Immobilized tannase as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological catalysis, and particularly relates to immobilized tannase as well as a preparation method and application thereof. The chelating resin and the nickel chloride solution are mixed, so that a stable complex is formed by a chelating group on the resin and the nickel ions, the nickel ion chelating resin is constructed, and effective fixation of the nickel ions is ensured by utilizing high selectivity of the chelating resin to specific metal ions. Nickel ion chelating resin and tannase liquid are mixed, and high affinity between specific amino acid residues on the surface of tannase molecules and nickel ions is utilized, so that efficient immobilization of tannase on the resin is achieved. Besides, the genipin-containing solution obtained by enzymolysis of geniposide is used as the cross-linking agent, so that the operation is simple, the problem of environmental pollution in the genipin extraction process is avoided, and the cost is reduced. In the immobilization process, the heat stability and relatively high reusability of the tannase can be remarkably improved, and the method is a green and efficient novel enzyme immobilization method and has high practical value.

Description

Technical Field

[0001] The present application belongs to the field of biocatalysis technology, and specifically relates to an immobilized tannase and a preparation method and application thereof. Background Art

[0002] Tannase (EC3.1.1.20), also known as tannin acyl hydrolase, is an enzyme that catalyzes the hydrolysis of tannin compounds. In addition to being found in plants rich in tannin, tannase is also widely distributed in microorganisms in nature, including fungi, bacteria, yeast and other microorganisms that can produce this enzyme, especially species under the genus Aspergillus, which is the most capable of producing tannase. Due to its wide range of biological activity and application potential, tannase has been used in many fields, such as food processing, feed industry, cosmetics manufacturing, pharmaceutical industry, leather production and environmental governance, showing extremely important economic value and application prospects.

[0003] The characteristics of tannase catalysis include mild reaction conditions and high catalytic efficiency, which make tannase potentially valuable in a variety of industrial applications. However, free tannase faces some challenges in practical use, such as poor thermal stability, short service life, difficulty in recycling and reuse, and difficulty and high cost in separating tannase from the product after the reaction. These problems have greatly limited the widespread application of tannase in the industrial field.

[0004] In order to overcome the above challenges, researchers have developed immobilized tannase technology. By adopting appropriate immobilization methods, the performance of tannase can be significantly improved. Immobilization technology can not only realize the multiple recycling of tannase, effectively reducing the application cost of tannase, but also enhance the physicochemical properties and biological stability of tannase, such as improving its tolerance to temperature and pH changes, reducing enzyme loss, and increasing its operational stability and storage stability. In addition, immobilized tannase is also conducive to enzyme recovery and product purification after the reaction, further reducing the cost of the overall process and improving the feasibility and economic benefits of industrial applications. Therefore, the development of immobilized tannase technology is of great significance for promoting the application of tannase in many fields such as food processing, feed industry, cosmetics manufacturing, pharmaceutical industry and environmental governance. Summary of the invention

[0005] The present application provides a novel method for preparing immobilized tannase, which is specifically achieved through the following technical solutions:

[0006] The first aspect of the present application provides a method for preparing an immobilized tannase, comprising the following steps: using Aspergillus niger as a starting strain, constructing an Aspergillus niger protease knockout uracil auxotrophic strain ΔpepF-ΔpyrG-WZ001; the Aspergillus niger has a deposit number of CCTCCNO.206047; constructing a gene fragment of a tannase tan2 gene plus a pyrG gene with a his tag and transferring it into Aspergillus niger, screening and obtaining an Aspergillus niger high-yield tannase strain; performing fermentation and cultivation to obtain a tannase enzyme solution; mixing a chelating resin with a nickel chloride solution to obtain a nickel ion chelating resin; mixing the nickel ion chelating resin with the tannase enzyme solution to obtain a tannase affinity chromatography resin; mixing β-glucosidase with a gardenia glycoside aqueous solution to obtain a genipin solution; mixing the tannase affinity chromatography resin and the genipin solution to obtain an immobilized tannase.

[0007] Preferably, during the preparation of the nickel ion chelating resin, the concentration of the nickel chloride solution is 0.4 mol / L, and the volume mass ratio of the chelating resin to the nickel chloride solution is 1:5.

[0008] Preferably, during the preparation of the tannase affinity chromatography resin, the volume mass ratio of the nickel ion chelating resin added to the tannase enzyme solution added is 1:4. Further preferably, the reaction temperature is 20-40°C, the rotation speed is 100-200 rpm, and the time is 4-12h.

[0009] Preferably, during the preparation of the genipin solution, the volume ratio of 0.4% (w / v) geniposide phosphate buffer to β-glucosidase is 19: 1. Further preferably, the reaction conditions are 50° C. for 6 h.

[0010] Preferably, during the preparation of immobilized tannase, the volume mass ratio of tannase affinity chromatography resin to genipin solution is 1: 10. Further preferably, the reaction conditions are a temperature of 25° C. and a cross-linking time of 1 h.

[0011] The second aspect of the present application provides an immobilized tannase, which is prepared using any of the preparation methods described above.

[0012] The third aspect of the present application proposes the use of the above-mentioned immobilized tannase in tannic acid enzymolysis.

[0013] Preferably, during the enzymatic hydrolysis of tannic acid by the immobilized tannase, the enzymatic hydrolysis temperature is 30°C.

[0014] Preferably, during the enzymatic hydrolysis of tannic acid by the immobilized tannase, the enzymatic hydrolysis time is 10 hours.

[0015] Compared with the prior art, this application has the following beneficial effects:

[0016] The present application is to mix a chelating resin with a nickel chloride solution so that the chelating group on the resin forms a stable complex with nickel ions to construct a nickel ion chelating resin. This process utilizes the high selectivity of the chelating resin to specific metal ions (such as nickel ions) to ensure the effective fixation of nickel ions. Further, by mixing the nickel ion chelating resin with the tannase enzyme solution, the high affinity between the specific amino acid residues (such as histidine) on the surface of the tannase molecule and the nickel ions is utilized to achieve efficient fixation of the tannase on the resin. In addition, the solution containing genipin obtained by the enzymolysis of gardenia glycosides is used as a cross-linking agent, which is simple to operate, not only avoiding the environmental pollution problem in the genipin extraction process, but also reducing the cost. The immobilization process of the present application can significantly improve the thermal stability and relatively high reusability of tannase, and is a green and efficient new enzyme fixation method with high practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to clearly introduce the embodiments, the drawings of the accompanying drawings are briefly introduced below:

[0018] Figure 1 This is a schematic diagram of the tannase gene expression plasmid;

[0019] Figure 2 is the optimum temperature for immobilized tannase;

[0020] Figure 3 is the thermal stability of immobilized tannase;

[0021] Figure 4 Catalytic batch stability of immobilized tannase. DETAILED DESCRIPTION

[0022] The present application will be further described below in the form of specific embodiments. Those of ordinary skill in the art will be able to implement the present application based on these descriptions. In addition, the embodiments of the present application involved in the following description are generally only embodiments of a part of the present application, rather than all embodiments. Therefore, based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present application.

[0023] In the following examples, the resin is a chelating resin D403 with a weakly acidic iminodiacetic acid group [-CH2N-(CH2OOH)2] on a styrene-divinylbenzene copolymer with a special macroporous structure, and the manufacturer is Tianjin Xinyue Huamei Environmental Protection Technology Co., Ltd.

[0024] Example 1. Construction of Aspergillus niger ΔpyrG ΔpepF strain

[0025] Aspergillus niger WZ001 was used as the starting strain to construct an Aspergillus niger uracil auxotrophic strain ΔpyrG. Aspergillus niger WZ001 was deposited in the China Center for Type Culture Collection with a deposit number of CCTCC No. 206047 and a deposit date of May 15, 2006. The patent application number of the prior patent is CN200610051963.X, which is an existing strain.

[0026] The pyrG gene from Aspergillus niger was retrieved from the NCBI database (Gene bank: XM_001395395.2). The genome of Aspergillus niger CCTCC NO.206047 was used as a template, and the upstream and downstream homologous arms of the pyrG gene were amplified using specific primers Up-pyrG-F / Up-pyrG-R and Do-pyrG-F / Do-pyrG-R, respectively.

[0027] Using pET-28a(+) plasmid as template, the vector fragment was reversely amplified using primers 28ZT-F / 28ZT-R. After digestion and purification, the upstream and downstream homology arms of the pyrG gene were connected to the pET-28a(+) plasmid using a one-step cloning kit, and the ligation product was transferred into E. coli DH5α competent cells. The positive recombinant plasmid obtained by screening was named pET-28a(+)-PTpyrG.

[0028] The constructed recombinant plasmid pET-28a(+)-PTpyrG was used as a template to amplify the expression cassette of the knockout pyrG gene, i.e., the upstream and downstream homologous arms of the pyrG gene, and the PCR product was verified by 1% agarose gel electrophoresis, and was transferred into the genome of Aspergillus niger WZ001 by PEG-mediated protoplast transformation. After spores grew on the transformation plate, they were passaged to a PDA plate containing uridine and 5-fluoroorotic acid, and after the transformants grew, the genome was verified to obtain a stable genetic Aspergillus niger uracil auxotrophic strain ΔpyrG.

[0029] Table 1. Primer names and sequences

[0030] Primer name Primer sequences Up-pyrG-F GGGTCGCGGATCCGAATTCTCAGATCTGTCTTGATGCCCATAA Up-pyrG-R TCTTCCTTCAGATTTAAGGACCAATGTCGAGCACGGGTAG Do-pyrG-F CTACCCGTGCTCGACATTGGTCCTTAAATCTGAAGGAAGA Do-pyrG-R GAGTGCGGCCGCAAGCTTGCAGTGTGAGCCGAATGTGAAT 28ZT-F AAGCTTGCGGCCGCACTCGA 28ZT-R GAATTCGGATCCGCGACCCA

[0031] Note: The underlined part is the homologous sequence required for cloning.

[0032] Using the Aspergillus niger uracil auxotrophic strain ΔpyrG as the starting strain, the Aspergillus niger protease knockout strain ΔpyrGΔpepF-WZ001 was constructed.

[0033] First, the pepF sequence gene from Aspergillus niger (Gene ID: 4982072) was searched in the NCBI database. The genome of Aspergillus niger CCTCC NO.206047 was used as a template, and the upstream and downstream gene fragments pepFL, pepFR and pyrG gene expression cassette of the pepF gene were amplified using primers Up-pepF-F / Up-pepF-R, Do-pepF-F / Do-pepF-R, and pyrG-F / pyrG-R, respectively.

[0034] Using pET-28a(+) plasmid as template, the linearized fragment of the plasmid was reversely amplified using primers 28-F / 28-R. After digestion and purification, the upstream and downstream homology arms of the pyrG gene and the pyrG gene expression cassette were connected to the pET-28a(+) plasmid using a one-step cloning kit, and the ligation product was transferred into E.coLiDH5 competent cells. The positive recombinant plasmid obtained by screening was named pET-28a(+)-PTpepF-pyrG.

[0035] The constructed recombinant plasmid pET-28a (+) -PTpepF-pyrG was used as a template to amplify the linearized fragment pepFL-pyrG expression cassette-pepFR, and the PCR product was verified by 1% agarose gel electrophoresis, and was transferred into the genome of Aspergillus niger Δ malt Δ black malt-WZ001 by PEG-mediated protoplast transformation. After spores grow on the transformation plate, they are subcultured on a non-resistant plate, and the genome is verified to obtain a stable genetic Aspergillus niger strain ΔpyrGΔpepF-WZ001.

[0036] Table 2. Primer names and sequences

[0037] Primer name Primer sequences Up-pepF-F TGGGTCGCGGATCCGAATTCAGCAAGGCCGAGTGGAGGT Up-pepF-R TTGTGTGAGGTTGGCTTACGGTGGGCTGGAAGACAAAGAAAG Do-pepF-F GGAGGGCGACTACTCGGCC Do-pepF-R TCGAGTGCGGCCGCAAGCTTTTTTCTGGTTGGCATCATCCTTACTA pyrG-F CGTAAGCCAACCTCACACAAACA pyrG-R TGGCCGAGTAGTCGCCCTCCGGGGTAGTAACGTTTTAGCGACG 28ZT-F AAGCTTGCGGCCGCACTCGA 28ZT-R GAATTCGGATCCGCGACCCA

[0038] Note: The underlined part is the homologous sequence required for cloning.

[0039] Example 2: Construction of tannase gene recombinant plasmid and PEG-mediated transformation of protoplasts

[0040] The tannase gene tan2 from Aspergillus niger was retrieved from the NCBI database (Genebank: XM001401772). The tan2 gene was amplified using the Aspergillus niger WZ001 genome as a template using specific primers tan2-F / tan2-R, and the PCR product was verified by 1% agarose gel electrophoresis. The plasmid pCAMBIA-PgpdA-TcbhI-pyrG was used as a template, and the linearized fragment of the plasmid was reversely amplified using primers pCAMBIA-F / pCAMBIA-R. After digestion and purification, the tan2 gene and the vector were connected using a one-step cloning kit, and the recombinant product was transformed into E.coLi DH5α competent cells. After culturing at 37°C for 12 hours, a single colony was picked, and the correctly identified plasmid was named pCAMBIA-tan2-pyrG ( Figure 1 ).

[0041] Table 3. Primer names and sequences

[0042]

[0043] Note: The underlined part is the homologous sequence required for cloning

[0044] When transforming the Aspergillus niger uracil auxotrophic strain with the pepF gene knocked out, the auxotrophic type is used as a screening marker. The screening marker gene pyrG encodes orotidine-5'-phosphate decarboxylase. The strain lacking the pyrG gene cannot synthesize uracil / uridine and must be supplemented with uracil / uridine to grow normally. After the pyrG gene is complemented and transferred into the Aspergillus niger uracil auxotrophic strain ΔpyrG strain, the wild-type phenotype is restored and it can grow on the basic medium PDA.

[0045] The His tag is constructed by connecting 6-10 consecutive histidine residues to the N or C terminus of the target protein. The core principle of the His tag is to form a coordination bond between the nucleophilic nitrogen atom in the histidine residue and the metal ion to achieve the specific binding of the target protein to the metal ion. Commonly used metal ions include nickel, copper, zinc, etc.

[0046] The Aspergillus niger strain ΔpyrGΔpepF-WZ001 was inoculated into DPY medium and cultured for 24 hours before preparing protoplasts. The PEG-mediated protoplast transformation method was used, with the nutritional deficiency type as the screening marker, and the recombinant plasmid pCAMBIA-tan2-pyrG was used as a template to amplify the linearized tannase expression cassette fragment with a his tag at the C-terminus, and randomly integrated it into the genome of the Aspergillus niger strain ΔpyrGΔpepF-WZ001. After culturing at 30°C for 4-6 days, the Aspergillus niger transformants were randomly selected to a non-resistant PDA plate for passage and cultured at 30°C for 5 days. The transformant genome was extracted for PCR verification, and the positive transformants containing the target gene tan2 were screened.

[0047] Example 3: Screening, culture and enzyme activity determination of Aspergillus niger transformants

[0048] The composition of the seed liquid culture medium (W / V) is: 2% glucose, 0.5% peptone, 0.2% yeast extract powder, 0.1% K2HPO4, 0.05% MgSO4, the solvent is water, and the pH is adjusted to 6.8; the composition of the fermentation culture medium (W / V) is: 4.2% corn syrup, 3% soybean cake powder, 2% glucose, 1.5% K2HPO4, 1.5% (NH4)2SO4, 0.3% citric acid, 0.25% yeast peptone, 0.25% yeast extract powder, 0.02% CaCL2, 0.5% MgSO4, the solvent is water, and the pH is natural.

[0049] The 8 positive transformants (tan2-1 to tan2-8) were inoculated on PDA plates and cultured at 30°C for 4 days. The spores were washed with an appropriate amount of sterile water to prepare a 10 7 The spore suspension was inoculated into the seed culture medium and cultured at 30°C and 220rpm for 24h. The 2% (v / v) seed solution was transferred into the fermentation medium and cultured at 30°C and 220rpm for 120h. After the fermentation, the supernatant of the fermentation solution was collected to obtain the crude enzyme solution of the recombinant Aspergillus niger tannase.

[0050] Method for determining tannase activity: before the reaction begins, keep 10 mM propyl gallate solution and the enzyme solution to be tested in a 30°C water bath for 5-10 minutes; take 4 clean test tubes, 1 for a blank tube and 3 for test tubes, add 0.25 mL of PG solution to each tube, then add 0.25 mL of the enzyme solution to be tested to the test tubes respectively, react in a 30°C water bath for 5 minutes, add 0.3 mL of methanol rhodanine solution (0.667%, W / V) to all test tubes, and keep warm for 5 minutes; add 4.2 mL of KOH solution (0.5 M) to all test tubes, add 0.25 mL of enzyme solution to the blank tube, place at 30°C for 10 minutes, return the blank tube to zero, and measure the absorbance of each tube solution at 520 nm.

[0051] Under the conditions of 30℃ and pH 5.0, the amount of enzyme required to degrade propyl gallate solution to release 1 mol gallic acid per minute was defined as one enzyme activity unit (U). Among the 8 recombinant Aspergillus niger strains, tan2-8 had the highest enzyme activity, with an enzyme activity of 23.6 U / mL (Table 4).

[0052] Table 4. Enzyme activities of 8 recombinant Aspergillus niger strains

[0053] Strain name Enzyme activity U / mL tan2-1 13.6 tan2-2 15.8 tan2-3 20.1 tan2-4 18.3 tan2-5 17.6 tan2-6 21.3 tan2-7 21.7 tan2-8 23.6

[0054] Example 4. Preparation of immobilized tannase

[0055] Add 52g of nickel chloride to 800mL of deionized water, ultrasonicate at 40Hz and 25℃ for 30min, dilute to 1L, and prepare 0.4M nickel chloride solution. Take 20g of D403 chelating resin, the manufacturer is Tianjin Xinyue Huamei Environmental Protection Technology Co., Ltd., add 100mL of 0.4M nickel chloride solution, 25℃, 120rpm, shake in a water bath overnight, and vacuum filter to obtain nickel ion chelating resin. Add 10g of nickel ion chelating resin to a conical flask containing 40mL of tannase fermentation broth, stir magnetically at 25℃ and 180rpm for 10h, and vacuum filter with a vacuum filter paper filter to obtain tannase affinity chromatography resin.

[0056] Take 19 mL of phosphate buffer (pH 7.0, 10 mM) containing 0.4% (w / v) geniposide, add 1 mL of β-glucosidase, and gently stir at 50°C for 6 h. Take the reaction solution every hour for HPLC analysis. After 6 h, terminate the reaction. This enzymatic solution is the cross-linking solution, and store the genipin solution at 4°C for subsequent experiments.

[0057] Take 2g of nickel ion resin adsorbing tannase, 20mL of genipin solution, cross-linking temperature 25℃, cross-linking time 1h, and take the reaction solution for HPLC analysis every 10min. When the reaction is carried out for 10min, the genipin in the reaction solution gradually decreases; when the reaction is carried out for 30min, the genipin in the reaction solution is still continuously consumed; when the reaction is carried out for 60min, the content of genipin does not decrease significantly, which indicates that genipin has achieved a certain cross-linking effect and the preparation of immobilized tannase is completed.

[0058] Example 5. Optimum temperature of immobilized tannase

[0059] The effect of temperature on enzyme activity is achieved by changing the conformation of the enzyme protein and the enzyme catalysis process. In this example, the tannase activity at 20°C, 30°C, 40°C, 50°C, 60°C, 70°C, and 80°C was studied. The study found that the optimal reaction temperature for both free enzyme and immobilized enzyme was 30°C. Both free enzyme and immobilized tannase showed high activity in the range of 20°C-50°C. When the temperature was raised to 70°C, the enzyme activities of both decreased. The relative activity of free tannase was only 17.6%, but the relative activity of immobilized tannase still retained 65.1%. The results are as follows Figure 2 shown.

[0060] Example 6. Thermal stability of immobilized tannase

[0061] Thermal stability is one of the characteristics of enzymes and plays an important role in enzyme catalysis. Free tannase and immobilized tannase were incubated at 30°C, pH 5.0 for 8 hours. The initial enzyme activity was calculated as 100%. The reaction solution and immobilized enzyme were taken once every hour to determine their thermal stability. The study found that within the range of 0-8 hours, the enzyme activity of both enzymes decreased, but the free enzyme activity decreased more significantly. The results are as follows: Figure 3 As shown, the results showed that the immobilized tannase had higher thermal stability.

[0062] Example 7: Conversion rate of immobilized tannase at different times

[0063] This example explores the effect of enzymatic hydrolysis time on the enzymatic hydrolysis of tannic acid aqueous solution by immobilized tannin. The amount of enzyme added is 0.3%, the enzymatic hydrolysis temperature is 30°C, and the enzymatic hydrolysis time in this example is 1h, 2h, 3h, 4h, 5h, 6h, 7h, 8h, 9h, and 10h, respectively. Other conditions remain unchanged, and the tannic acid aqueous solution is enzymatically hydrolyzed. The conversion rate is shown in Table 4. The results show that the enzymatic hydrolysis time is higher than 8h, and the tannin conversion rate exceeds 90%.

[0064] Table 5. Tannin conversion rate at different enzymatic hydrolysis times

[0065] Different time (h) Reaction conversion rate (%) 1 31.2％ 2 42.3％ 3 55.7％ 4 64.2％ 5 72.3％ 6 81.4％ 7 89.4％ 8 92.8％ 9 94.8％ 10 95.2％

[0066] Example 8. Catalytic batch stability of immobilized tannase

[0067] Take 0.3g of the immobilized tannase prepared in Example 4 after cross-linking and add it to 100mL of 2% tara tannin aqueous solution, and react for 12h at 30℃ and 1500rpm metal bath conditions. After the reaction is completed, take the reaction solution for HPLC analysis to detect the amount of gallic acid GA produced. Suck out all the reaction solution in the reaction system, detect the enzyme activity, and then add new substrate to carry out the next batch of reaction. Take 10 samples in total, i.e., 10 batches of reaction. The results are as follows: Figure 4 As shown, the results showed that the immobilized tannase had good batch stability.

Claims

1. A method for preparing immobilized tannase, characterized in that: The following steps are involved: Aspergillus niger is used as a starting strain to construct an Aspergillus niger protease knockout uracil auxotrophic strain ΔpepF-ΔpyrG-WZ001; the Aspergillus niger has a preservation number of CCTCC NO.206047; a gene fragment of a tannase tan2 gene plus a pyrG gene with a his tag is constructed and transferred into Aspergillus niger to screen out an Aspergillus niger high-yield tannase strain; fermentation and culture are performed to obtain a tannase enzyme solution; a chelating resin is mixed with a nickel chloride solution to obtain a nickel ion chelating resin; the nickel ion chelating resin is mixed with the tannase enzyme solution to obtain a tannase affinity chromatography resin; beta-glucosidase is mixed with a gardenia glycoside aqueous solution to obtain a genipin solution; the tannase affinity chromatography resin and the genipin solution are mixed to obtain an immobilized tannase.

2. The method for preparing an immobilized tannase according to claim 1, characterized in that: During the preparation of nickel ion chelating resin, the concentration of nickel chloride solution was 0.4 mol / L, and the volume mass ratio of chelating resin to nickel chloride solution was 1:

5.

3. The method for preparing an immobilized tannase according to claim 1, characterized in that: During the preparation of tannase affinity chromatography resin, the volume mass ratio of the added amount of nickel ion chelating resin to the added amount of tannase enzyme solution was 1:

4.

4. The method for preparing an immobilized tannase according to claim 1, characterized in that: During the preparation of the genipin solution, the volume ratio of 0.4% (w / v) geniposide phosphate buffer to β-glucosidase was 19:

1.

5. The method for preparing an immobilized tannase according to claim 1, characterized in that: During the preparation of immobilized tannase, the volume mass ratio of tannase affinity chromatography resin to genipin solution was 1:

10.

6. An immobilized tannase, characterized in that: It is prepared by the preparation method according to any one of claims 1 to 5.

7. Use of the immobilized tannase according to claim 6 in enzymolysis of tannic acid.

8. The use according to claim 7, characterized in that: The temperature of enzymatic hydrolysis was 30°C.

9. The use according to claim 7, characterized in that: The enzymatic hydrolysis time was 10 h.

Images