Recombinant human metallothionein and preparation method thereof

Abstract

The invention provides recombinant human metallothionein and a preparation method thereof. The recombinant human metallothionein comprises nucleic acid sequences corresponding to human Ia type and II-IV type metallothionein as shown in SEQ ID NO: 1-4. The invention further provides an expression element containing the human Ia type metallothionein gene and the human II-IV type metallothionein gene. The invention relates to a method for preparing human metallothionein, which comprises the following steps of: transferring an expression element for expressing metallothionein into yeast cells by means of genetic engineering, and culturing the yeast cells to obtain the human metallothionein. The saccharomyces cerevisiae is selected as a chassis cell for heterologous expression of the human metallothionein, and the human metallothionein is optimized according to codon preference of the saccharomyces cerevisiae, so that the transcription efficiency of the human metallothionein in the saccharomyces cerevisiae is improved; in addition, the human Ia-IV type metallothionein modified by the eukaryotic expression system is successfully expressed and obtained, and a basis is provided for further research and application of the human metallothionein.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant human metallothionein and a preparation method thereof. Background Art

[0002] Metallothionein (MT) is a type of low molecular weight, Cys-rich metal-binding protein found in animals, plants and microorganisms. It has the functions of scavenging free radicals, detoxifying heavy metals, resisting endoplasmic reticulum stress, protecting against radiation, controlling cell metabolism, and enhancing immunity. It has broad application prospects in medicine, food, biological testing, aquaculture, health products, cosmetics, etc. However, the problem of its production source has not been solved, the output is low, and the price is expensive.

[0003] At present, there are three ways to obtain exogenous MT: one is to extract it from animal tissues, but the method of raising animals has problems such as high cost, long animal growth cycle, complicated separation and purification, and low yield; the second is to purify it from plants, but its source is limited, the extraction is difficult, the yield is low and the purity is not high; the third is to use genetic engineering technology to clone the MT gene into hosts such as Escherichia coli or lactic acid bacteria for fermentation and purification. Compared with the first two methods, the MT obtained by the third method has high purity, good product uniformity, and more stable performance. For example, in the prior art: a human metallothionein-2a fusion protein expression vector disclosed in patent document CN105483150A uses an Escherichia coli expression system to express human metallothionein; another example: a ramie metallothionein gene and its recombinant protein and application disclosed in patent document CN107699578A use Escherichia coli to express ramie metallothionein. However, prokaryotic expression of human MT is very easy to form inclusion bodies, and there are very few reports on the mass production of soluble human MT.

[0004] The source of MT raw materials has become one of the bottlenecks restricting the development of this field, thus limiting its application and research. Using genetic recombination technology to mass produce MT is a hot research direction to solve the bottleneck of its source limitation. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a recombinant human metallothionein and a preparation method thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: A recombinant human metallothionein, wherein the human metallothionein is expressed by a yeast expression system; the metallothionein includes human type Ia metallothionein, human type II metallothionein, human type III metallothionein, and human type IV metallothionein.

[0007] Preferably, the nucleic acid sequence corresponding to the human type Ia metallothionein is shown in SEQ ID NO: 1; the nucleic acid sequence corresponding to the human type II metallothionein is shown in SEQ ID NO: 2; the nucleic acid sequence corresponding to the human type III metallothionein is shown in SEQ ID NO: 3; and the nucleic acid sequence corresponding to the human type IV metallothionein is shown in SEQ ID NO: 4.

[0008] An expression element for expressing human metallothionein, characterized in that the expression element comprises: a promoter, a His tag, a Flag tag, a human metallothionein gene and a terminator.

[0009] Optionally, the expression element further comprises a signal peptide.

[0010] The promoter is ADH1 promoter, the terminator is ADH1 terminator, the His tag is 6His tag, and the Flag tag is 5Flag tag.

[0011] Optionally, in the above expression element, the 6His tag and the 5Flag tag are fused to the N-terminus of the protein corresponding to the human metallothionein gene.

[0012] A yeast cell expressing human metallothionein, wherein the yeast cell contains any one of the above expression elements.

[0013] A method for preparing human metallothionein comprises transferring an expression element for expressing metallothionein into yeast cells by means of genetic engineering, and obtaining the human metallothionein by culturing the yeast cells.

[0014] Optionally, the expression element for expressing metallothionein is transferred into yeast cells by means of genetic engineering, which is to integrate the expression element for expressing metallothionein into the genome of yeast cells by utilizing the homologous recombination mechanism of yeast cells themselves. Preferably, the integration into the genome of yeast cells is to replace the metallothionein Crs5 ORF in the genome of yeast cells.

[0015] Beneficial effects: (1) The present invention successfully constructed a recombinant Saccharomyces cerevisiae strain expressing human type Ⅰa, type Ⅱ to type Ⅳ metallothionein. By culturing the recombinant yeast cells, a large amount of human type Ⅰa, type Ⅱ to type Ⅳ metallothionein modified with a eukaryotic expression system can be obtained.

[0016] (2) The human metallothionein sample prepared by the present invention has extremely strong antioxidant capacity, laying a foundation for the large-scale preparation of human metallothionein and its wide application in industrial fields such as food, medical cosmetics and environmental protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :SDS-PAGE was used to detect protein purity. Lane 1 is maker, lane 2 is recombinant hMT1, and lane 3 is recombinant hMT2.

[0018] Figure 2 :WB detection of the expression of human metallothionein, lane 1 is recombinant hMT1, lane 2 is recombinant hMT2.

[0019] Figure 3 : WB detection of the expression of human metallothionein, lane 1 is the blank control, i.e., the blank strain that was not transformed, lane 2 is the blank control, i.e., the strain transformed with a DNA fragment that does not contain recombinant human protein, and lanes 3 to 6 are recombinant hMT1 to hMT4.

[0020] Figure 4 :Total antioxidant capacity test, p value less than 0.01 is indicated by ☆☆, p value less than 0.001 is indicated by ☆☆☆. DETAILED DESCRIPTION

[0021] The present invention provides a recombinant human metallothionein, which is expressed by a yeast expression system; the metallothionein includes human type Ia metallothionein, human type II metallothionein, human type III metallothionein, and human type IV metallothionein.

[0022] Preferably, the nucleic acid sequence corresponding to the human type Ia metallothionein is shown in SEQ ID NO: 1; the nucleic acid sequence corresponding to the human type II metallothionein is shown in SEQ ID NO: 2; the nucleic acid sequence corresponding to the human type III metallothionein is shown in SEQ ID NO: 3; and the nucleic acid sequence corresponding to the human type IV metallothionein is shown in SEQ ID NO: 4.

[0023] An expression element for expressing human metallothionein, the expression element comprising: a promoter, a His tag, a Flag tag, a human metallothionein gene and a terminator. A signal peptide may be added to the expression element according to the expression requirements. Optionally, the signal peptide is α factor.

[0024] The promoter is ADH1 promoter, the terminator is ADH1 terminator, the His tag is 6His tag, and the Flag tag is 5Flag tag.

[0025] Optionally, in the above expression element, the 6His tag and the 5Flag tag are fused to the N-terminus of the protein corresponding to the human metallothionein gene. Preferably, the 6His tag is located upstream of the 5Flag tag.

[0026] Each element in the above expression elements is connected in series with or without a linker sequence.

[0027] Optionally, a tandem sequence is ADH1 promoter-6His-5Flag-human metallothionein gene-ADH1 terminator.

[0028] Optionally, a tandem sequence is ADH1 promoter-α factor-6His-5Flag-human metallothionein gene-ADH1 terminator.

[0029] Optionally, the nucleic acid sequence of the expression element for expressing type I human metallothionein is shown as SEQ ID NO: 5; the nucleic acid sequence of the expression element for expressing type II human metallothionein is shown as SEQ ID NO: 6; the nucleic acid sequence of the expression element for expressing type III human metallothionein is shown as SEQ ID NO: 7; and the nucleic acid sequence of the expression element for expressing type IV human metallothionein is shown as SEQ ID NO: 8.

[0030] Furthermore, in order to facilitate screening, the above expression element may also include a resistance gene, and the resistance gene may be a hygromycin resistance gene.

[0031] Optionally, the expression direction of the resistance gene is the same as the expression direction of the human metallothionein gene.

[0032] Alternatively, the expression direction of the resistance gene is opposite to the expression direction of the human metallothionein gene.

[0033] A yeast cell expressing human metallothionein, wherein the yeast cell contains any one of the above expression elements.

[0034] A method for preparing human metallothionein comprises transferring an expression element for expressing metallothionein into yeast cells by means of genetic engineering, and obtaining the human metallothionein by culturing the yeast cells.

[0035] Optionally, the expression element for expressing metallothionein is transferred into yeast cells by means of genetic engineering, which is to integrate the expression element for expressing metallothionein into the genome of yeast cells by utilizing the homologous recombination mechanism of yeast cells themselves. Preferably, the integration into the genome of yeast cells is to replace the metallothionein Crs5 gene in the genome of yeast cells.

[0036] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0037] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1 Design the nucleic acid sequence for expressing human metallothionein according to the codon preference of Saccharomyces cerevisiae: The sequence of human type Ⅰa metallothionein (hMT1) is shown in SEQ ID NO: 1, and the corresponding expression element sequence is shown in SEQ ID NO: 5; The sequence of human type II metallothionein (hMT2) is shown in SEQ ID NO: 2, and the corresponding expression element sequence is shown in SEQ ID NO: 6; The sequence of human type III metallothionein (hMT3) is shown in SEQ ID NO: 3, and the corresponding expression element sequence is shown in SEQ ID NO: 7; The sequence of human type IV metallothionein (hMT4) is shown in SEQ ID NO: 4, and the corresponding expression element sequence is shown in SEQ ID NO: 8.

[0039] The above sequences were synthesized by a commercial company and constructed in the pFA6a plasmid, and the sequences containing hMT1-4 are shown in SEQ ID NOs: 13-16, respectively.

[0040] Obtaining the target fragment: Design primers containing homology arms: The sequence of crs5-del-F is shown in SEQ ID NO: 9: TACACTGAACACTACAATGTCAAATAGTACTCAATAAATCGGATCCCCGGGTTAATTAA; The crs5-del-R sequence is shown in SEQ ID NO: 10: ATGATGATGTATTTATGATAAGTAAAGAGTAGGGGTCACGAATTCGAGCTCGTTTAAAC; Using the pFA6a vector containing the above expression element as a template, the target fragment was amplified according to the following system and procedure to obtain the target fragment: PCR system (50 μL)

[0041] PCR procedure

[0042] The PCR product was subjected to agarose gel electrophoresis and compared with a DNA marker to determine whether the product length was correct.

[0043] Example 2 Saccharomyces cerevisiae (BY4741) was selected as the expression strain to construct the recombinant strain: 1) Pick a yeast colony and place it in 3 mL YPD medium. Incubate at 30°C overnight with shaking. Ensure that the yeast is in the most vigorous growth state, with an OD value between 0.8 and 1.

[0044] 2) Collect 3 mL of yeast culture medium into a 1.5 mL centrifuge tube, centrifuge at 3000 × g, and discard the supernatant.

[0045] 3) Add 900 μL of water and 100 μL of 1 M LiAc, vortex to mix, and centrifuge at 3000 × g and discard the supernatant.

[0046] 4) Add the transformation system, shake and mix, and place on ice for 5 min. (LiAc: prepared with ultrapure water, the stock concentration is 1 M, after the volume is fixed, filter with a 0.22 μm filter and store in a 4°C refrigerator; 50% PEG3350: prepared with ultrapure water, the stock concentration is 50 mg / mL, after the volume is fixed, autoclave and store in a 4°C refrigerator; ssDNA: prepared with 50 mM pH 8.0 Tris-HCl, the stock concentration is 2 mg / mL, after the volume is fixed, aliquot and store in a -20°C refrigerator, boil in a boiling water bath for 5 min before use, and quickly insert into ice water.) Transformation system (360 μL)

[0047] 5) Heat shock in a 42°C water bath for 45 min.

[0048] 6) Centrifuge at 3000×g and remove the supernatant. Add 1 mL YPD and resuscitate at 30°C. After 5 minutes, spread on the Hygr resistance screening plate and culture inverted in a constant temperature incubator at 30°C.

[0049] 7) Pick a single bacterium to extract the genome: a. Take 100 μL of yeast genome extraction buffer in a 1.5 mL centrifuge tube (yeast genome extraction buffer: 1% SDS, 200 mM LiAc).

[0050] b. In a clean bench, use a pipette to pick up a soybean-sized amount of yeast and place it in the buffer, then shake to mix.

[0051] c. React in a 75°C metal bath for 5 min.

[0052] d. Add 300 μL of anhydrous ethanol, shake to mix, and centrifuge at 18,000 × g for 3 min.

[0053] e. Remove the supernatant, add 700 μL 70% ethanol to wash once, and centrifuge at 18,000×g for 3 min.

[0054] f. Remove the supernatant, open the lid and place in a 60°C oven to dry until the genome becomes transparent, indicating that the ethanol has been dried.

[0055] g. Add 50 μL of ultrapure water and shake to mix. Centrifuge at 18,000×g for 3 min. The supernatant is the yeast genome for later use.

[0056] h. The strain successfully transformed by PCR detection was stored for future use. The PCR system was the same as that in Example 1, and the primer sequences were shown in SEQ ID NO: 11: GCGTCTTTATTGCTGTGTGG; and SEQ ID NO: 12: CTGCAGCGAGGAGCCGTAAT.

[0057] Example 3 Protein expression and purification: Materials and reagents: DTT (sigma, 10197777001); (N30210-10ml) Ni NTA Beads 6FF (LABLEAD, N30210); imidazole (sigma, I2399); 1M Tris-HCl pH 7.5 (Sangong, B548124-0500); affinity chromatography tube (Biyuntian, FCL12).

[0058] Main instruments and equipment: Biological safety cabinet (ESCO, AC2-4S1); medical refrigerator (Haier, HYC-390); freeze drying system (CHRIST, GAMMA 1-16 LSC); general laboratory incubator (ESCO, IFA-1107-8); shaker / constant temperature oscillator (Shanghai Yiheng Technology Co., Ltd., THZ-98AB); centrifuge (eppendorf, Centrifuge 5804R); electronic balance (Hochoice, HC313); ultra-low temperature refrigerator (Thermo, 8800); medical centrifuge (Haier, LX-165T2R); three-hole electric constant temperature water bath (Shanghai Yiheng Technology Co., Ltd., DK-8D); multi-purpose rotary shaker (Qilin Bell, QB-206); electrophoresis instrument (Beijing Liuyi, DYCZ-MINI4); transfer instrument (Beijing Liuyi, DYCZ-TRANS2).

[0059] 1. Seed culture: Pick the monoclones constructed in Example 2 and inoculate them into 3 mL YPD respectively, and culture them at 30°C with shaking at 200 rpm for about 12 h until the seed solution is saturated; 2. Transfer culture: according to the starting OD 600 Transfer to 250 mL fresh YPD (medium) and shake at 200 rpm at 30°C until OD reaches 0.1. 600 =1.5; 3. Collect the fermentation broth: 5000×g for 5 min, transfer the supernatant to a 350 mL centrifuge bucket; 4. Impurity removal: 80°C water bath for 10 min; 5. Centrifuge: 4°C 15000×g for 60 min, transfer the supernatant to a 350 mL centrifuge bucket; 6. Binding: 1.5 mL Ni beads resin (pre-equilibrated 3 times in lysis buffer) was added directly to the supernatant of the fermentation broth; binding at 4°C for ≥2 h; 7. Elute with wash buffer (40 mM Tris-HC, 500 mM NaCl, 20 mM imidazole, pH 7.5) at 4°C until no protein is detected in the eluate; 8. Incubate with 500 μL elution buffer (40 mM Tris–HCl, 500 mM NaCl, 400 mM imidazole, pH 7.5) at 4°C for 15 min, then elute by adding 500 μL elution buffer each time for a total of 10 times and collect the eluate (containing the target protein).

[0060] 9. Store the purified product at -80°C for future use.

[0061] Example 4 Two of the purified proteins in Example 3 were selected for SDS-PAGE and WB (primary antibody: mouse anti-αFlag, secondary antibody: HRP-conjugated anti-mouse IgG) detection. The test results are as follows: Figure 1 and Figure 2 As shown, it can be seen that the human metallothionein designed in Example 1 was successfully secreted and expressed in recombinant yeast and purified successfully.

[0062] Example 5 The nucleic acid sequence for expressing human metallothionein was designed according to the method in Example 1, except that it did not contain a signal peptide element, and the rest was the same.

[0063] The recombinant strains were constructed in the same manner as in Examples 1 and 2.

[0064] Example 6 Protein expression detection: 1) The recombinant strain constructed in Example 5 was cultured and 5 OD yeast was collected in a 1.5 mL centrifuge tube.

[0065] 2) Add 1 mL of alkaline lysis buffer (0.25 M NaOH, 1% β-mercaptoethanol. Prepare freshly before use and place on ice), shake to mix, and place on ice for 10 min.

[0066] 3) Add 160 μL of 50% TCA, invert and mix three times, and place on ice again for 10 min.

[0067] 4) Centrifuge at 14,000 × g for 5 min at 4°C, remove the supernatant, and remove the remaining liquid with a pipette.

[0068] 5) Add 1 mL of ice-cold acetone, crush the precipitate with a pipette tip to wash away residual TCA, and centrifuge at 14,000 × g at 4°C for 5 min.

[0069] 6) Remove the supernatant, open the lid and place in a 60°C oven to dry for 20 min.

[0070] 7) Dissolve the precipitate in 50 μL 0.1M NaOH, add 2× loading buffer (100 mM Tris-HCl (pH 6.8), 4% SDS, 20% glycerol, 0.2% bromophenol blue, add 2% β-mercaptoethanol before use), mix well. Boil in boiling water bath for 5 min, centrifuge at 14000×g for 5 min, and take the supernatant for polyacrylamide gel electrophoresis.

[0071] 8) Western blotting was performed, primary antibody: mouse anti-α Flag, secondary antibody: HRP-conjugated anti-mouse IgG.

[0072] The results are as follows Figure 3 As shown: the recombinant yeast constructed by the present invention successfully expressed human type Ⅰa~Ⅳ metallothioneins, among which type Ⅲ and Ⅳ metallothioneins may have multiple modifications or be in the form of protein polymers.

[0073] Example 7 Biological activity detection of recombinant human metallothionein: Two purified proteins in Example 3 were dialyzed to remove imidazole from the buffer, and then the total antioxidant capacity (T-AOC) detection kit (Solarbio ®, Catalog No.: BC1315) for oxidation capacity detection, the experimental group was 800 ng of each protein purified in Example 3, and the control group was SOD 800 ng.

[0074] The results are as follows Figure 4 As shown: the total antioxidant level of hMT1 reached 164.25, the total antioxidant level of hMT2 reached 178.38, while the antioxidant level of the control SOD was only 0.07; the total antioxidant level of hMT1 was 2202 times that of SOD, and the total antioxidant level of hMT2 was 2391 times that of SOD.

[0075] In summary, these results indicate that the present invention successfully expressed recombinant human metallothionein with strong bioactivity through yeast cells, providing a reliable material basis for further research on metallothionein and subsequent development of related products.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A recombinant human metallothionein, characterized in that: The human metallothionein is expressed by a yeast expression system; the human metallothionein includes human type Ia metallothionein, human type II metallothionein, human type III metallothionein, and human type IV metallothionein.

2. The recombinant human metallothionein according to claim 1, characterized in that The nucleic acid sequence corresponding to the human type Ia metallothionein is shown in SEQ ID NO: 1; the nucleic acid sequence corresponding to the human type II metallothionein is shown in SEQ ID NO: 2; the nucleic acid sequence corresponding to the human type III metallothionein is shown in SEQ ID NO: 3; and the nucleic acid sequence corresponding to the human type IV metallothionein is shown in SEQ ID NO:

4.

3. An expression element for expressing human metallothionein, characterized in that: The expression elements include: a promoter, a His tag, a Flag tag, a human metallothionein gene and a terminator.

4. The expression element according to claim 3, characterized in that The expression element also includes a signal peptide.

5. The expression element according to claim 3, characterized in that The promoter is ADH1 promoter, the terminator is ADH1 terminator, the His tag is 6His tag, and the Flag tag is 5Flag tag.

6. The expression element according to claim 5, characterized in that The 6His tag and the 5Flag tag are fused and constructed at the N-terminus of the protein corresponding to the human metallothionein gene.

7. A yeast cell expressing human metallothionein, characterized in that: The yeast cell contains the expression element according to any one of claims 3 to 6.

8. A method for preparing the human metallothionein as claimed in claim 1 or 2, characterized in that: The expression element for expressing metallothionein is transferred into yeast cells by means of genetic engineering, and the human metallothionein is obtained by culturing the yeast cells.

9. The method according to claim 8, characterized in that The method of transferring the expression element for expressing metallothionein into yeast cells by means of genetic engineering is to utilize the homologous recombination mechanism of yeast cells themselves to integrate the expression element for expressing metallothionein into the genome of yeast cells.

10. The method according to claim 9, characterized in that The integration into the genome of the yeast cell is to replace the metallothionein Crs5 ORF in the genome of the yeast cell.

Images