PbrR-QD complex was stored at 4°C in the dark for future use.

[0064] S2, aTF sequence is as follows:

[0065] Table 1 Amino acid sequence of PbrR

[0066]

[0067] S3. Covalent modification of optical fiber surface:

[0068] The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30%-50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, the ultrasound is removed, and the probe is blown dry with nitrogen for standby use to form a hydroxyl group (-OH); the optical fiber probe probe part is inserted into a mixture of APTES, isopropanol and ammonia water, magnetically stirred, and dried; the dried optical fiber probe probe part is placed in a glutaraldehyde solution for treatment, magnetically stirred, and washed with Tris-HCl to introduce an aldehyde group (-CHO).

[0069] S4. DNA modification:

[0070] The fiber probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber probe was complexed with PbrR-QD and washed with ddH2O; the surface of the fiber probe was observed using a scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), UV light, and fluorescence microscope (BX63, Evident, Tokyo, Japan).

[0071] S5. The DNA sequences used in this work are as follows:

[0072] The PbrR binding DNA sequence (SEQ ID NO: 2) is:

[0073] tttttgtcttgactctatagtaactagagggtgttaaatcggcaa-5`NH2

[0074] ttgccgatttaacaccctctagttactatagagtcaagacaaaaa

[0075] The fluorescent sensor proposed in the present invention uses aTF as the recognition element. Since aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, it realizes one-step rapid detection. The sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes.

[0076] Example 1

[0077] The present invention provides a PbrR-QD composite fluorescent optical fiber biosensor.

[0078] Mainly include:

[0079] The PbrR-QD composite fluorescent optical fiber biosensor proposed in the present invention uses PbrR as a recognition element and optical fiber as a transmission element, and covalently modifies the PbrR-QD complex on the surface of the optical fiber probe to achieve specific detection of Pb2+.

[0080] The present invention constructs a signal acquisition device, adopts an ultraviolet 310nm LED as a light source, excites fluorescence on the surface of an optical fiber probe, and the optical fiber probe is connected to a Mayya 2000pro spectrometer (Maya2000 pro, Ocean Optics, Florida, American) through a jumper and a rotary joint; during detection, the optical fiber probe is inserted into a 1.5ml ep tube containing a sample for a period of time, and then taken out to collect fluorescence signals; and the fluorescence spectrum is displayed on a laptop computer for further analysis.

[0081] Results: See Figure 1 The PbrR-QD composite fluorescent optical fiber biosensor proposed in the present invention uses aTF (allosteric transcription factor) as the recognition element. aTF itself has the characteristics of high sensitivity and specificity to quickly recognize the target and dissociate from DNA, thus realizing one-step rapid detection. The sensor does not require a long and complicated reaction system and pretreatment process, and can achieve quantitative detection within 5 minutes. With optical fiber as a carrier, PbrR-QD is covalently modified on the surface of the optical fiber, and the signal is collected and transmitted through the optical fiber. Finally, the signal data is output to the computer by the spectrometer. Since the optical fiber has the characteristics of high sensitivity, strong anti-interference and rapid transmission, and the spectrometer is small and easy to carry, it avoids complex and expensive instruments and equipment, and can achieve on-site quantification in complex environments with scarce resources.

[0082] Example 2

[0083] The present invention provides a method for using a PbrR-QD composite fluorescent optical fiber biosensor for lead ion detection.

[0084] Mainly include:

[0085] The steps of using the PbrR-QD composite fluorescent optical fiber biosensor proposed in the present invention for lead ion detection include:

[0086] S1. Preparation of PbrR-QD complexes:

[0087] EDC, NHS and QD-COOH were added to 125 μl BBS buffer with final concentrations of 1.2 mg / ml, 1.8 mg / ml and 1.6 μM, respectively, and incubated in the dark at room temperature for 30 min; the activated quantum dots were mixed with 0.0043 mg / ml PbrR and incubated in the dark at room temperature for 2 h; free PbrR was removed with an ultrafiltration tube (30 kDa MWCO, Millipore), washed 3 times with ddH2O, and the obtained PbrR-QD complex was stored in the dark at 4°C for later use.

[0088] S2, aTF sequence is as follows:

[0089] Table 1 Amino acid sequence of PbrR

[0090]

[0091] S3. Covalent modification of optical fiber surface:

[0092] Remove the fiber coating and wipe it with alcohol; immerse the fiber probe part 5cm in 40% HF solution, treat the fiber probe surface with piranha solution (98% H2SO4:30% H2O2, 3:1 [V / V]) for 30min, take out 320W ultrasound for 10s, blow dry with nitrogen for use, and form hydroxyl (-OH); insert the fiber probe part into a mixture of 2% APTES, isopropanol and ammonia water (5:5:1 [V / V]) and stir magnetically at 250rpm for 2h. After stirring, dry at 60℃ for 2h. Insert the dried fiber probe part into 5% glutaraldehyde solution, stir magnetically at 250rpm for 2h, and wash it 3 times with Tris-HCl (0.3M, pH=8.0) to introduce aldehyde group (-CHO).

[0093] S4. DNA modification:

[0094] The fiber optic probe was incubated in dsDNA-NH2 at 37°C overnight; the remaining aldehyde sites were blocked with 0.01g / ml BSA solution for 1h; the DNA-modified fiber optic probe and PbrR-QD complex were incubated at 37°C for 30min and washed three times with ddH2O; the surface of the fiber optic probe was observed using a scanning electron microscope (SEM, Sigma 300, Zeiss, Oberkochen, Germany), 310nm ultraviolet light and a fluorescence microscope (BX63, Evident, Tokyo, Japan).

[0095] S5. The DNA sequences used in this work are as follows:

[0096] The PbrR binding DNA sequence is:

[0097] tttttgtcttgactctatagtaactagagggtgttaaatcggcaa-5`NH2

[0098] ttgccgatttaacaccctctagtttactatagagtcaagacaaaaa

[0099] S6. Detection of lead ions by PbrR-QD composite fluorescent fiber biosensor

[0100] An ultraviolet 310nm LED was used as the light source to excite fluorescence on the surface of the fiber optic probe, which was connected to a Mayya 2000pro spectrometer (Maya2000 pro, Ocean Optics, Florida, American) via a jumper and a rotary joint. During detection, the fiber optic probe was inserted into a 1.5ml ep tube containing the sample for a period of time and then taken out to collect the fluorescence signal. The fluorescence spectrum was displayed on a laptop computer for further analysis.

[0101] Results: See Figure 1 The PbrR-QD composite fluorescent optical fiber biosensor proposed in the present invention can be mass-produced after the preliminary preparation of the optical fiber probe; one optical fiber probe is a sensor; in actual application, only 1 ml of sample needs to be added to a 1.5 ml ep tube and the sensor probe can be immersed in the test liquid to complete the detection.

[0102] Example 3

[0103] The present invention proposes a parameter optimization experiment of a PbrR-QD composite fluorescent optical fiber biosensor.

[0104] Mainly include:

[0105] (1) Optimization of optical fiber probe:

[0106] Single-mode fiber probes and multi-mode fiber probes were analyzed. For HF corrosion time verification, different corrosion times (5min, 10min, 15min, 20min, 25min, 30min) were evaluated under the same conditions, and the subsequent preparation conditions were the same. Under the excitation of external light sources, the signal output was collected, and the signal value was ΔS (S1-S2). The typical signal spectrum is shown in Figure 2 shown.

[0107] (2) Determination of testing time:

[0108] The experiment used Pb 2+A series of concentrations (0.1nM, 1nM, 10nM, 100nM, 500nM) were set and inserted into a 1.5ml ep tube containing different concentrations of the target to be detected. Signals were collected every 5s within 5min, every 1min from 5-20min, and every 2min from 20-30min.

[0109] (3) Pb 2+ Acquisition of quantitative formula for detection:

[0110] After determining the detection time, based on the detection time experiment, ΔS and Pb 2+ The concentration ranged from 0.1nM to 500nM, showing a good linear relationship, and the linear equation was Y = 1245 × X + 1600 (R 2 =0.9709), where Y is ΔS and X is Pb 2+ The logarithm of the concentration.

[0111] Results: See Figure 2 , we can see the typical signal spectrum. In order to improve the detection efficiency, multimode optical fiber was selected, and it was determined that the transmission efficiency was best when the corrosion time was 15min. The aTF-QD composite fluorescent optical fiber biosensor had a good linear relationship in the range of 0.1 to 500nM. The sample can be detected in only 5 minutes in one incubation step, which greatly improved the detection efficiency, reduced the detection steps, shortened the detection time, and had good detection performance.

[0112] Example 4

[0113] The present invention proposes a performance and detection limit (LOD) determination experiment of a PbrR-QD composite fluorescent optical fiber biosensor.

[0114] Mainly include:

[0115] The present invention proposes the calculation of the detection limit (LOD) of the PbrR-QD composite fluorescent optical fiber biosensor. According to the classification of the US National Bureau of Standards, the detection limit is defined as 3 times the standard deviation of the blank, that is, 3α blank (or 3S blank), which is the average value of the background signal generated by the matrix blank plus 3 times the mean standard deviation, with the value of the background signal generated by the matrix blank without Pb 2+ Ultrapure water was used as a blank sample, and 10 tests were performed. The average value of ΔS obtained was added with 3 times the standard deviation of the mean and the Pb 2+ Calculate in the quantitative formula of detection, and obtain Pb according to the linear formula 2+ The LOD of the assay was 0.14 nM.

[0116] The present invention constructs a fluorescent optical fiber sensing system to measure Pb 2+The concentration gradient-induced ΔS was used to further investigate the performance and detection limit (LOD) of the PbrR-QD composite fluorescent fiber biosensor.

[0117] Results: See Figure 3 For the PbrR-QD composite fluorescent optical fiber biosensor of the present invention, there is a good linear relationship in the range of 0.1nM-500nM. The detection process can be completed by directly incubating with the sample for 5min, and one-step detection can be achieved without other incubation processes. It has great potential in qualitative detection and is effective for Pb 2+ The detection limit is as low as 0.14nM. Therefore, a lower detection limit can fully meet the needs of detection. Under similar LOD conditions, the fiber optic probe significantly shortens the detection time. In traditional immunofiber optic sensors, whether sandwich or competitive methods are used, the detection process involves a series of incubation processes that take at least 1 hour. However, the aTF-QD composite fluorescent fiber optic biosensor can detect samples in just 5 minutes in one incubation step.

[0118] Example 5

[0119] The present invention proposes a selectivity experiment of a PbrR-QD composite fluorescent optical fiber biosensor.

[0120] Mainly include:

[0121] The present invention adopts 5 kinds of common metal ions (Cd 2+ , Hg 2+ 、Ni 2+ 、As 3+ , Cu 2+ ) As potential interferents, the concentration of antibiotics in ddH2O was 10 nM.

[0122] Using ddH2O as a control, different types of 10nM metal ions were detected by the sensor for 5min. Three groups of experiments were performed and the test results were observed. 2+ In the presence of metal ions, Pb 2+ Mixed solutions with other types of metal ions were prepared with a concentration of 10 nM. ddH2O was used as a control. The mixed solutions of different types of metal ions were detected by the sensor respectively. The detection time was 5 minutes. Three groups of experiments were carried out and the detection results were observed.

[0123] Results: See Figure 4 (A) and Figure 4 (B). Figure 4 (A) shows that only Pb 2+ A clear signal was generated, indicating that the sensor Pb2+ It has good selectivity. In addition, Pb 2+ It is also recognized by the biosensor in the presence of metal ions ( Figure 4 (B)), indicating that the PbrR-QD composite fluorescent fiber biosensor has high selectivity for target detection.

[0124] Example 6

[0125] The present invention proposes a repeatability experiment of a PbrR-QD composite fluorescent optical fiber biosensor.

[0126] Mainly include:

[0127] The fiber probe of the fiber probe used in the detection of the present invention was immersed in 0.5% SDS for 5 minutes to remove the residual PbrR-QD complex, and then washed with PBS for 3 times; incubated with PbrR-QD at 37°C for 30 minutes to couple the PbrR-QD complex with the DNA fixed in the fiber probe; and the regeneration process was run for 5 cycles. In order to evaluate the detection performance of the regenerated fiber probe, the present invention tested different concentrations of Pb 2+ (0.1nM, 1nM, 10nM, 100nM, 500nM) and compared with the performance of the new fiber optic probe.

[0128] Results: See Figure 5 After SDS treatment, the fluorescence intensity of the PbrR-QD fiber biosensor dropped below 2500. After incubation with fresh PbrR-QD, the fluorescence intensity increased to 8000-10000. Moreover, even after 5 cycles of regeneration, the fluorescence intensity was very stable and had good repeatability. This shows that the PbrR-QD composite fluorescent fiber biosensor proposed in the present invention is reusable and can be reused after treatment; it can be reused at least 5 times without affecting its performance after soaking in 0.5% SDS for 5 minutes and then prepared again, which greatly reduces the cost.

[0129] Comparative Example

[0130] The present invention proposes a method for using a PbrR-QD composite fluorescent optical fiber biosensor for lead ion detection and compares it with other main methods in the prior art.

[0131] Mainly include:

[0132] The detection performance of the PbrR-QD biosensor was verified in real river water samples. 2+ The effect of dissolving 10, 100 and 250 nM Pb in river water 2+The recovery of spiked samples was tested and compared with the standard atomic absorption spectrometry (AAS).

[0133] result:

[0134] As shown in Table 2, the recovery rate of the PbrR-QD composite optical fiber biosensor is 98.69% to 104.01%, and the relative standard deviation (RSD) is 3.7% to 10.2%. The detection accuracy of the PbrR-QD composite optical fiber biosensor is comparable to that of the standard Pb 2+ The detection accuracy of the detection methods is basically the same. The results show that the aTF-QD fiber biosensor has excellent detection ability and performs well in water samples.

[0135] Table 2 Detection accuracy of PbrR-QD composite optical fiber biosensors of different samples

[0136]

[0137] It should be noted that the term "comprises" or any other variation thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only these elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprises..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0138] The above are only embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included within the scope of the claims of the present application.

Claims

1. A fluorescent sensor based on an allosteric transcription factor, characterized in that: The fluorescence sensor includes a recognition element, a target, a transmission element, a light source and a spectrum detection device; The recognition element is aTF; the aTF is PbrR; The transmission element is an optical fiber; the optical fiber includes an optical fiber probe; The surface of the optical fiber probe is modified with a PbrR-QD complex; The PbrR sequence is shown in SEQ ID NO: 1; The target DNA sequence is shown in SEQ ID NO: 2; The light source is a fluorescent light source.

2. The fluorescent sensor based on the allosteric transcription factor according to claim 1, characterized in that: The PbrR is attached to the optical fiber surface through DNA recognition; The surface of the optical fiber probe is covalently modified with a PbrR-QD complex; The optical fiber is a sensing optical fiber.

3. The fluorescent sensor based on the allosteric transcription factor according to claim 1, characterized in that: The fluorescent light source includes one of ultraviolet light, high pressure mercury lamp, xenon lamp, metal halide lamp, LED light and laser; The sensing optical fiber is one of quartz glass optical fiber, silicon optical fiber and plastic optical fiber.

4. Application of fluorescent sensor based on allosteric transcription factor in lead ion detection, characterized in that: The fluorescent sensor is the fluorescent sensor based on the allosteric transcription factor according to any one of claims 1 to 3.

5. The use of the fluorescent sensor based on allosteric transcription factors in lead ion detection according to claim 4, characterized in that: The method for lead ion detection comprises: (1) Preparation of PbrR-QD complexes: EDC, NHS and QD-COOH were added to BBS buffer respectively and incubated in the dark at room temperature; the activated quantum dots were mixed with PbrR and incubated in the dark at room temperature; free PbrR was removed and washed with ddH2O to obtain the PbrR-QD complex; (2) Covalent modification of optical fiber surface: The optical fiber coating is removed and wiped with alcohol; the optical fiber probe part is immersed in a 30% to 50% HF solution, the surface of the optical fiber probe is treated with a piranha solution, taken out, ultrasonicated, and blown dry with nitrogen to form hydroxyl groups; the optical fiber probe part is placed in a mixture of APTES, isopropanol and ammonia water, stirred, and dried; the dried optical fiber probe part is placed in a glutaraldehyde solution, magnetically stirred, and washed with Tris-HCl to obtain an optical fiber probe with an aldehyde group introduced; (3) DNA modification: The fiber optic probe was incubated in dsDNA-NH2 overnight; the remaining aldehyde sites were blocked with BSA solution; the DNA-modified fiber optic probe and PbrR-QD complex was obtained, and then washed with ddH2O; and the surface of the fiber optic probe was observed.

6. The use of the fluorescent sensor based on the allosteric transcription factor in lead ion detection according to claim 5, characterized in that: The fluorescent sensor PbrR can bind to or separate from the target DNA sequence. When no target is present, the PbrR is connected to the optical fiber surface through DNA recognition; The ultraviolet light activates QD fluorescence, and the optical fiber collects and analyzes the fluorescence signal, at which time the fluorescence intensity is the maximum; After the target is added, the PbrR binds to the target and changes its conformation, causing the PbrR-QD complex to dissociate from the fiber probe and the fluorescence intensity to decrease; The lead ion concentration in the solution was detected by the change of fluorescence intensity.

7. The use of the fluorescent sensor based on allosteric transcription factors in lead ion detection according to claim 5, characterized in that: The optical fiber probe is connected to the spectrum detection device through a jumper and a rotary joint; During detection, the optical fiber probe is inserted into a sample tube containing a sample, and then taken out to collect the fluorescence signal; Record the changes in fluorescence spectrum and detect the lead ion concentration in the solution.

8. The use of the fluorescent sensor based on allosteric transcription factors in lead ion detection according to claim 5, characterized in that: The final concentrations of EDC, NHS and QD-COOH added to the BBS buffer were 0.8 mg / ml to 1.6 mg / ml, 1.4 mg / ml to 2.2 mg / ml and 1.2 μM to 2.0 μM, respectively; The free PbrR was removed by a 30 kDa ultrafiltration tube.

9. The use of the fluorescent sensor based on allosteric transcription factors in lead ion detection according to claim 5, characterized in that: The concentration of the HF solution is 20% to 40%; The piranha solution is 98% H2SO4:30% H2O2 in a volume ratio of 3:1; The APTES concentration is 2%; The volume ratio of 2% APTES, isopropanol and ammonia water = 5:5:1; The fiber optic probe was incubated in dsDNA-NH2 overnight at 37°C.

10. The use of the fluorescent sensor based on allosteric transcription factors in lead ion detection according to claim 5, characterized in that: Under the excitation of the fluorescent light source, the signal output is collected, and the signal value is ΔS (S1-S2).

Images