Treatment of mitochondrial diseases

Abstract

The present invention provides treatment of mitochondrial diseases. The present invention provides a composition comprising one or more deoxyribonucleosides for use in the treatment of a mitochondrial DNA depletion and / or multiplex deletion syndrome, provided that the syndrome is not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism. By using the invention, the mitochondrial DNA level recovery is independent of the severity of the disease in the patient, which imparts great therapeutic value to the invention.

Description

[0001] This application is a divisional application of the invention application with the application date of June 3, 2016, the Chinese national application number of 201680039230.6, and the invention name of “Treatment of mitochondrial disease”.

[0002] The present invention relates to the field of medicine, and in particular to the treatment of mitochondrial diseases, more particularly to those mitochondrial diseases caused by deletion / depletion of mitochondrial DNA (mtDNA). Background Art

[0003] The mitochondrial genome (mtDNA) is a 16.5 kb DNA molecule that is normally present in multiple copies in a single mitochondria.

[0004] An important group of Mendelian mitochondrial diseases are caused by mutations in nuclear genes whose products are involved in mitochondrial DNA replication or maintenance. These rare diseases are also known as intergenomic communication defects, mtDNA depletion diseases, mtDNA multiple deletion diseases, or mitochondrial depletion and deletion diseases (MDDS). These entities have specific orphan codes: ORPHA35698 for mitochondrial DNA depletion syndrome and ORPHA254807 for multiple mitochondrial DNA deletion syndrome, and are also identified in the OMIM database as http: / / www.omim.org / phenotypicSeries / PS603041 (for mitochondrial DNA depletion) and http: / / www.omim.org / phenotypicSeries / PS157640 (for multiple mitochondrial DNA deletions). These diseases are a complex group of genetically and clinically heterogeneous disorders characterized by the presence of mtDNA aberrations in one or more affected tissues (e.g., skeletal muscle, liver, brain).

[0005] The severity and progression of these disorders are also highly variable, ranging from mild clinical manifestations (e.g., progressive external ophthalmoplegia) to severe phenotypes that may lead to death in infancy or early childhood, as observed in classic mtDNA depletion syndromes.

[0006] Most genes associated with defects in intergenic communication so far are either directly involved in mtDNA replication or involve the metabolism of deoxyribonucleoside triphosphates (dNTPs), which are building blocks for DNA synthesis. However, more and more mutations that cause MDDS have been identified in genes (OPA1, MPV17, FBXL4, etc.) that cause mtDNA instability through unknown pathological mechanisms. It is generally believed that defects in certain genes specifically cause loss or multiple mtDNA deletions. For example, DGUOK defects usually cause mtDNA loss, while OPA1 defects usually cause multiple mtDNA deletions. However, increasing evidence shows that mitochondrial DNA loss and multiple deletions can be considered as clinical manifestations of the same pathogenic pathways that affect mitochondrial DNA replication and repair. For mutations in genes (TK2, DGUOK) that were only found to be related to infantile mitochondrial DNA loss until recently, it has now been found that it also causes multiple mtDNA deletions, and in some cases adult onset.

[0007] Because MDDS is a multi-organ dysfunction, a multidisciplinary team including different specialists is required to provide supportive care and symptomatic treatment for associated complications.

[0008] To date, no effective treatments have been developed for these complex diseases. This is mainly due to the lack of information about the exact factors that cause the mechanisms of the diseases, as well as due to the variability from one syndrome to another.

[0009] Nevertheless, some attempts have been made to find appropriate therapies for MDDS caused by dNTP metabolism defects in which dNTP availability is known to be impaired. For example, recent experimental studies have shown that mtDNA loss can be overcome by bypassing the defective steps in deoxyribonucleotide biosynthesis. Specifically, it has been reported that the addition of purine dN monophosphate (dNMP) can rescue mtDNA loss in TK2-KO mice [1]. In addition, Camara Y. et al. [2] reported that the use of specific inhibitors of deoxyribonucleosides and / or their catabolism may be an effective pharmacological approach for treating different MDDS caused by defects in dNTP homeostasis.

[0010] Despite efforts, there remains a need for treatments for these and other MDDS variants. Summary of the invention

[0011] The present inventors have discovered that administration of deoxyribonucleosides allows restoration of mtDNA levels in MDDS diseases that are not caused by defects in dNTP metabolism.

[0012] To date, it has been generally believed that the administration of nucleosides is only effective in treating mitochondrial diseases caused by defects in dNTP metabolism. In fact, the prior art has assumed that diseases caused by defects in dNTP metabolism can be overcome by administering "defective" nucleosides [2]. Therefore, until now, it was expected that only diseases caused by a specific nucleotide defect could be treated by administering a sufficient amount of the "defective" nucleotide / nucleoside in question.

[0013] Contrary to the teachings of the prior art, the inventors administered deoxyribonucleosides to fibroblast samples from patients previously diagnosed with MDDS, which carried certain mutations affecting the catalytic subunit of polymerase gamma protein 1 (an enzyme involved in the mtDNA replication machinery). It was surprisingly found that administration of deoxyribonucleosides to those samples restored mtDNA levels to "normal" (healthy) levels, regardless of the mutations carried by the patient (see Table 3 below). Unexpectedly, by administering the same degree of deoxyribonucleosides to all three patient-derived cells, the functional abnormalities of the POLG1 enzyme caused by different mutations (which ultimately negatively affect the correct function of the replication machinery) can be overcome. This suggests that restoration of mtDNA levels by administration of deoxyribonucleosides is unrelated to mutations that cause defects in the mtDNA replication machinery.

[0014] Therefore, a first aspect of the present invention provides a composition comprising one or more standard deoxyribonucleosides for treating mitochondrial DNA loss and / or deficiency syndrome, provided that the syndrome is not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism. This aspect can also be formulated as the use of a composition comprising one or more standard deoxyribonucleosides in the preparation of a medicament for treating mitochondrial DNA loss and / or deficiency syndrome, provided that the syndrome is not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism. Alternatively, this aspect can be formulated as a method for treating mitochondrial DNA loss and / or deficiency syndrome not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism, the method comprising administering an effective therapeutic amount of one or more standard deoxyribonucleosides to a subject in need thereof.

[0015] Experimental data were obtained in cells derived from patients suffering from different clinical manifestations due to POLG deficiency.

[0016] POLG is a gene encoding the catalytic subunit of mitochondrial DNA polymerase (called DNA polymerase γ). In eukaryotic cells, mitochondrial DNA is replicated by DNA polymerase γ, which is a trimeric protein complex composed of a catalytic subunit of 140kDa encoded by the POLG gene and a dimeric auxiliary subunit of 55kDa encoded by the POLG2 gene. The catalytic subunit contains three kinds of enzyme activities, i.e., DNA polymerase activity, 3'-5' exonuclease activity for correcting misincorporated nucleotides, and 5'-dRP lyase activity required for base excision repair. In the example provided below, the patient suffers from POLG defects caused by mutations in the exonuclease or polymerase domain (R309C (in the exonuclease domain) and G848S and V1177L (in the polymerase domain)) and in the linker region (W748S).

[0017] The inventors surprisingly found that administration of deoxyribonucleosides "worked" for all tested POLG mutations, and that, regardless of whether the mutation affected the function or structure of POLG, the enzymatic activity of the mutant POLG forms was significantly improved to the extent that mtDNA levels were restored and of the same order of magnitude as those shown by healthy subjects. That is, administration of deoxyribonucleosides overstimulated POLG enzyme forms that were partially lacking polymerase activity prior to said administration.

[0018] The experimental data presented below (summarized in Table 3 below) allow to infer that the administration of deoxyribonucleosides is sufficient to accelerate the rate of mtDNA polymerization, regardless of the mutation in the POLG gene. Moreover, these findings also suggest that any other MDDS disease, known to be characterized by a reduction in mtDNA (due to a reduction in the number of mtDNA copies or by multiple mtDNA deletions) and due to mutations in proteins from the replication machinery itself (POLG1, POLG2, which encode auxiliary units of polymerase gamma; PEO1, MGME1 and DNA2, etc.) or proteins indirectly involved in mtDNA replication (such as MPV17), can also be effectively treated by overstimulating POLG enzyme activity through the administration of deoxyribonucleosides: by enhancing POLG activity, mtDNA levels are significantly increased, which can "neutralize" the loss of mtDNA, regardless of the cause of the loss (specific mutations in a specific protein), and restore "normal" levels.

[0019] Therefore, dN-based therapeutic strategies may partially or fully counteract mtDNA depletion in any defect where mtDNA replication is challenged by providing partially or fully active polymerase activity.

[0020] It can also be inferred from the experiments shown below that the restoration of mitochondrial DNA levels may be independent of the severity of the patient's disease, which gives great therapeutic value to the present invention.

[0021] Other advantages of the present invention related to the administration of deoxyribonucleosides in the treatment of MDDS subjects are cost (cheap) and no special requirements for their storage. In addition, standard deoxyribonucleosides are natural compounds commonly found in all living organisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Amino acids of POLG1 protein according to NCBI database. The following mutations are highlighted: at position 309 -> arginine to cysteine, at position 748 -> tryptophan to serine, at position 848 -> glycine to serine, at position 1143 -> glutamic acid to glycine, at position 1177 -> valine to leucine.

[0023] Figure 2: indicates metabolic pathways involved in mitochondrial DNA depletion and deletion syndrome (MDDS). Proteins whose dysfunction is associated with MDDS are marked with the number 1 (involved in dNTP metabolism), the number 2 (belonging to the replication machinery), or the number 3 (associated with MDDS through an unknown pathological mechanism). Although the association of SUCLA2 and SUCLG1 with nucleotide diphosphate kinases has been documented, their relationship with dNTP metabolism has not been clearly demonstrated. Other proteins involved in dNTP metabolism but not yet associated with MDDS and specific inhibitors of deoxyribonucleoside degrading enzymes have also been described: tetrahydrouridine (THU); 5-chloro-6-[1-(2-iminopyrrolidinyl)methyl]uracil hydrochloride (TPI), immunocin (Immucilin) ​​H (IH) and erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA). Abbreviations: ABAT: 4-aminobutyrate aminotransferase; ADA: adenosine deaminase; ANT1: adenine nucleotide translocator 1; CDA: cytidine deaminase; cdN: cytosolic deoxyribonuclease; dAdo: deoxyadenosine; dCK: deoxycytidine kinase; dCTD: dCMP deaminase; dCtd: deoxycytidine; dGK: deoxyguanosine kinase; dGuo: deoxyguanosine; dIno: deoxyinosine; DNA2: DNA replication helicase 2; dThd: thymidine; dUrd: deoxyuridine; ENT1: equilibrative nucleoside transporter 1; FBXL4: F-box and leucine repeat-rich protein 4; mdN: mitochondrial deoxyribonuclease; MFN2: mitochondrial fusion protein (Mitofusin)-2; MGME 1: mitochondrial genome maintenance exonuclease 1; MPV17: inner mitochondrial membrane MPV17; NDPK: nucleotide diphosphate kinase; NMPK: nucleotide monophosphate kinase; OPA1: optic atrophy 1; PNP: purine nucleoside phosphorylase; POLG1: polymerase gamma subunit 1; POLG2: polymerase gamma subunit 2; RNR: ribonucleotide reductase; SAMHD1: protein containing SAM domains and HD domains 1; SUCLA2: β-subunit, succinate-CoA ligase; SUCLG1: α-subunit, succinate-CoA ligase; TK1: thymidine kinase 1; TK2: thymidine kinase 2; TP: thymidine phosphorylase; TS: thymidylate synthase; Twinkle: mitochondrial Twinkle helicase.

[0024] Figure 3 Figure : Experimental design followed to determine mtDNA levels in cells collected at indicated times (t0, t7, t14, t21, and t26). The stability of dN was monitored in the cell culture medium after 2-3 days of culture (t16-t17). DETAILED DESCRIPTION

[0025] The present invention is based on the discovery that restoration of mtDNA levels can be achieved when deoxyribonucleosides are administered to patients suffering from MDDS caused by defects other than defects in dNTP metabolism.

[0026] Nucleosides are glycosylamines that can be considered as nucleotides without a phosphate group. Nucleosides consist only of a nucleobase (also called a nitrogenous base) and a 5-carbon sugar (ribose or deoxyribose), while nucleotides consist of a nucleobase, a pentose sugar, and one or more phosphate groups. In a nucleoside, the base is bound to the ribose or deoxyribose by a β-glycosidic bond. Examples of nucleosides include cytidine, uridine, adenosine, guanosine, thymidine, and inosine.

[0027] As already explained above, MDDS diseases are a group of diseases caused by defects in mitochondrial DNA (mtDNA) replication and include diseases characterized by reduced mtDNA copy number (mtDNA depletion syndrome) or multiple mtDNA deletions (mtDNA deletion syndrome). They are well-known entities in orphaned and online human Mendelian inheritance directories (which are reference sites for technicians in these types of pathology).

[0028] This group of mitochondrial diseases constitutes a well-known group of diseases caused by mutations in a defined group of genes and is therefore well known to mitochondrial disease specialists. In some cases, the names of this group of diseases may be variable: mtDNA depletion and deletion syndromes [3,4]; intergenic communication (or signaling) defects [5]; mtDNA replication defects [6]; etc. Two or more of these names sometimes coexist in the same publication.

[0029] Diseases caused by defects in mtDNA replication can be attributed to mutations in:

[0030] A-genes encoding proteins belonging to the mtDNA replication machinery (in Figure 2 Marked with the number "2" in the middle)[7,8,9,10,11]

[0031] B-Genes encoding proteins involved in nucleoside / nucleotide catabolism or anabolism (in Figure 2 Marked with number "1" in the middle)[12,13,14,15]

[0032] C - Genes encoding proteins with unknown functions or whose functions do not belong to class A or B and cannot be biochemically linked to the mtDNA replication process (in Figure 2 (marked with the number "3") [16,17,18,19,20,21,22,23,24]

[0033] This classification has been clearly recognized by those skilled in the art [3,4,6,25,26,27].

[0034] dNTPs are required as substrates for DNA synthesis at the replication fork. Mammalian cells obtain precursors for DNA synthesis and repair from two different metabolic sources (cytoplasmic de novo synthesis and salvage pathways), which are based on two sets of parallel enzymes located in the cytoplasm and mitochondrial matrix. When the cell's demand for DNA precursors is highest, the synthesis of dNTPs is coupled to nuclear DNA replication. Once the replication period (S phase) is over, or in non-dividing cells, the dNTP pool is significantly reduced. De novo synthesis is based on the cytoplasmic activity of ribonucleotide reductase (RNR) (in addition to dTMP, which has recently been identified as mitochondrial thymidylate synthase). RNR catalyzes the allosteric equilibrium reduction of all four ribonucleoside diphosphates to the corresponding deoxyribonucleosides (dN), providing cells with high concentrations of dNTPs during the S phase of the cell cycle. RNR is a heterotetramer containing two copies of a large subunit (R1) and two small subunits (R2 or p53R2). While R2 undergoes proteasome-dependent degradation in late mitosis, p53R2 is present throughout the cell cycle and its expression remains stable also in non-dividing cells. Unlike nuclear genome replication, mtDNA synthesis occurs independently of cell division. Although the cytoplasmic de novo synthesis supported by p53R2 during S phase is much lower than that provided by R2, it has been shown to be essential for mtDNA maintenance due to mtDNA depletion caused by mutations in the p53R2 gene.

[0035] The salvage synthesis pathway is based on sequentially phosphorylating precursor nucleosides into dNMP, dNDP and final dNTP. The first and rate-limiting step in this pathway is irreversibly catalyzed by deoxynucleoside kinase. Thymidine kinase 1 (TK1) and deoxycytidine kinase (dCK) work in the cytoplasm, while thymidine kinase 2 (TK2) and deoxyguanosine kinase (dGK) are located in mitochondria. Mutations in mitochondrial kinases involved in the salvage pathway cause severe MDDS, proving that mitochondria rely on the salvage supply of dNTP for its DNA maintenance and repair. Additional nucleotide kinases complete the phosphorylation of all four dNMPs into the final corresponding dNTP required for DNA synthesis. Cytoplasm and mitochondrial matrix are independent compartments, but they actively communicate, bidirectionally exchanging pool components across the inner mitochondrial membrane by carriers that have not been well characterized so far. Due to this cross-connection, it is believed that the change in dNTP pool size occurs in parallel in two compartments. Therefore, in post-mitotic cells (wherein the cytoplasmic pool has been greatly reduced), mitochondria become more susceptible to damage for the defect of its own salvage supply of dNTP.

[0036] The size of the dNTP pool depends on the balance between the above-mentioned anabolic pathways, the rate of incorporation into DNA, and the catabolic processes leading to dNTP degradation.

[0037] dNTPs are required at the replication fork as substrates for integration into DNA by the mitochondrial polymerase gamma (POLG). Although the exact mode of mtDNA replication is currently controversial, the rudimentary mitochondrial replisome formed by polymerase gamma (composed of a catalytic subunit encoded by POLG1 and two auxiliary subunits encoded by POLG2), the Twinkle helicase and the single-strand binding (SSB) protein has been reconstituted in vitro

[28] . Other less well-characterized activities are essential for the complete in vivo replication of mtDNA molecules (e.g., primases, topoisomerases) and for the initiation and regulation of processes in response to different stimuli and stresses. Some examples are the MGME1 and DNA2 genes encoding proteins that are involved in the replication process to some extent (maturation of 7S RNA, helicase activity, respectively) and whose mutations have recently been associated with MDDS.

[0038] In one embodiment, treatment of the syndrome is achieved by increasing polymerase gamma activity.

[0039] In one embodiment, one or more deoxyribonucleosides are standard deoxyribonucleosides. Advantageously, by using such deoxyribonucleosides, since metabolites do not need to be additionally processed, effects can be obtained earlier. In addition, since standard deoxyribonucleosides are substantially the same as endogenous deoxyribonucleosides, the risk of side effects associated with the treatment of the disease can be reduced.

[0040] In one embodiment of the first aspect of the invention, the syndrome is caused by a defect in the mitochondrial DNA replication machinery.

[0041] In another embodiment of the first aspect of the invention, the defect is caused by one or more mutations in one or more proteins of the mitochondrial DNA replication machinery.

[0042] In yet another embodiment, the protein is selected from the group consisting of DNA polymerase subunit gamma-1 (POLG1), DNA polymerase subunit gamma-2 (POLG2), Twinkle protein (PEO1), mitochondrial genome maintenance exonuclease 1 (MGME1) and human helicase / nuclease DNA2 protein. In another embodiment, the protein is DNA polymerase subunit gamma-1 (POLG1) and Twinkle protein.

[0043] Polymerase γ is a heterotrimer composed of a catalytic subunit (encoded by POLG1) and two auxiliary subunits (encoded by POLG2) that act as processivity factors and regulators of DNA binding. Its accession number in the NCBI database is NP_001119603.1 (also known as Figure 1 and SEQ ID NO: 1).

[0044] POLG-related disorders present with a continuum of broad and overlapping phenotypes that present from early childhood to late adulthood. Clinical phenotypes of POLG-related disorders include: autosomal recessive and dominant adult-onset PEO, myoclonic epilepsy, myopathy, sensory ataxia (MEMSA) syndrome, ataxia-neuropathy spectrum (including mitochondrial recessive ataxia syndrome (MIRAS) and sensory ataxia), neuropathy, dysarthria, ophthalmoplegia (SANDO) syndrome, and hepatocerebral MDS (Alpers-Huttenlocher syndrome). Recently, POLG mutations have been identified in individuals with clinical features of MNGIE but without leukoencephalopathy.

[0045] The incidence of Alpers-Huttenlocher syndrome is estimated to be approximately 1:50,000. This is the most severe phenotype associated with POLG mutations and is characterized by progressive encephalopathy with intractable epilepsy and psychomotor retardation, neuropathy, and liver failure. Affected individuals typically present between the ages of 2 and 4 years with seizures (focal, generalized, myoclonic, epilepsy continua, or status epilepticus), headaches usually associated with visual auras or visual halos, hypotonia, and psychomotor deterioration. Areflexia and hypotonia are present early in the disease, followed by spastic paraplegia that develops over months to years, leading to psychomotor decline. Affected individuals develop liver dysfunction with elevated transaminases, hypoproteinemia, coagulopathy, hypoglycemia, and hyperammonemia. Liver involvement may progress rapidly to end-stage liver failure over a period of months. CSF protein is generally elevated. Neuroimaging may show gliosis and global brain atrophy. Liver histology may show macro- and microvesicular steatosis, centrilobular necrosis, fibrosis, cirrhosis, bile duct proliferation, and mitochondrial hyperplasia. The mtDNA content in the liver is decreased. Disease progression is variable, and life expectancy ranges from 3 months to 12 years from symptom onset.

[0046] In one embodiment, mitochondrial DNA depletion and / or deletion syndrome is caused by defects in the mitochondrial replication pathway caused by one or more of the following mutations in the POLG1 protein: arginine to cysteine ​​at position 309

[29] , tryptophan residue at position 748 to serine (rs113994097), glycine to serine at position 848 (rs113994098), glutamate to glycine at position 1143 (rs2307441), and valine to leucine at position 1177.

[0047] Alternatively, in another embodiment of the first aspect of the invention, the defect is caused by one or more mutations in one or more proteins selected from the group consisting of: ANT1, MPV17, SUCLA2, FBXL4, ABAT, SUCLG1, MFN2 and OPA1. In another embodiment of the first aspect, the defect is caused by one or more mutations in a protein selected from the group consisting of: OPA1, SUCLA2 and SUCLG1.

[0048] In another embodiment, the one or more deoxyribonucleosides are standard deoxyribonucleosides. In another embodiment, the one or more deoxyribonucleosides are selected from the group consisting of: deoxyadenosine, deoxyguanosine, deoxycytidine and deoxythymidine. In another embodiment, the composition comprises four kinds of standard deoxyribonucleosides. The composition comprises four kinds of standard deoxyribonucleosides and does not contain any other nucleosides (this means that the composition uniquely comprises these four kinds of deoxyribonucleosides as "deoxyribonucleoside components", but can include excipients, carriers, etc.). In another embodiment, the composition comprises deoxyadenosine, deoxythymidine, deoxycytidine and deoxyguanosine. In another embodiment, the composition comprises deoxyadenosine, deoxythymidine, deoxycytidine and deoxyguanosine, and does not contain any other nucleosides (this means that the composition uniquely comprises these four kinds of nucleosides as "nucleoside components", but can include excipients, carriers, etc.).

[0049] One skilled in the art will be able to determine the amount of each deoxyribonucleoside used to restore mtDNA levels (ie, a therapeutically effective amount to improve signs and symptoms of mitochondrial disease). In another embodiment, when the composition comprises more than one standard deoxyribonucleoside, the nucleosides are present in an equimolar ratio.

[0050] In one embodiment, the composition comprises a combination of deoxyadenosine (dAdo), deoxycytidine (dCtd), deoxyguanosine (dGuo), and deoxythymidine (commonly referred to as thymidine, dThd), all nucleosides in equimolar ratios.

[0051] In another embodiment, the composition further comprises one or more pharmaceutically acceptable nucleoside degradation inhibitors.

[0052] There are well-known nucleoside degradation inhibitors in the prior art. Illustrative non-limiting examples are: Inmucilin H or Forodesine as dGuo degradation inhibitors, tetrahydrouridine as dCtd degradation inhibitors, 5-chloro-6-[1-(2-iminopyrrolidinyl)methyl]uracil hydrochloride (TPI) as dThd degradation inhibitors, and erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) as dAdo degradation inhibitors. Figure 1The modes of action of these inhibitors are shown.

[0053] One skilled in the art will be able to determine the amount of inhibitor necessary to ensure restoration of nucleoside bioavailability at the mtDNA level.

[0054] In one embodiment, the composition further comprises a pharmaceutically acceptable nucleoside degradation inhibitor. In another embodiment, the pharmaceutically acceptable inhibitor is a deoxyadenosine degradation inhibitor. In another embodiment, the inhibitor is erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA).

[0055] For use herein, the active ingredients described can be formulated with pharmaceutically suitable excipients or carriers, which are selected to make the composition suitable for delivery by oral, rectal, parenteral (e.g., intravenous, intramuscular, intraarterial and intraperitoneal, etc.) or inhalation routes, osmotic pumps, topical and ocular, etc.

[0056] Ointments are semisolid preparations consisting of the active ingredient incorporated into a fatty, waxy or synthetic base.

[0057] Examples of suitable creams include, but are not limited to, water-in-oil and oil-in-water emulsions. Water-in-oil creams can be formulated using suitable emulsifiers having similar properties to fatty alcohols such as cetyl alcohol or cetearyl alcohol or to emulsifying waxes (but not limited thereto). Oil-in-water creams can be formulated using emulsifiers (e.g., cetomacrogol emulsifying waxes). Suitable properties include the ability to change the viscosity of the emulsion and physical and chemical stability over a wide range of pH. Water-soluble or miscible cream bases can contain a preservative system or can be buffered to maintain an acceptable physiological pH.

[0058] In addition to the topical administration methods described above, there are various methods for systemic administration of the compounds of the invention. One such means involves an aerosol suspension of respirable particles consisting of the active compound, which can be inhaled by the subject. The active compound will be absorbed into the bloodstream through the lungs and contact the systemic circulation in a pharmaceutically effective amount. The respirable particles can be liquid or solid, and their particle size is small enough to pass through the mouth and throat when inhaled.

[0059] Another means of systemically administering the active compound to a subject would involve administering a liquid / liquid suspension in the form of nasal drops of a liquid formulation or a nasal spray of inhalable particles that the subject inhales. Liquid pharmaceutical compositions of the active compound for the preparation of nasal sprays or nasal drops can be prepared by combining the active compound with a suitable carrier, such as sterile pyrogen-free water or sterile saline, by techniques known to those skilled in the art.

[0060] Another means of systemically administering the active compound to a subject would involve administering a liquid / liquid suspension in the form of nasal drops of a liquid formulation or a nasal spray of respirable particles that the subject inhales. Liquid pharmaceutical compositions of the active compound for the preparation of nasal sprays or nasal drops can be prepared by combining the active compound with a suitable carrier, such as sterile pyrogen-free water or sterile saline, by techniques known to those skilled in the art.

[0061] Other means of systemic administration of the active compound will involve oral administration, wherein the pharmaceutical composition containing the compound of formula I is in the form of solids, solutions, emulsions, dispersions, micelles and liposomes, and wherein the resulting preparation contains the active compound contemplated for use herein, mixed with an organic or inorganic carrier or excipient suitable for intranasal, enteral or parenteral application. The active ingredient can be mixed with a generally nontoxic, pharmaceutically or physiologically acceptable carrier for tablets, pills, capsules, lozenges, pastilles, aqueous or oily suspensions, dispersible powders or granules, suppositories, solutions, emulsions, suspensions, hard or soft capsules, caplets or syrups or elixirs and any other form suitable for use. Carriers that can be used include gum arabic, gelatin, mannitol, starch paste, magnesium trisilicate, talc, corn starch, keratin, colloidal silicon dioxide, potato starch, urea, medium chain triglycerides, dextran and other carriers suitable for solid, semisolid or liquid form preparations. Additionally, adjuvants, stabilizers, thickeners and colorants may be used.The active compounds contemplated for use herein are included in the pharmaceutical formulations in an amount sufficient to produce the desired effect upon administration (ie, a therapeutically effective amount).

[0062] Powders, solutions, suspensions or tablets contain the active compound in a physiologically compatible carrier that can be selected by a person skilled in the art of oral delivery system development using conventional criteria. For example, such preparations may contain one or more agents selected from the following: flavoring agents (such as peppermint, wintergreen oil or cherry oil), coloring agents and preservatives, etc., to provide pharmaceutically high-quality and palatable preparations. Tablets containing the active ingredient mixed with non-toxic pharmaceutically acceptable excipients can also be manufactured by known methods. The excipients used can be, for example: (1) inert diluents, such as calcium carbonate, lactose, calcium phosphate and sodium phosphate, etc.; 2) granulating agents and disintegrants, such as corn starch, potato starch and alginic acid, etc.; (3) binders, such as tragacanth, corn starch, gelatin and gum arabic, etc.; and (4) lubricants, such as magnesium stearate, stearic acid and talc, etc. The tablets can be uncoated, or they can be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained effect over a longer period of time. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.

[0063] When the preparation for oral use is in the form of hard gelatin capsules, the active ingredient can be mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, etc. They can also be in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium such as peanut oil, liquid paraffin or olive oil, etc.

[0064] Another means of systemically administering the active compounds to a subject would involve administering the active compounds in suppository form so that a therapeutically effective amount of the compound reaches the systemic circulation.

[0065] The daily dose for ameliorating the signs and symptoms of mitochondrial disease may be administered in divided or multiple unit doses, depending on the solubility of the particular formulation of active compound being administered.

[0066] Throughout the specification and claims, the word "comprising" and variations of the word are not intended to exclude other technical features, additives, components or steps. In addition, the word "comprising" covers the situation of "consisting of . . . ". Other objects, advantages and features of the present invention will become apparent to those skilled in the art by studying this specification, or can be learned by practicing the present invention. The following examples are provided for illustration, and they are not limitations of the present invention. In addition, the present invention covers all possible combinations of the specific preferred embodiments described herein.

[0067] Example

[0068] 1. Methods

[0069] patient

[0070] Cells derived from three patients with POLG deficiency were included in the study. All subjects gave informed consent in accordance with our institutional review board and the Declaration of Helsinki. Mutations in POLG (RefSeqNP_001119603.1) were identified in all three patients by Sanger sequencing. Total DNA was isolated from fibroblasts using QiaAMP Mini (Qiagen), and a fragment of approximately 500 bp containing the mutation site of interest was amplified by conventional PCR using the following primer pairs and rTaq (Takara) listed below:

[0071] The primers used were:

[0072] Primer 1 (R309C, 925c->t)

[0073] Forward primer GTCCACACCACCAAGCAGT (SEQ ID NO: 2)

[0074] Reverse primer GGTCCCAAGCACTATGCTCC (SEQ ID NO: 3)

[0075] Primer 2 (W748S c.2243G->C)

[0076] Forward primer CCTTGCTGAATGCAGGTGCT (SEQ ID NO: 4)

[0077] Reverse primer TGTGCCTGAAATCACACTCTGT (SEQ ID NO: 5)

[0078] Primer 3 (G848S c.2542G->A)

[0079] Forward primer ATGGTCTGCTGAGTGGTTGT (SEQ ID NO: 6)

[0080] Reverse primer CCCTCAGAGCCCAGTTTCTAC (SEQ ID NO: 7)

[0081] Primer 3 (E1143G c.3428A->G)

[0082] Forward primer CCCAGTTTATGACCAGCCGT (SEQ ID NO: 8)

[0083] Reverse primer CAAGGAACGCTCACCCAAAG (SEQ ID NO: 9)

[0084] Primer 4 (V1177L c.3529G->C)

[0085] Forward primer AGGGGAAGCCCTGCTCTAAG (SEQ ID NO: 10)

[0086] Reverse primer ACAAATGTGTTGTGCTCACCC (SEQ ID NO: 11)

[0087] Sequencing reactions were performed using the same primers and BigDye v3.1 sequencing kit (Life Technologies), purified by BigDye X-Terminator purification kit (Life Technologies), and sequenced in an ABI 3130 sequencer (Applied Biosystems). Patient 1 (homozygous for the p.R309C mutation) suffered from a severe neurological phenotype (neuropathy, encephalopathy, MNGIE-like) leading to death at the age of 20 years; patient 2 (compound heterozygous for the p.W748S and p.G848S mutations) suffered from a less severe phenotype, but also mainly neurological (neuropathy, psychotic symptoms, MNGIE-like); patient 3 (heterozygous for two dominant amino acid changes in cis p.V1177L and p.E1143G) presented with the familiar PEO dominant inheritance pattern (progressive external ophthalmoplegia), psychotic symptoms, and proximal muscle weakness. Skeletal muscle from all three patients demonstrated accumulation of mitochondrial DNA deletions, but without significant loss.

[0088] Cell culture

[0089] Primary cultured fibroblasts were obtained from skin biopsies of patients 1–3 and 4 healthy donors. All subjects gave informed consent in accordance with our institutional review board and the Declaration of Helsinki.

[0090] Cells were seeded in 9.5 cm2 tubes in Dulbecco's modified Eagle's medium (DMEM) in a humidified incubator at 37°C and 5% CO2. 2In 6-well plates, the DMEM has 4.5g / L glucose and is supplemented with 2mM L-glutamine, 100U / mL penicillin and streptomycin and 10% dialyzed fetal bovine serum (FBS) (Invitrogen). After reaching tight confluence, FBS is reduced to 0.1% to induce rest, and simultaneous treatment with 5ng / ml EtBr (ethidium bromide, Merck) is started (day 0, t0). The cell culture medium is replaced with the same treatment every 2-3 days for two weeks. On the 14th day (t14), EtBr is withdrawn from the cell culture medium, and a group containing all cells is started with 200μM of all four deoxynucleosides (dN): dAdo (deoxyadenosine, Sigma), dCtd (deoxycytidine, Sigma), dGuo (deoxyguanosine, Sigma), dThd (deoxythymidine, Sigma) and 5μM EHNA (Sigma). One group of cells is not treated, and all parameters are monitored in parallel. The cell culture medium was changed every 2-3 days by the same treatment for another 12 days. On day 16 or 17, the culture medium was collected and stored at -20°C until further use. For DNA analysis, cells were harvested by trypsin digestion on days 0, 7, 14, 21 and 26, washed with phosphate-buffered saline, pelleted and stored at 20°C until DNA isolation ( Figure 2 Total DNA was isolated using the QiaAMP DNA mini kit (Qiagen).

[0091] Evaluation of the stability of deoxynucleosides in cell culture media

[0092] The Acquity UPLC-MS / MS instrument (Acquity UPLC-Xevo TM dN and some related metabolites were measured by liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS) using a 100 μM HPLC-MS / MS (TQ Mass Spectrometer, Waters, Milford, MA) as previously described [2]. Cell culture media were deproteinized by ultrafiltration (3 kDa Amicon Ultra filters, Millipore) at 14,000 × g and 4 °C for 30 min and then injected into the LC-MS / MS system.

[0093] mtDNA Survey

[0094] The copy number of mtDNA was assessed by quantitative PCR as described previously [2].

[0095] mtDNA deletions were investigated by long-range PCR blotting according to the PCR conditions and primers published by Nishigaki et al.

[30] :

[0096] Forward primer (F1142-1516): ACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGG (SEQ ID NO: 12)

[0097] Reverse primer (R1180-1146): ACCGCCAGGTCCTTTGAGTTTTAAGCTGTGGCTCG (SEQ ID NO: 13)

[0098] 2. Results

[0099] EtBr exposure induces greater mtDNA depletion in POLG-deficient quiescent fibroblasts

[0100] When testing the potential treatment of mtDNA loss, an important limitation is that in many cases, cells from MDDS patients do not show any mtDNA abnormalities in cell culture. For this reason, different models have been developed to demonstrate the molecular defects that affect mtDNA replication. In the prior art, EtBr exposure has been repeatedly used to force the mtDNA loss in cultured cells and analyze their ability to restore normal mtDNA levels (Pontarin et al., "Mammalianribonucleotide reductase subunit p53R2 is required for mitochondrial DNA replication and DNA repair in quiescent cells", 2012, PNAS, v.109 (33), pages 13302-13307). By being exposed to 5ng / ml EtBr for 14 days, mtDNA loss was induced in healthy controls and in POLG defective resting cells. Obvious mtDNA loss was observed in all cells. However, all POLG-deficient cells experienced a higher degree of mitochondrial DNA depletion than observed in fibroblast cell lines obtained from healthy controls (mean percentage of residual mtDNA level ± SE: 17.5 ± 2.3%; in control cells: 39.68 ± 6.6%). These data suggest that the molecular defects caused by POLG mutations can aggravate the interference of EtBr with the replication process.

[0101] When treated with a combination of dN plus EHNA, POLG-deficient fibroblasts fully recovered after forced depletion of EtBr. mtDNA levels

[0102] After EtBr cessation, the effect of supplementing the cell culture medium with all four dNs on the recovery of mtDNA levels was investigated. dAdo has previously been reported to be particularly sensitive to extracellular and intracellular enzymatic degradation, primarily by ADA (adenosine deaminase) [2]. Therefore, in order to exert a partial inhibition of dAdo catabolism and improve its stability, the culture medium was supplemented with equimolar concentrations of all four standard dNs (200 μM dGuo, dAdo, dThd and dCtd) plus 5 μM EHNA (Sigma). On days 16-17, the concentrations of the added dNs and some of their derived metabolites were measured in the conditioned medium from days 2-3, following a protocol identical to the one disclosed in Cámara Y. et al., 2014 [2]. Although partially degraded, in all cases the concentrations of all dNs remained above 70% of the initial addition (Table 2). No significant differences in dN stability were observed between the conditioned medium from control or patient-derived cells.

[0103] Table 2: Compound concentrations in culture medium after 2-3 days of treatment

[0104] Comparison patient dCtd 168.9±27.4 196±24.0 dU 46.7±27.6 6.2±3.4 dT 154.8±9.1 153.9±10.2 Thymine 48.4±17.3 36.4±10.2 dGuo 171.6±17.9 173.3±16.5 Guanine 71.0±27.5 57.9±12.1 dAdo 140.4±15.7 142.9±17.5 dIno 50.7±22.1 30.7±10.7 Hypoxanthine 23.7±8.8 22.7±8.3

[0105] Results are mean ± SD from three different POLG-deficient and four control cell lines. dUrd: deoxyuridine; dIno: deoxyinosine.

[0106] The rate of mtDNA recovery was monitored before and after EtBr withdrawal in the presence or absence of dN supplementation (following a protocol identical to that of Cámara Y. et al., 2014 [2]). The mtDNA copy number from control cells reached values ​​above 100% of the initial level 12 days after EtBr withdrawal, regardless of dN treatment (mean percentage of mtDNA residual level ± SE: untreated 129.8 ± 35.2%; treated 153.9 ± 40.6%). In contrast, POLG-deficient cells were unable to recover normal mtDNA levels (26.6 ± 1.5%) unless supplemented with dN.

[0107] Table 3: mtDNA levels in quiescent fibroblasts at different time points during the experiment.

[0108]

[0109]

[0110] Values ​​are expressed as percentage relative to the mtDNA copy number at day 0. After EtBr-induced depletion, cells were treated or not with dNs+EHNA starting from day 14 of the experiment.

[0111] The results shown in Table 3 allow the conclusion that the administration of standard nucleosides allows the achievement of mtDNA levels in MDDS patients comparable to those in healthy subjects (150.3±21.9%, Table 3). Therefore, this data indicates that in patients suffering from MDDS caused by defects other than dNTP metabolism defects, the administration of nucleosides can restore mtDNA levels to levels associated with a "healthy" condition, indicating the therapeutic potential of the combination in the treatment of this disease.

[0112] References cited in this application

[0113] 1.Garone C, Garcia-Diaz B, Emmanuele V, Lopez LC, Tadesse S, et al. (2014) Deoxypyrimidine monophosphate bypass therapy for thymidine kinase2deficiency. EMBO Mol Med 6:1016-1027.

[0114] 2. Camara Y, Gonzalez-Vioque E, Scarpelli M, Torres-Torronteras J, Caballero A, et al. (2014) Administration of deoxyribonucleosides or inhibition of their catabolism as apharmacological approach for mitochondrial DNAdepletion syndrome. Hum Mol Genet23:2459-2467.

[0115] 3. Camara Y, Gonzalez-Vioque E, Scarpelli M, Torres-Torronteras J, Marti R (2013) Feeding the deoxyribonucleoside salvage pathway to rescue mitochondrialDNA. Drug Discov Today 18:950-957.

[0116] 4.Suomalainen A,Isohanni P(2010)Mitochondrial DNAdepletionsyndromes--many genes,common mechanisms.Neuromuscul Disord 20:429-437.

[0117] 5.Spinazzola A,Zeviani M(2005)Disorders of nuclear-mitochondrialintergenomicsignaling.Gene 354:162-168.

[0118] 6.Copeland WC(2012)Defects in mitochondrial DNA replication and humandisease.Crit Rev Biochem Mol Biol 47:64-74.

[0119] 7.Naviaux RK,Nyhan WL,Barshop BA,Poulton J,Markusic D,et al.(1999)Mitochondrial DNA polymerase gamma deficiency and mtDNA depletion in a childwithAlpers'syndrome.Ann Neurol 45:54-58.

[0120] 8.Hakonen AH,Isohanni P,Paetau A,Herva R,Suomalainen A,et al.(2007)Recessive Twinkle mutations in early onset encephalopathy with mtDNAdepletion.Brain130:3032-3040.

[0121] 9.Kornblum C,Nicholls TJ,Haack TB,Scholer S,Peeva V,et al.(2013)Loss-of-function mutations in MGME1 impair mtDNA replication andcausemultisystemic mitochondrial disease.Nat Genet.

[0122] 10.Ronchi D,Di Fonzo A,Lin W,Bordoni A,Liu C,et al.(2013)Mutations inDNA2Link Progressive Myopathy to Mitochondrial DNA Instability.Am J HumGenet.

[0123] 11.Longley MJ,Clark S,Yu Wai Man C,Hudson G,Durham SE,et al.(2006)MutantPOLG2 disrupts DNA polymerase gamma subunits and causes progressiveexternalophthalmoplegia.Am J Hum Genet 78:1026-1034.

[0124] 12.Mandel H,Szargel R,Labay V,Elpeleg O,Saada A,et al.(2001)Thedeoxyguanosine kinase gene is mutated in individuals with depletedhepatocerebralmitochondrial DNA.Nat Genet 29:337-341.

[0125] 13.Saada A,Shaag A,Mandel H,Nevo Y,Eriksson S,et al.(2001)Mutantmitochondrial thymidine kinase in mitochondrial DNA depletionmyopathy.Nat Genet 29:342-344.

[0126] 14.Bourdon A,Minai L,Serre V,Jais JP,Sarzi E,et al.(2007)MutationofRRM2B,encoding p53-controlled ribonucleotide reductase(p53R2),causes severemitochondrialDNA depletion.Nat Genet 39:776-780.

[0127] 15.Nishino I,Spinazzola A,Hirano M(1999)Thymidine phosphorylasegenemutations in MNGIE,a human mitochondrial disorder.Science 283:689-692.

[0128] 16.Rouzier C,Bannwarth S,Chaussenot A,Chevrollier A,Verschueren A,etal.(2012)The MFN2 gene is responsible for mitochondrial DNA instability andoptic atrophy'plus'phenotype.Brain 135:23-34.

[0129] 17.Renaldo F,Amati-Bonneau P,Slama A,Romana C,Forin V,et al.(2012)MFN2,anew gene responsible for mitochondrial DNA depletion.Brain.

[0130] 18.Ostergaard E,Schwartz M,Batbayli M,Christensen E,Hjalmarson O,etal.(2005)A novel missense mutation in SUCLG1 associated with mitochondrialDNA depletion,encephalomyopathic form,with methylmalonic aciduria.Eur JPediatr 169:201-205.

[0131] 19.Amati-Bonneau P,Valentino ML,Reynier P,Gallardo ME,Bornstein B,etal.(2008)OPA1 mutations induce mitochondrial DNA instability and opticatrophy'plus'phenotypes.Brain 131:338-351.

[0132] 20.Blakely EL,Butterworth A,Hadden RD,Bodi I,He L,et al.(2012)MPV17mutation causes neuropathy and leukoencephalopathy with multiple mtDNAdeletions inmuscle.Neuromuscul Disord 22:587-591.

[0133] 21.Spinazzola A,Viscomi C,Fernandez-Vizarra E,Carrara F,D'Adamo P,etal.(2006)MPV17 encodes an inner mitochondrial membrane protein and is mutatedininfantile hepatic mitochondrial DNA depletion.Nat Genet 38:570-575.

[0134] 22.Wedding IM,Koht J,Tran GT,Misceo D,Selmer KK,et al.(2014)Spasticparaplegia type 7 is associated with multiple mitochondrial DNAdeletions.PLoS One 9:e86340.

[0135] 23.Bonnen PE,Yarham JW,Besse A,Wu P,Faqeih EA,et al.(2013)Mutationsin FBXL4 cause mitochondrial encephalopathy and a disorder of mitochondrialDNA maintenance.Am J Hum Genet 93:471-481.

[0136] 24.Gai X,Ghezzi D,Johnson MA,Biagosch CA,Shamseldin HE,et al.(2013)Mutations in FBXL4,encoding a mitochondrial protein,cause early-onsetmitochondrial encephalomyopathy.Am J Hum Genet 93:482-495.

[0137] 25.Nogueira C,Almeida LS,Nesti C,Pezzini I,Videira A,et al.(2014)Syndromes associated with mitochondrial DNAdepletion.Ital J Pediatr 40:34.

[0138] 26.Copeland WC(2008)Inherited mitochondrial diseases of DNAreplication.Annu Rev Med 59:131-146.

[0139] 27.Copeland WC(2014)Defects of mitochondrial DNA replication.J ChildNeurol29:1216-1224.

[0140] 28.Korhonen JA,Pham XH,Pellegrini M,Falkenberg M(2004)Reconstitutionof aminimal mtDNAreplisome in vitro.Embo J 23:2423-2429.

[0141] 29.Amiot A,Tchikviladze M,Joly F,Slama A,Hatem DC,et al.(2009)Frequency ofmitochondrial defects in patients with chronic intestinal pseudo-obstruction.Gastroenterology 137:101-109.

[0142] 30.Nishigaki Y,Marti R,Hirano M(2004)ND5 is a hot-spot for multipleatypicalmitochondrial DNA deletions in mitochondrial neurogastrointestinalencephalomyopathy.Hum Mol Genet 13:91-101。

Claims

1. A composition comprising one or more deoxyribonucleosides for use in treating mitochondrial DNA depletion and / or deletion syndrome, provided that the syndrome is not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism.

2. The composition according to claim 1, wherein Treatment of the syndrome is achieved by increasing polymerase gamma activity.

3. The composition according to any one of claims 1 to 2, wherein The one or more deoxyribonucleosides are standard nucleosides.

4. The composition according to any one of claims 1 to 3, wherein The syndrome is caused by defects in the mitochondrial DNA replication machinery.

5. A composition as claimed in any one of the preceding claims, wherein The defect is caused by one or more mutations in one or more proteins of the mitochondrial DNA replication machinery.

6. The composition according to claim 5, wherein The one or more proteins are selected from the group consisting of DNA polymerase subunit gamma-1 (POLG1), DNA polymerase subunit gamma-2 (POLG2), Twinkle protein (PEO1), mitochondrial genome maintenance exonuclease 1 (MGME1) and human helicase / nuclease DNA 2 protein (DNA2).

7. The composition according to claim 6, wherein The syndrome is caused by a defect in the DNA polymerase subunit gamma-1 (POLG1) protein.

8. A composition as claimed in any one of the preceding claims, wherein The mitochondrial DNA depletion and deletion syndrome is caused by defects in the mitochondrial replication pathway, which are caused by one or more of the following mutations in the POLG1 protein: R309C, W748S, V1177L, G848S, E1143 and E1143G, the positions of which are referenced to SEQ ID NO:

1.

9. A composition as claimed in any one of the preceding claims, wherein The one or more deoxyribonucleosides are selected from the group consisting of deoxyadenosine, deoxyguanosine, deoxycytidine and deoxythymidine.

10. A composition as claimed in any preceding claim comprising deoxyadenosine, deoxyguanosine, deoxycytidine and deoxythymidine.

Images