5 '-phosphopyridoxal synthase mutant T50W and application thereof in synthesis of 5'-phosphopyridoxal

Abstract

The invention belongs to the field of gene engineering and enzyme engineering, and discloses a 5 '-phosphopyridoxal synthase mutant T50W and application thereof in synthesis of 5'-phosphopyridoxal. According to the present invention, the 50th amino acid of the PLP synthase small subunit PdxT derived from Bacillus licheniformis is mutated from threonine T to tryptophan W through the site-specific mutagenesis manner, and the enzyme activity of the mutant is significantly improved; the invention also provides a recombinant plasmid containing any PLP synthase mutant gene, a recombinant strain and application of the recombinant plasmid and the recombinant strain in production of 5 '-phosphopyridoxal, wherein the yield of PLP synthesized by the mutant PdxSTT50W is increased by 37.4% compared with that of a wild type. The PLP synthase mutant and the engineering strain obtained by the invention have the advantages that the PLP fermentation production capability is greatly improved, and the industrial application prospect is good.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering and gene engineering, and specifically relates to a 5'-pyridoxal phosphate synthase mutant T50W and application thereof in the synthesis of 5'-pyridoxal phosphate. Background Art

[0002] Pyridoxal-5'-phosphate (PLP) is the only metabolically active form of vitamin B6 (VB6) as a coenzyme and is a coenzyme for more than 160 enzymes. PLP can be used as a scavenger of reactive oxygen species, a metal chelator, a molecular chaperone in the enzyme folding process, and can also control the expression and action of steroid hormone receptors and may have a positive effect on immune function; it has high commercial value in medical, food industry, animal husbandry and agricultural production, and has a large market demand.

[0003] At present, the synthesis method of PLP is mainly artificial total synthesis using oxazole chemical synthesis method, but this synthesis method has many problems such as time-consuming and energy-consuming, serious pollution, high cost and low recovery rate. Therefore, it is of great significance to develop a green and sustainable microbial fermentation method to synthesize PLP. Researchers mostly use Escherichia coli or rhizobia to produce VB6, and increase the production of VB6 by endogenous or heterologous expression of related genes. Zhang Dawei's team reconstructed the de novo synthesis pathway of vitamin B6, enhanced the precursor DXP and the intermediate metabolite 4HTP to promote metabolic flow, and strengthened the key genes PdxA and PdxJ in the downstream synthesis pathway. A high-yield Escherichia coli chassis strain with a fermentation yield of 1.4g / L of pyridoxine (PN) was obtained (Liu et al., Nat Commun. 2023Aug 31; 14(1): 5304). Wu Jing's team used Salmonella typhi acid phosphatase (StAPase) and Escherichia coli pyridoxine oxidase (EcPNPO) as pathway enzymes, and pyridoxine (PN) and pyrophosphate (PPi) as substrates to synthesize PLP, with a yield of 15 g / L (Wang et al., J Agric Food Chem. 2024Apr 11). However, the efficiency of E. coli in synthesizing VB6 is low, and endotoxins will be produced, so the use of E. coli as a production strain has certain limitations. In addition, the low catalytic efficiency of natural enzymes and the strict regulation of metabolic pathways hinder the high yield of VB6 in microbial fermentation, making its production level in microbial fermentation still not commercially valuable. Therefore, in order to achieve sustainable commercial production of VB6, a large amount of microbial metabolic engineering research and technological innovation are still needed.

[0004] 5'-Pyridoxal phosphate synthase PdxST is a key enzyme derived from Bacillus that catalyzes the synthesis of PLP. The protein structure of PLP synthase has been resolved. It consists of two subunits, PdxS and PdxT, forming a heterodimer, which then forms a 12-mer to function. Researchers found that the mutation of histidine at position 170 in the active site of the glutaminase subunit PdxT to asparagine can significantly improve the catalytic activity of PdxST. In addition, there is currently no relevant research at home and abroad on the mutation modification of 5'-pyridoxal phosphate synthase. Therefore, to further increase the production of PLP, we need to develop a 5'-pyridoxal phosphate synthase with higher catalytic efficiency and a recombinant strain that efficiently produces PLP. Bacillus licheniformis is a food-safe strain that is used to synthesize substances such as phenylalanine, acetoin, and 2,3-butanediol. However, there is no report on the use of Bacillus licheniformis as a cell factory to synthesize pyridoxal phosphate. Summary of the invention

[0005] The purpose of the present invention is to provide a PLP synthase mutant T50W with improved catalytic performance to solve the problem of low catalytic efficiency of existing PLP synthase. The mutant is shown in SEQ ID NO.4.

[0006] Another object of the present invention is to provide the use of the PLP synthase mutant T50W in producing PLP.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant mutated the 50th amino acid of the wild-type PLP synthase from Bacillus licheniformis DW2 from threonine to tryptophan, and obtained the PLP synthase mutant T50W of the present invention, which is shown in SEQ ID NO.4.

[0009] The protection scope of the present invention includes:

[0010] The gene encoding the protein shown in SEQ ID NO.4.

[0011] An expression vector containing the above gene;

[0012] A recombinant microorganism expressing a protein represented by SEQ ID NO.4;

[0013] The microorganism mentioned above is preferably Bacillus licheniformis, which has the ability to metabolize and produce 5'-pyridoxal phosphate.

[0014] The Bacillus licheniformis mentioned above is preferably Bacillus licheniformis DW2.

[0015] Application of the above substances in the preparation of 5'-pyridoxal phosphate synthase;

[0016] The above application is preferably to insert the gene encoding the protein shown in SEQ ID NO.4 into an expression vector, and transform it into Bacillus licheniformis DW2 for fermentation expression.

[0017] The application of the above substances in the preparation and production of 5'-pyridoxal phosphate.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention mutates the 50th amino acid of PLP synthase from threonine to tryptophan by site-directed mutagenesis, significantly improving the catalytic activity of PLP synthase, and can greatly improve its ability to produce PLP. Through fermentation yield determination and analysis, it is found that compared with wild-type PLP synthase, the PLP synthase mutant T50W of the present invention shows a significantly improved ability to synthesize PLP under fermentation conditions with glucose as the sole carbon source, indicating that it is more suitable for industrial production. Experiments show that the recombinant strain of Bacillus licheniformis expressing the PLP synthase mutant has excellent PLP production capacity. After 60 hours of shake flask fermentation at 37°C, the T50W mutant is 37.4% higher than the control strain to reach 140.53 mg / L, and has better industrial application prospects than the recombinant bacteria containing the unmutated PLP synthase gene. DETAILED DESCRIPTION

[0020] The technical solutions of the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. In order to make the technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific examples, but it does not constitute a limitation of the present invention.

[0021] The culture medium involved in the following examples is as follows:

[0022] LB liquid medium: yeast powder 5g·L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , pH 7.0.

[0023] LB solid medium: yeast powder 5g L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0024] PP liquid culture medium: yeast powder 15g·L -1 、(NH4)2SO4 20g·L -1 、KH2PO4 2g·L-1 、MgSO4·7H2O3g·L -1 、MnSO4 5mg·L -1 , 80g / L glucose, the solvent is deionized water, and the pH value is natural.

[0025] The detection methods involved in the following embodiments are as follows:

[0026] HPLC detection of PLP content:

[0027] The fermentation broth supernatant was filtered with a 0.22 μm microporous filter membrane, and the PLP yield was detected by high performance liquid chromatography (HPLC).

[0028] HPLC operating conditions were as follows: the chromatographic separation column was Hypersil ODS2 C18 (250 mm × 4.6 mm), the UV detection wavelength was 291 nm, the injection volume was 10 μL, the mobile phase A was 100% methanol, the mobile phase B was 0.1% formic acid, the pH was natural, the detection mobile phase was 100% methanol: 0.1% formic acid = 20%: 80%, and the flow rate was 0.6 ml / min.

[0029] The yield of generated PLP was calculated based on the absorption peak area and the peak area of ​​PLP standard.

[0030] Embodiment 1:

[0031] Construction of recombinant plasmid pHY-pdxST:

[0032] The PLP synthase gene pdxST (shown in SEQ ID NO.1, encoding the protein shown in SEQ ID NO.2) was cloned from Bacillus licheniformis DW2 (Bacilluslicheniformis DW2, CCTCC NO: M2011344, CN111321099A) using pdxST-F and pdxST-R. The P43 promoter was amplified using the Bacillus subtilis 168 genome as a template and primers P43-F and P43-R; the amylase terminator TamyL was amplified using primers TamyL-F and TamyL-R. P43-F and TamyL-R were used as primers to perform SOE-PCR on the three fragments of P43, pdxST and TamyL to obtain the fusion fragment P43-pdxST-TamyL. Plasmid pHY300PLK was used as a template, and pHY-T5-F and pHY-T5-R were used as primers for full plasmid PCR amplification to obtain the linearized pHY300PLK vector. After the above amplified products were tested by electrophoresis, the PCR products were purified and recovered using a gel recovery kit. The fusion fragment was fused with the linearized vector pHY300PLK using the ClonExpress II one-step cloning kit to obtain the recombinant plasmid pHY-pdxST. The fused recombinant plasmid pHY-pdxST was transformed into competent E.coli DH5α, and positive colonies were screened on LB plates containing tetracycline. After overnight culture at 37°C in a shaking incubator, the plasmid pHY-pdxST was extracted and sequenced for verification.

[0033] The sequences of the primers are:

[0034] P43-F:TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

[0035] P43-R:TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA

[0036] pdxST-F:GTATACAGTAGGAGATTAATGGCTCAAACAGGTACT

[0037] pdxST-R:ATGATTTATTTTGTTCAGTTATACGACGGCTTCCTG

[0038] TamyL-F:CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT

[0039] TamyL-R:TTTGCCCCAAGCTTCTAGAAGCGCAATAATGCCGTCGCACT

[0040] pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC

[0041] pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT

[0042] Embodiment 2:

[0043] Preparation of wild-type Bacillus licheniformis expressing PLP synthase and enzyme activity determination:

[0044] The plasmid pHY-pdxST sequenced correctly in Example 1 was transformed into Bacillus licheniformis DW2 as a wild-type control strain for the following examples. After selecting the transformants and verifying that they were correct, they were inoculated into LB medium and cultured at 37°C for 12 hours; transferred to TB liquid medium with an inoculum size of 3%, cultured at 37°C for 24 hours, centrifuged to collect the cells, washed twice with PBS, re-dissolved with PBS and added with a final concentration of 0.6 mg·mL -1 The lysozyme was reacted at 37°C for 30 min, then ultrasonically disrupted in ice water (ultrasonic power 25%, time 10 min), 12000 r·min -1 Centrifuge for 5 minutes to obtain the supernatant, which is the crude PLP synthase solution.

[0045] Determination of PLP synthase activity:

[0046] Preparation of substrate solution: 1mM R5P+1mM G3P+5mM glutamine dissolved in 50mM Tris-HCl, pH 9.0; Reaction system: take 1mL of substrate solution in a 1.5mL centrifuge tube, preheat at 37°C for 5min, add 100μL of the obtained PLPase crude enzyme solution, and react for 30min; add 8% TCA to terminate the reaction, centrifuge at 10,000xg for 1min, and detect the amount of PLP generated by HPLC.

[0047] Enzyme activity definition: One unit (U) is defined as the amount of enzyme required to produce 1 nmol / min PLP.

[0048] Embodiment 3:

[0049] Preparation of PLP synthase mutants:

[0050] A site-directed mutagenesis strategy was adopted, and point mutation primers were designed according to the amino acid site to be mutated. The 50th threonine of the PLP synthase small subunit PdxT was mutated to tryptophan, and the base encoding the 50th amino acid of PdxT was split into two parts. The PLP synthase mutant sequence was obtained by PCR.

[0051] Specifically, the pHY-pdxST constructed in Example 1 was used as a template, primers T50W-F and T50W-R were designed, and whole plasmid PCR amplification was performed to obtain a linearized pHY-pdxST with a P43 promoter and an amylase TamyL terminator. T50W The linearized vector pHY-pdxST T50W The recombinant plasmid pHY-pdxST was obtained by backbone self-ligation. T50W Then, the competent E. coli was transformed and coated with a screening plate containing tetracycline. The recombinant plasmid mutant containing a specific mutation site was screened and sequenced for confirmation. The mutant plasmid was named pHY-pdxST T50W .

[0052] T50W-F:GAAAGCTGGACGATGAGGCGCCTCATCGATACG

[0053] T50W-R:CCTCATCGTCCAGCTTTCCCCTCCCGGC

[0054] According to the above method, the applicant also constructed pHY-pdxST M16Y , pHY-pdxST M16W , pHY-pdxST M16L , pHY-pdxST E48R Plasmid as mutant control:

[0055] pHY-pdxST M16Y The expression plasmid is prepared by mutating the 16th methionine of the PdxS subunit of PLP synthase to tyrosine;

[0056] pHY-pdxST M16W An expression plasmid prepared by mutating the 16th methionine of the PdxS subunit of PLP synthase to tryptophan;

[0057] pHY-pdxST M16L The expression plasmid is prepared by mutating the 16th methionine of the PdxS subunit of PLP synthase to leucine;

[0058] pHY-pdxST E48R The expression plasmid was prepared by mutating the 48th glutamic acid of the PdxT subunit of PLP synthase to arginine.

[0059] Embodiment 4:

[0060] Preparation of PLP synthase mutant engineered strains and enzyme activity determination:

[0061] The mutant plasmid sequenced correctly in Example 3 was transformed into Bacillus licheniformis DW2, wherein pHY-pdxST E48R The plasmid was transformed into Bacillus licheniformis DW2 and named as recombinant Bacillus licheniformis DW2 / pHY-pdxST E48R The rest are similar. After selecting and verifying the correct transformants, inoculate them into LB medium and culture them at 37℃ for 12h; transfer them into TB liquid medium with an inoculation volume of 5% and culture them at 37℃ for 24h.

[0062] The enzyme activity of the recombinant strain was detected according to the method in Example 2. The experimental results showed that compared with the control strain, the enzyme activity of the T50W mutant was 10.11 U / mL, which was 2.4 times that of the control strain, but the enzyme activities of the other mutants were lower than those of the control group under the same conditions (Table 1).

[0063] Table 1: Comparison of PLP synthase activity under fermentation conditions between mutants and wild-type control group

[0064]

[0065] Embodiment 5:

[0066] Recombinant strains expressing wild-type and mutant PLP synthase produce PLP from glucose fermentation

[0067] The recombinant Bacillus licheniformis DW2 / pHY-pdxST obtained in Example 4 T50W The recombinant Bacillus licheniformis of other mutants was fermented, and the recombinant strain DW2 / pHY-pdxST obtained in Example 2 was used as a control.

[0068] The specific steps of seed fermentation are as follows: first, recombinant Bacillus licheniformis DW2 / pHY-pdxST T50W , DW2 / pHY-pdxST M16Y , DW2 / pHY-pdxST M16W , DW2 / pHY-pdxST M16L , DW2 / pHY-pdxST E48R and DW2 / pHY-pdxST from glycerol tubes containing 20 μg mL -1 Activate by streaking on LB solid medium containing tetracycline and incubate at 37°C for 20-24 hours. Pick colonies and inoculate into LB medium containing 20 μg mL-1 5 mL LB medium containing tetracycline, 230 r·min -1 , temperature 37℃, culture for 10-12h. Then inoculate the activated bacterial solution with 3% (v / v) to contain 20μg·mL -1 In 50 mL of LB liquid medium containing tetracycline, 37°C, 230 r·min -1 Culture for 10-12h, and obtain the seed solution (OD 600 4.0-5.0).

[0069] The specific steps of production and fermentation are as follows: 50 mL of PP liquid medium is placed in a 250 mL triangular flask, the seed liquid is transferred to the PP liquid medium at an inoculum rate of 3% (v / v), and the mixture is incubated at 37°C and 230 r·min. -1 After 60 h of culture, the fermentation broth of the control group and the experimental group was obtained, with 3 replicates in each group.

[0070] The PLP production of the fermentation broth of the experimental group and the control group was detected. The test results are shown in Table 2. T50W The yield of the mutant strain DW2 / pHY-pdxST was 140.53 mg / L, while the yield of the control strain DW2 / pHY-pdxST was 102.30 mg / L. T50W The yield was increased by 37.4% compared with that of the control bacteria.

[0071] Table 2: The yield of PLP synthesized by mutant engineered bacteria and wild-type control group

[0072]

Claims

1. A 5'-pyridoxal phosphate synthase mutant T50W, wherein the mutant is shown in SEQ ID NO.

4.

2. A gene encoding the protein shown in SEQ ID NO.

4.

3. An expression vector containing the gene according to claim 2.

4. A recombinant microorganism expressing the protein represented by SEQ ID NO.

4.

5. The microorganism according to claim 4, wherein the microorganism is Bacillus licheniformis ( Bacillus licheniformis ), the Bacillus licheniformis has the ability to metabolize and produce 5'-pyridoxal phosphate. The microorganism according to claim 5, wherein the Bacillus licheniformis is Bacillus licheniformis DW2.

7. Use of the mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the recombinant microorganism according to claim 4 in the preparation of 5'-pyridoxal phosphate synthase.

8. The use according to claim 7, when the gene according to claim 2 is used to prepare 5'-pyridoxal phosphate synthase, the process is to insert the gene encoding the protein shown in SEQ ID NO.4 into an expression vector, transform it into Bacillus licheniformis DW2 for fermentation expression.

9. Use of the mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the recombinant microorganism according to claim 4 in the preparation and production of 5'-pyridoxal phosphate.

Images