Novel method for preparing ultrahigh-efficiency sphere nucleic acid

Abstract

The invention discloses a novel ultrahigh-efficiency sphere nucleic acid preparation method which is based on a DNA extraction principle and comprises the following steps: (1) adding an organic alcohol solution into a mixed solution of nanoparticles and DNA; (2) uniformly shaking, and immediately adding inorganic salt for salting out; and (3) separating to obtain the sphere nucleic acid through simple centrifugation. According to the method, ultrahigh-efficiency ball nucleic acid preparation can be realized, the coupling of the nanoparticles and the DNA can be realized at the moment of adding the organic alcohol, and the whole process can be completed within three minutes. In addition, the method is suitable for preparing the spherical nucleic acid under sulfydryl DNA, non-sulfydryl DNA and various nano-particles in any volume. Compared with reported methods, the method provided by the invention really meets the requirements of simple operation, instant coupling, high DNA density, universality and large-scale preparation at the same time.

Description

Technical Field

[0001] The invention relates to a method for preparing a spherical nucleic acid, and in particular to a new method for preparing a super-efficient spherical nucleic acid. Background Art

[0002] Nucleic acids are universal molecular building blocks for constructing functional materials due to their inherent biological properties, molecular recognition capabilities, sequence programmability, and biocompatibility. Therefore, researchers have constructed nucleic acid-functionalized biomaterials with various compositions and characteristics, and further explored their applications in biology, chemistry, medicine, and other fields. Spherical nucleic acids are a typical nucleic acid-functionalized nanomaterial, which is generally composed of a nanoparticle core and a tightly bound and orderly arranged nucleic acid shell. Spherical nucleic acids provide new application possibilities in many fields, including nucleic acid programming nanotechnology, molecular sensing, cell imaging, gene regulation, drug delivery, disease diagnosis and treatment, etc. The premise of these applications is to prepare stable spherical nucleic acids, and the key step in preparing spherical nucleic acids is to couple the designed nucleic acid sequence to the surface of nanoparticles, usually gold nanoparticles (AuNPs), to ensure that the synthesized spherical nucleic acids are stable under physiological conditions. Therefore, it is of great significance to develop a simple and efficient method for preparing spherical nucleic acids.

[0003] There are currently a variety of methods for preparing spherical nucleic acids, among which the more classic one is the salt aging method. The operation method is to gradually add a salt solution (such as a sodium chloride solution) to a mixture of DNA and AuNPs at intervals, and finally reach a higher salt concentration. The entire preparation process takes 1 to 2 days to finally form a stable spherical nucleic acid. The DNA density of this method depends on the final concentration of inorganic salts. The higher the final concentration of inorganic salts, the higher the density of coupled DNA. And the salt addition process is prone to cause AuNPs aggregation, resulting in coupling failure. Therefore, the salt aging method is a cumbersome and time-consuming preparation method with extremely low efficiency and poor reproducibility. Subsequent researchers shortened the entire preparation process to 1 to 2 hours by introducing surfactants or polymers. In order to further improve efficiency, researchers have developed several innovative and efficient methods, such as low pH method, freeze-thaw method, n-butanol dehydration method, and drying method.

[0004] The preparation process of the low pH method is as follows: SH-DNA and AuNPs are mixed in a certain ratio, and then a citric acid-HCl buffer solution is added to adjust the solution pH to 3.0. After standing for 3-5 minutes, the spherical nucleic acid is obtained by centrifugation. The low pH method is simple to operate, but the density of the prepared spherical nucleic acid DNA is relatively low.

[0005] The freeze-thaw method preparation process is as follows: SH-DNA and AuNPs are mixed in a certain ratio, then placed in a -20℃ or -80℃ refrigerator, or frozen with dry ice, taken out after freezing into a solid, thawed at room temperature, and then centrifuged to obtain the spherical nucleic acid. The freeze-thaw method requires freezing equipment or coolants to convert liquid into solid, and cannot achieve instant coupling; and the volume of the solution determines the time required for freezing, and the time required for large-volume preparation is greatly increased, and rapid preparation cannot be achieved in this case.

[0006] The preparation process of the n-butanol dehydration method is as follows: SH-DNA and AuNPs are mixed in a certain ratio, then 6-9 times the volume of n-butanol is added, vortexed for dehydration, then TBE buffer is added, vortexed again to dissolve the spherical nucleic acid in the aqueous phase, centrifuged to separate the layers, the n-butanol layer liquid is removed, and finally centrifuged to obtain the spherical nucleic acid. The entire preparation process has many operating steps, and it is difficult to completely remove n-butanol by centrifugation, which is not conducive to the next step of biomedical application.

[0007] The drying method preparation process is as follows: SH-DNA and AuNPs are mixed in a certain proportion and placed in a drying device (such as a microwave oven, vacuum dryer) for drying. After the liquid is completely evaporated, a buffer solution is added to resuspend it, and finally centrifuged to obtain the spherical nucleic acid. The drying method also requires a drying device to evaporate all the liquid, and the time required for evaporation is related to the volume of the liquid. The larger the volume, the longer the time required. Therefore, it cannot meet the requirements of rapid preparation when conducting large-scale preparation.

[0008] In summary, there is currently a lack of an ideal method for preparing spherical nucleic acids that can truly possess the advantages of simple operation, instant coupling, high DNA density, versatility and large-scale preparation. Summary of the invention

[0009] In order to solve the shortcomings of the above-mentioned technology, the present invention provides a new method for preparing ultra-efficient spherical nucleic acids.

[0010] In order to solve the above technical problems, the technical solution adopted by the present invention is: a new method for preparing ultra-efficient spherical nucleic acid, characterized in that it includes the following preparation steps:

[0011] S1, adding organic alcohol solution to the mixture of nanoparticles and DNA;

[0012] S2. After shaking, add inorganic salt immediately for salting out;

[0013] S3. Simply centrifuge to separate the spherical nucleic acid.

[0014] Preferably, if non-thiol DNA is used, a poly-T sequence needs to be connected to one end of the DNA.

[0015] Preferably, the nanoparticles coupled to the thiol DNA are any one of gold nanoparticles, silver nanoparticles and gold nanorod particles.

[0016] Preferably, the organic alcohol solution is one of anhydrous ethanol or isopropanol, and the volume fraction of the organic alcohol solution is 75-90%.

[0017] Preferably, the inorganic salt is sodium chloride with a concentration of 10-100 mmol·L -1 .

[0018] Preferably, when the gold nanoparticles used are 13 nm gold nanoparticles, the DNA and the 13 nm gold nanoparticles are mixed in a molar ratio of (300-600):1.

[0019] Preferably, when the gold nanoparticles used are 60 nm large-diameter gold nanoparticles, the DNA and the large-diameter gold nanoparticles are mixed at a molar ratio of 10000:1;

[0020] When 20 nm silver nanoparticles were used, DNA and silver nanoparticles were mixed at a molar ratio of 4000:1;

[0021] When 15×38 nm gold nanorods were used, DNA and gold nanorods were mixed at a molar ratio of 4000:1.

[0022] Preferably, the spherical nucleic acid is prepared by shaking with inorganic salt and standing for 1 minute to allow the spherical nucleic acid to aggregate and precipitate, then centrifuging at 12000 rpm for 30 seconds, removing the supernatant, and resuspending the precipitate in an aqueous solution.

[0023] A new method for preparing ultra-efficient spherical nucleic acids, which is suitable for rapid and large-scale preparation of spherical nucleic acids.

[0024] The present invention discloses a new method for preparing ultra-efficient spherical nucleic acids. Based on the traditional DNA extraction principle, high-DNA-density spherical nucleic acids are prepared. By adding an organic alcohol solution (ethanol or isopropanol) to a mixture of DNA and nanoparticles (such as AuNPs), the coupling of DNA and nanoparticles can be achieved instantly, and the whole process can be completed within three minutes to obtain spherical nucleic acids. Compared with the reported methods, the spherical nucleic acid preparation method of the present invention can truly meet the requirements of simple operation, instantaneous coupling, high DNA density, versatility and large-scale preparation of spherical nucleic acids. The prepared spherical nucleic acids maintain the biological activity of DNA and can hybridize with complementary DNA, providing an ultra-efficient preparation method for the further extensive application of spherical nucleic acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram of preparing spherical nucleic acid using the DNA extraction method in Example 1.

[0026] Figure 2 This is a characterization result diagram of the spherical nucleic acid prepared in Example 1;

[0027] in, Figure 2 A is the absorption spectra of citrate-coated gold nanoparticles (Cit-AuNPs) and DNA-coupled gold nanoparticles (DNA-AuNPs);

[0028] Figure 2 B is added 50mmol·L -1 Cit-AuNPs with sodium chloride and 0.3, 0.6, 1.0, 2.0 mol·L -1 Absorption spectrum of DNA-AuNPs in sodium chloride;

[0029] Figure 2 C is the agarose gel electrophoresis image of the prepared DNA-AuNPs.

[0030] Figure 3 The agarose gel electrophoresis and DNA quantification diagram of DNA-AuNPs obtained when comparing the various methods in Example 1.

[0031] Figure 4 A is the agarose gel electrophoresis and DNA quantification diagram of DNA-AuNPs prepared under different ethanol volume fraction conditions in Example 1;

[0032] Figure 4 B is the agarose gel electrophoresis and DNA quantification diagram of DNA-AuNPs prepared under different DNA:AuNPs molar ratios in Example 1;

[0033] Figure 4 C is the agarose gel electrophoresis and DNA quantification diagram of DNA-AuNPs prepared under different incubation time conditions in Example 1;

[0034] Figure 4 D is the absorption spectrum and gel electrophoresis of the spherical nucleic acid prepared in Example 1 when water and ethanol are added in different orders.

[0035] Figure 5 A is the addition and absence of 20mmol·L in Example 1 -1 Absorption spectrum of the centrifugal supernatant after sodium chloride salting out and gel electrophoresis of the prepared spherical nucleic acid;

[0036] Figure 5 B is an agarose gel electrophoresis diagram of spherical nucleic acids prepared after salting out with sodium chloride solutions of different concentrations in Example 1;

[0037] Figure 5 C is 20mmol·L -1Agarose gel electrophoresis of DNA-AuNPs prepared by salting out for different times in sodium chloride solution.

[0038] Figure 6 This is a result diagram of using isopropanol to prepare spherical nucleic acid in Example 2;

[0039] in, Figure 6 A is the absorption spectra of Cit-AuNPs and DNA-AuNPs;

[0040] Figure 6 B is added 50mmol·L -1 Cit-AuNPs with sodium chloride and 0.3, 0.6, 1.0, 2.0 mol·L -1 NaCl absorption spectrum of DNA-AuNPs.

[0041] Figure 7 A and Figure 7 B is the absorption spectrum of the spherical nucleic acid prepared by coupling SH-DNA with large-size AuNPs (60 nm) in Example 3 and its absorption spectrum in sodium chloride solutions of different concentrations;

[0042] Figure 7 C and Figure 7 D is the absorption spectrum of the spherical nucleic acid prepared by coupling SH-DNA with silver nanoparticles (AgNPs, 20 nm) in Example 4 and its absorption spectrum in sodium chloride solutions of different concentrations;

[0043] Figure 7 E is the absorption spectrum of the spherical nucleic acid and CTAB-AuNRs prepared by coupling SH-DNA with gold nanorods (AuNRs, 15×38 nm) in Example 5;

[0044] Figure 7 F is the gel electrophoresis diagram of the spherical nucleic acid and CTAB-AuNRs prepared by coupling SH-DNA with gold nanorods (AuNRs, 15×38 nm) in Example 5.

[0045] Figure 8 A is the absorption spectrum of the spherical nucleic acid and Cit-AuNPs prepared by coupling non-thiol DNA with AuNPs in Example 6;

[0046] Figure 8 B is the absorption spectrum of the spherical nucleic acid prepared by coupling non-thiol DNA with AuNPs in Example 6 in sodium chloride solutions of different concentrations.

[0047] Fig. 9 This is the gel electrophoresis diagram of the spherical nucleic acid prepared by coupling non-thiol DNA of different sequences with AuNPs in Example 6.

[0048] Fig.10 This is the gel electrophoresis diagram of the spherical nucleic acid prepared by coupling SH-DNA with 0.1mL or 1.0mL AuNPs solution using this method.

[0049] Fig.11 A and Fig.11 B is the absorption spectrum of the solution after adding different concentrations of target DNA to the mixed solution of DNA1-AuNPs and DNA7-AuNPs prepared by the present invention and the photograph of the corresponding solution. DETAILED DESCRIPTION

[0050] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0051] Embodiment 1

[0052] The method for preparing the ultra-efficient spherical nucleic acid, i.e., DNA-AuNPs coupling complex disclosed in this embodiment includes the following process:

[0053] 1. Synthesis of 13 nm gold nanoparticles and DNA

[0054] The 13 nm citrate-coated AuNPs (cit-AuNPs) were synthesized by the classic citric acid reduction method. 50 mL of HAuCl4 solution (1.0 mmol·L) was added to a 125 mL clean conical flask. -1 ) and heated on a hot plate until boiling and refluxed. Then, 2.5 mL of sodium citrate (77.6 mmol·L) was added under rapid stirring (800 rpm). -1 ), reflux reaction for 15 min. Turn off the heating, stir and cool to room temperature. The concentration of AuNPs was determined by Lambert-Beer law, and the corresponding molar absorption coefficient at 520 nm was 2.7×10 8 M -1 cm -1 .

[0055] The DNA used was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The specific sequences are as follows:

[0056] DNAname Sequences(5′to3′) <![CDATA[DNA1]]> SH-AAAAAAAAAA-CCATAACCTTTCCA <![CDATA[DNA2]]> SH-AAAAAAAAAA-CCATAACCTTTCCA-FAM <![CDATA[DNA3]]> AAAAAAAAAA-CCATAACCTTTCCA <![CDATA[DNA4]]> TTTTTTTTTTT-CCATAACCTTTCCA <![CDATA[DNA5]]> CCCCCCCCCC-CCATAACCTTTCCA <![CDATA[DNA6]]> GGGGGGGGGG-CCATAACCTTTCCA <![CDATA[DNA7]]> CATACCGCAGACAAAAAAAAAA-SH <![CDATA[DNA8]]> GTCTGCGGTATGTGGAAAGGTTATGG

[0057] 2. Experimental steps for preparing spherical nucleic acid by DNA extraction method

[0058] like Figure 1 As shown in the figure, 100 μL Cit-AuNPs were mixed with a certain volume of SH-DNA (DNA1, 100 μmol·L -1) were mixed at a molar ratio of 1:500, and a certain volume of anhydrous ethanol was immediately added to the above mixture to make the volume fraction of ethanol 80%. After shaking, a certain volume of sodium chloride solution (2.0 mol·L -1 ) to a final concentration of 20 mmol·L -1 , shake well and let stand for 1 minute until the spherical nucleic acid aggregates and precipitates, and finally centrifuge (12000rpm, 30s), remove the supernatant, and resuspend the precipitate in an aqueous solution to complete the preparation of spherical nucleic acid. The entire preparation process is simple to operate, and all operations can be completed within 3 minutes.

[0059] 3. Characterization of spherical nucleic acids

[0060] The successful preparation of spherical nucleic acids was confirmed by experimental characterization in the following aspects.

[0061] One is the absorption spectrum. Figure 2 A is the absorption spectra of Cit-AuNPs and the prepared spherical nucleic acid, namely DNA-AuNPs. Compared with Cit-AuNPs, the absorption of DNA-AuNPs is red-shifted and the absorption peak increases, indicating that DNA is successfully coupled to the surface of AuNPs, causing changes in the microenvironment around AuNPs, thereby causing changes in its localized surface plasmon resonance absorption.

[0062] The second is the salt resistance experiment. Figure 2 B is added 50mmol·L -1 Cit-AuNPs with sodium chloride and 0.3, 0.6, 1.0, 2.0 mol·L -1 Absorption spectrum of DNA-AuNPs in NaCl. Cit-AuNPs in 50mmol·L -1 In the presence of sodium chloride, the DNA-AuNPs prepared in this example aggregated significantly. -1 The DNA can be stably present in sodium chloride solution without aggregation, indicating that the DNA has been successfully coupled to the surface of AuNPs, thereby protecting the AuNPs from aggregation under high salt concentrations.

[0063] The third is agarose gel electrophoresis. Figure 2 C is the agarose gel electrophoresis of the prepared DNA-AuNPs, with dihydrate bis (p-sulfonylphenyl) phenylphosphine (BSPP) coated stabilized AuNPs (BSPP-AuNPs) as the control. The prepared spherical nucleic acid is similar to BSPP-AuNPs, with only one clear band, indicating that the prepared spherical nucleic acid has no aggregation, has good monodispersity, and the number of DNA coupled to each AuNP is consistent.

[0064] 4. Comparison with existing preparation methods

[0065] To confirm that the preparation method of this example can obtain high-density DNA, the DNA extraction method (DE) of this example was compared with the low pH method (pH), freeze-thaw method (Fz), n-butanol dehydration method (BD), microwave-assisted thermal drying method (MD) and vacuum drying method (VD).

[0066] The same SH-DNA (DNA1) was coupled with AuNPs by different methods and separated to obtain DNA-AuNPs. Figure 3 As shown in agarose gel electrophoresis, the order of electrophoretic hysteresis of DNA-AuNPs prepared by different methods is: DE=MD>BD>VD>Fz>pH. Since the higher the DNA density, the more significant the electrophoretic hysteresis, the order of the number of DNA on the spherical nucleic acids prepared by different methods should be DE=MD>BD>VD>Fz>pH. Further, fluorescent DNA (DNA2) was coupled to AuNPs and DNA quantification experiments were performed. The results showed that the number of DNA coupled by different methods was 287, 287, 282, 218, 174, and 95 per particle, respectively, which was consistent with the electrophoresis results. In addition, agarose gel electrophoresis showed that the spherical nucleic acids prepared by microwave-assisted thermal drying (MD) had multiple bands, indicating that the prepared spherical nucleic acids had a small amount of aggregates, while the spherical nucleic acids prepared by the other five methods were all single bands, indicating that the prepared spherical nucleic acids had good monodispersity. Therefore, the preparation method proposed in the present invention can prepare monodisperse spherical nucleic acids with the highest DNA density.

[0067] In addition, the optimization process of the experimental conditions for the preparation of spherical nucleic acid in this embodiment includes:

[0068] First, the amount of ethanol used in the implementation of this method is critical. The present invention experiments with the preparation of spherical nucleic acids at different ethanol volume fractions, and the obtained spherical nucleic acids are characterized by electrophoresis and DNA quantification. Figure 4 As shown in A, the spherical nucleic acids obtained under 60% and 70% ethanol conditions aggregated significantly, while the spherical nucleic acids prepared when the ethanol volume fraction was 75% and above were monodispersed. The DNA quantification results also showed that the number of DNA couplings was large when the ethanol volume fraction was 75%-90%.

[0069] Second, to obtain monodisperse spherical nucleic acids, the molar ratio of DNA:AuNPs is also very important. Figure 4B is the agarose gel electrophoresis and DNA quantification of DNA-AuNPs prepared under different DNA:AuNPs molar ratios. When the molar ratio is 100:1, the obtained spherical nucleic acid is obviously aggregated and monodisperse spherical nucleic acid cannot be obtained; when the molar ratio is 200:1, the obtained spherical nucleic acid still has a small degree of aggregation; and when the molar ratio is greater than or equal to 300:1, monodisperse spherical nucleic acid can be obtained. In addition, as the DNA:AuNPs molar ratio increases, the DNA-AuNPs gel electrophoresis hysteresis becomes more obvious, indicating that the number of DNA couplings is greater at a high molar ratio, and this result is consistent with the DNA quantification result.

[0070] Furthermore, the method was verified to be able to prepare spherical nucleic acids in an instant. By examining the agarose gel electrophoresis and DNA quantification of spherical nucleic acids prepared after adding ethanol and then incubating for 0, 10, 30, and 60 minutes, it was found that there was basically no significant difference in the gel electrophoresis retardation of spherical nucleic acids prepared at different incubation times and the number of DNA coupled on the surface ( Figure 4 C), that is, prolonging the incubation time does not increase the number of DNA couplings, indicating that the spherical nucleic acid is formed at the moment of ethanol addition.

[0071] In order to further prove that the preparation of spherical nucleic acids can be completed in an instant, two groups of experiments were designed to prepare spherical nucleic acids. The final solution volume of the two groups of experiments was the same and the ethanol volume fraction was 60%, but the order of adding ethanol and water was different. One group first added ethanol to a volume fraction of 80% and then immediately added water to make the ethanol volume fraction 60%, while the other group first added water and then immediately added ethanol to a volume fraction of 60%. Absorption spectroscopy and gel electrophoresis ( Figure 4 D) shows that the spherical nucleic acids obtained from the two groups of experiments are completely different. One group of spherical nucleic acids is in a monodisperse state, while the other group of spherical nucleic acids is obviously aggregated. This result shows that DNA can be coupled instantly under 80% ethanol, so subsequent dilution with water will not cause the prepared spherical nucleic acids to aggregate.

[0072] Furthermore, in the present invention, inorganic salts play an important role in the preparation of spherical nucleic acids. Adding a certain concentration of inorganic salts can better separate the formed spherical nucleic acids. Figure 5 The absorption spectrum of A shows that if no sodium chloride is added, there is still obvious residual spherical nucleic acid in the supernatant after centrifugation (12000rpm, 30min); while adding 20mmol·L -1 After sodium chloride was used for salting out, the supernatant was centrifuged at the same speed for only 30 seconds, and there was almost no spherical nucleic acid in the supernatant. It can be seen that the addition of sodium chloride can greatly shorten the time for separating spherical nucleic acids and significantly improve the recovery rate of spherical nucleic acids. In addition, the addition of sodium chloride can increase the number of DNA couplings. Electrophoresis results ( Figure 5A inset) shows that the spherical nucleic acid obtained after salting out exhibits a greater electrophoretic hysteresis than the spherical nucleic acid without salting out, indicating that the number of DNAs coupled to the surface of the spherical nucleic acid obtained after salting out is greater.

[0073] Furthermore, the use of different concentrations of sodium chloride during salting out was investigated. Figure 5 The agarose gel electrophoresis results in B show that different sodium chloride concentrations have little effect on the formation of spherical nucleic acids. In addition, the effect of salting-out time on the formation of spherical nucleic acids was also investigated. Figure 5 The gel electrophoresis results in C show that there is no significant difference in the spherical nucleic acids obtained when the salting-out time is 1-10 min.

[0074] Embodiment 2

[0075] The preparation method of the ultra-efficient spherical nucleic acid, i.e., DNA-AuNPs coupling complex disclosed in this embodiment is the same as that of Example 1, except that isopropanol is used instead of ethanol. Figure 6 As shown, the spherical nucleic acid prepared in this example has a red-shifted absorption spectrum compared to Cit-AuNPs and has good salt resistance, which confirms that DNA is successfully coupled to the surface of AuNPs, indicating that the use of isopropanol can also achieve ultra-efficient spherical nucleic acid preparation.

[0076] Embodiment 3

[0077] The new method for preparing ultra-efficient spherical nucleic acid disclosed in this example is the same as that in Example 1, except that large-sized AuNPs (60 nm) are used for coupling with SH-DNA, and the large-sized AuNPs and SH-DNA are mixed at a molar ratio of 1:10000. Figure 7 As shown in A and 7B, the absorption spectrum of the spherical nucleic acid prepared by coupling SH-DNA with large-particle AuNPs is red-shifted and the absorption peak increases. At the same time, it has good salt resistance, indicating that DNA is successfully coupled to the surface of large-particle AuNPs.

[0078] Embodiment 4:

[0079] The new method for preparing ultra-efficient spherical nucleic acid disclosed in this example is the same as that in Example 1, except that silver nanoparticles (AgNPs, 20 nm) are used for coupling with SH-DNA, and AgNPs and SH-DNA are mixed at a molar ratio of 1:4000. Figure 7 C and 7D, the absorption spectrum of the spherical nucleic acid prepared by coupling SH-DNA with AgNPs undergoes a red shift and the absorption peak increases, and it also has good salt resistance, indicating that DNA is successfully coupled to the surface of AgNPs.

[0080] Embodiment 5

[0081] The new method for preparing ultra-efficient spherical nucleic acids disclosed in this embodiment has the same preparation process as that of Example 1, except that gold nanorods (AuNRs, 15×38 nm) are used for coupling with SH-DNA, and AuNRs and SH-DNA are mixed at a molar ratio of 1:4000. Figure 7 E shows that the absorption of the spherical nucleic acid prepared by coupling SH-DNA with AuNRs is red-shifted compared with that of CTAB-AuNRs; Figure 7 F shows the gel electrophoresis of spherical nucleic acids prepared by coupling SH-DNA and AuNRs. DNA-AuNRs showed a clear band, while CTAB-AuNRs aggregated significantly. The above results indicate that DNA was successfully coupled to the surface of AuNRs.

[0082] Embodiment 6

[0083] The new method for preparing ultra-efficient spherical nucleic acids disclosed in this embodiment has the same preparation process as that of the first embodiment, except that non-thiol DNA is used for coupling with AuNPs. Figure 8 The absorption spectrum shift and salt resistance test results of A and 8B show that this method can successfully couple non-thiol DNA (DNA4) to the surface of AuNPs. However, further studies have found that the dispersion of spherical nucleic acids prepared by coupling non-thiol DNA of different sequences with AuNPs is very different. Fig. 9 The gel electrophoresis results showed that the spherical nucleic acids prepared from non-thiol DNA containing poly A / C / G (DNA3, DNA5, DNA6) had different degrees of aggregation, and only the spherical nucleic acids prepared from non-thiol DNA containing poly T sequence (DNA4) were monodisperse. Therefore, DNA containing only poly A / C / G sequence could not be coupled to obtain monodisperse spherical nucleic acids, and only DNA containing a poly T sequence could be used for coupling.

[0084] The verification of the preparation of spherical nucleic acids under large volume conditions is as follows: an experimental comparison of 0.1mL and 1.0mL AuNPs solution coupled with DNA was performed. Fig.10 As shown in the figure, when the experimental steps are completely the same and the amount of reagents added is proportionally increased, the electrophoresis results of the spherical nucleic acid obtained are consistent, indicating that the method is not limited by the volume of the solution and can quickly and easily prepare spherical nucleic acids even in a large volume of solution. Therefore, the method is suitable for the rapid and large-scale preparation of spherical nucleic acids.

[0085] A DNA hybridization experiment was designed to verify the biological activity of the spherical nucleic acid. First, two DNA sequences (DNA1 and DNA7) that can complementarily hybridize with the target DNA (DNA8) were coupled to AuNPs respectively through the preparation method of the present invention to prepare DNA1-AuNPs and DNA7-AuNPs. Then the two spherical nucleic acids were mixed and added to the target DNA. The results are shown in Figure 2. Fig.11 As shown in the figure, compared with the experimental group without adding the target, the AuNPs in the experimental group with the target DNA added were significantly aggregated, and the higher the concentration of the added target DNA, the greater the aggregation of the AuNPs. The experimental results show that the DNA on the surface of the spherical nucleic acid can hybridize with the target DNA, causing the AuNPs to aggregate. Therefore, the spherical nucleic acid prepared by this method maintains the biological activity of DNA and can be further used in subsequent biochemical studies such as hybridization, targeted recognition, and nanodevice construction.

[0086] In summary, for the new method for preparing ultra-efficient spherical nucleic acids disclosed in the present invention, when organic alcohol is added to the mixture of nanoparticles and DNA, the nanoparticles and DNA can be coupled instantly, and the spherical nucleic acids can be quickly and efficiently separated by adding inorganic salts. This method has the advantages of simple operation, instant coupling, high DNA density, versatility and large-scale preparation. At the same time, the prepared spherical nucleic acids maintain the biological activity of DNA and can be used for subsequent biochemical research.

[0087] The above implementation modes are not limitations of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by technicians in this technical field within the scope of the technical solution of the present invention also belong to the protection scope of the present invention.

Claims

1. A new method for preparing ultra-efficient spherical nucleic acid, characterized in that: The method comprises the following preparation steps: S1, adding an organic alcohol solution to a mixture of nanoparticles and DNA; S2, immediately adding an inorganic salt to perform salt precipitation after shaking; and S3, separating and obtaining the spherical nucleic acid by simple centrifugation.

2. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 1, characterized in that: The DNA is either thiol DNA or non-thiol DNA.

3. The new method for preparing ultra-efficient spherical nucleic acid according to claim 2, characterized in that: If non-thiol DNA is used, a poly-T sequence needs to be attached to one end of the DNA.

4. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 1, characterized in that: The nanoparticles coupled to the thiol DNA are any one of gold nanoparticles, silver nanoparticles and gold nanorod particles.

5. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 1, characterized in that: The organic alcohol solution is one of anhydrous ethanol and isopropanol, and the volume fraction of the organic alcohol solution is 75-90%.

6. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 5, characterized in that: The inorganic salt is sodium chloride with a concentration of 10-100 mmol·L -1 .

7. The new method for preparing ultra-efficient spherical nucleic acid according to claim 4, characterized in that: When the gold nanoparticles used are 13 nm gold nanoparticles, DNA and the 13 nm gold nanoparticles are mixed at a molar ratio of (300-600):

1.

8. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 4, characterized in that: When the gold nanoparticles used are 60nm large-diameter gold nanoparticles, DNA and large-diameter gold nanoparticles are mixed at a molar ratio of 10000:1; when 20nm silver nanoparticles are used, DNA and silver nanoparticles are mixed at a molar ratio of 4000:1; when 15×38nm gold nanorods are used, DNA and gold nanorods are mixed at a molar ratio of 4000:

1.

9. The novel method for preparing ultra-efficient spherical nucleic acid according to claim 8, characterized in that: After shaking with inorganic salt and standing for 1-10 minutes, the spherical nucleic acid is aggregated and precipitated, and then the supernatant is removed by centrifugation, and the precipitate is resuspended in an aqueous solution to complete the preparation of the spherical nucleic acid.

10. A new method for preparing ultra-efficient spherical nucleic acid, characterized in that: The preparation method is suitable for the rapid and large-scale preparation of spherical nucleic acids.

Images