Method for improving heat resistance of tomato pollen and / or fruit setting rate at high temperature

Abstract

The invention discloses a method for improving tomato pollen heat resistance and / or high-temperature fruit setting rate, and belongs to the technical field of biology, the tomato pollen heat resistance and / or high-temperature fruit setting rate are / is improved through overexpression of a sugar transporter STP2 gene in tomatoes, the nucleotide sequence of a protein coding region of the STP2 gene is as shown in SEQ ID NO.1, and the nucleotide sequence of the protein coding region of the STP2 gene is as shown in SEQ ID NO.2. The amino acid sequence of the protein coded by the STP2 gene is as shown in SEQ ID NO. 2. According to the invention, STP2 gene overexpression homozygous strains OE: STP2-1 and OE: STP2-2 are screened by using a transgenic technology and a tissue culture technology, compared with wild type WT, the overexpression plants have the advantages that the pollen malformation rate at high temperature is obviously reduced, the germination rate is obviously increased, the tomato fruit setting rate at high temperature stress is also obviously increased, and the tomato yield is increased. An important gene resource is provided for cultivating a high-temperature-resistant tomato variety.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature. Background Art

[0002] Tomato, Solanum, Solanaceae, is one of the most widely cultivated vegetables and cash crops in the world. It is popular among consumers for its delicious taste and rich in lycopene, which has antioxidant and health-care functions. Its cultivation has a good market prospect. Tomatoes like warmth but are not heat-resistant. The most suitable growth temperature is 20-25℃. Due to the intensification of the greenhouse effect and the uncontrollability of the cultivation environment, high temperatures in summer have become the main factor affecting tomato growth. Especially in the reproductive growth stage of tomatoes, the sensitivity to high temperatures is more significant. The critical high temperature of flower organs is 3-5℃ lower than that of leaves. A high temperature of 33℃ can significantly lead to pollen abortion, falling flowers and fruits, and quality decline, which seriously limits the agricultural production goal of high-quality and high-yield tomatoes. In the process of coping with high temperature adversity, the heat resistance of pollen is a key factor affecting pollen fertility and fruit setting rate. Pollen abortion is the main reason for the frequent occurrence of various industrial problems under high temperature. Therefore, studying the response mechanism of pollen to high temperature has important scientific and practical significance for improving the resistance of tomatoes to high temperatures during their reproductive growth period. This is beneficial to increasing tomato yield and quality and ensuring a balanced supply throughout the year. It has now become a hot area of ​​botanical research.

[0003] At present, a series of pathways that regulate pollen development in higher plants have been discovered, such as carbohydrate accumulation and metabolism, hormone regulation, etc. In the early stages of pollen development, photosynthetic assimilates such as starch and other carbohydrates are continuously accumulated. As pollen grains gradually mature, starch is degraded into soluble sugars to provide energy for pollen growth and development. As a powerful photosynthesis reservoir, pollen's direct source of carbohydrates is supplied by anthers, so the accumulation and transport of sugars in anthers are key to pollen development. Mutations in the sucrose transporter SWEET13 and SWEET14 genes in Arabidopsis prevent sucrose from being transported from anthers to pollen, resulting in a significant decrease in the content of soluble sugars such as sucrose, glucose, and fructose in pollen, thereby affecting pollen development (Wang et al., Sucroserather than GA transported by AtSWEET13 and AtSWEET14 supports pollen fitness at late anther development stages, New Phytologist, 2022). Silencing of the tomato sucrose invertase gene CWIN1 inhibits the hydrolysis of sucrose into glucose and fructose, resulting in abnormal pollen grain morphology and reduced fruit setting rate (Zanor et al., RNA interference of LIN5 in tomato confirms its role in controlling brix content, uncovers the influence of sugars on the levels of fruit hormones, and demonstrates the importance of sucrose cleavage for normal fruit development and fertility, Plant Physiology, 2009, 150, 1204-1218).

[0004] In addition, there are studies on regulating the pollen development of higher plants by applying exogenous regulators. For example, the Chinese patent document with publication number CN112352575A discloses a preparation with 5-hydroxytryptamine as the active ingredient. By using this preparation, the phenomenon of tomato pollen abortion caused by high temperature can be alleviated, and the normal development morphology of pollen can be effectively maintained, thereby effectively improving the tolerance of plants to high temperature stress and increasing the fruit setting rate. The Chinese patent document with publication number CN108323516A discloses that a preparation prepared with melatonin as the main active ingredient can safely and effectively slow down the plant pollen abortion induced by high temperature, thereby reducing the yield reduction and economic losses caused by the reduction in seed setting rate. However, the exogenous regulator must be used strictly in accordance with the recommended usage and dosage, and there may be problems of residues in the plant body.

[0005] STP (sugar transport protein) is a family of sugar transport proteins. The tomato STP family has 18 members, which are distributed in the cell membrane, vacuole membrane, chloroplast and cytoplasm in plants (Reuscher et al., The sugar transporter inventory of tomato: genome-wide identification and expression analysis, Plant and Cell Physiology, 2014, 55 (6), 1123-1141). The STPs identified so far are mainly responsible for transporting hexose, with glucose as the preferred substrate. Some STPs can also transport fructose, galactose, mannose, etc. In tomatoes, mutation of tomato STP2 will lead to reduced hexose accumulation in fruits and reduced fruit dry weight (McCurdy, Functional Characterization and RNAi-Mediated Suppression Reveals Roles for Hexose Transporters in Sugar Accumulation by Tomato Fruit, Molecular Plant, 2010). The STP family plays an important regulatory role in plant growth, but there are few reports on its regulation of reproductive growth resistance under high temperature stress.

[0006] In recent years, biotechnology has developed rapidly. The establishment of DNA recombinant technology, especially the application of gene overexpression technology, can maximize the role of genes. The development of this technology not only provides an important way to study the complex traits and functions of horticultural crops, but also can effectively screen and cultivate germplasm resources with excellent resistance, and has broad application prospects in plant breeding and variety improvement research. Summary of the invention

[0007] In order to alleviate the problems of tomato pollen abortion and decreased fruit setting rate caused by high temperature adversity, the present invention provides a method for improving the heat resistance of tomato pollen and the fruit setting rate under high temperature by using the STP2 gene, in order to provide a basis for breeding high temperature resistant tomato varieties.

[0008] The specific technical solutions adopted are as follows:

[0009] The present invention provides an application of an STP2 gene in improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature. The nucleotide sequence of the protein coding region of the STP2 gene is shown in SEQ ID NO.1, the length of the protein coding region is 1572 bp, and the DNA sequence of the whole gene is shown in SEQ ID NO.3.

[0010] Furthermore, the expression level of the tomato STP2 gene was increased through gene overexpression technology.

[0011] The present invention also provides the use of a protein encoded by the STP2 gene in improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature. The protein encoded by the STP2 gene is a protein located on the cell membrane and mainly responsible for transporting hexose, and is composed of 523 amino acids. The amino acid sequence of the protein encoded by the STP2 gene is shown in SEQ ID NO.2.

[0012] High temperature will inhibit the transport of photosynthetic products from leaves to anthers, thereby reducing the soluble sugar content in anthers and pollen, and further leading to problems such as pollen abortion, flower and fruit drop, and quality decline. The STP2 gene and the protein it encodes regulate the resistance of reproductive growth to high temperature by increasing the glucose and fructose content in tomato anthers under high temperature adversity, thereby improving the heat resistance of tomato pollen and the fruit set rate under high temperature.

[0013] The present invention also provides a method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature, comprising overexpressing the STP2 gene in tomatoes.

[0014] Specifically, the method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature comprises the following steps:

[0015] (1) constructing a vector for overexpressing the STP2 gene;

[0016] (2) constructing an Agrobacterium genetically engineered bacterium containing the vector for overexpressing the STP2 gene in step (1);

[0017] (3) Transforming tomato cotyledons with the genetically engineered Agrobacterium constructed in step (2), and obtaining transgenic plants by screening through a plant tissue cell culture method.

[0018] Specifically, in step (1), RNA from tomato anthers is extracted, reverse transcribed to obtain cDNA, and the tomato STP2 gene is amplified using primers using the cDNA as a template, and the amplified product is constructed into a vector.

[0019] Furthermore, the primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is AGGCGCGCCATGGCCGGTGGAGGATTTAC (SEQ ID NO.4); the nucleotide sequence of the downstream primer is ACGCGTCGACCAACCGAGAAGTGGGATCAT (SEQ ID NO.5).

[0020] Furthermore, the vector used in step (1) is pFGC1008-3HA vector.

[0021] Preferably, in step (2), the genetically engineered Agrobacterium is Agrobacterium tumefaciens GV3101 strain.

[0022] The present invention also provides application of the method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature in cultivating high temperature resistant tomatoes.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] (1) The present invention provides a method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature by using transgenic technology, and obtains heat-resistant transgenic homozygous strains OE:STP2-1 and OE:STP2-2, which have broad application prospects in breeding heat-resistant (especially heat-resistant during reproductive growth) tomato germplasm, and provide important genetic resources for breeding heat-resistant tomato varieties.

[0025] (2) Compared with the wild type WT, the transgenic tomatoes OE:STP2-1 and OE:STP2-2 cultivated by the present invention have significantly reduced pollen deformity rate and significantly improved germination rate under high temperature, indicating that overexpression of the STP2 gene can improve the heat resistance of pollen. At the same time, the fruit set rate after high temperature treatment was statistically analyzed, proving that STP2 overexpression can improve the fruit set rate of tomatoes under high temperature adversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a statistical chart of the STP2 gene expression levels in wild-type WT tomatoes and STP2 overexpression plants verified by qRT-PCR after the STP2 overexpression plants were successfully constructed in Example 1; lowercase letters a and b represent significant differences at the 5% level.

[0027] Figure 2 The pollen grain morphology and pollen deformity rate of the wild-type WT and STP2 gene overexpressing plant OE:STP2-1 in Example 2 under normal temperature and high temperature conditions, wherein A is a scanning electron micrograph of pollen grain morphology, and B is a statistical graph of pollen deformity rate; lowercase letters a, b, and c represent significant differences at the 5% level.

[0028] Figure 3 These are the pollen germination diagrams of the wild-type WT and the STP2 gene overexpressing plant OE:STP2-1 under normal temperature and high temperature conditions in Example 2, wherein A is the aniline blue staining diagram of pollen in vitro germination, and B is the statistical diagram of pollen in vitro germination rate; lowercase letters a, b, and c represent significant differences at the 5% level.

[0029] Figure 4 The figure is a graph of the fruit setting rate of the wild type WT and the STP2 gene overexpressing plant OE:STP2-1 under high temperature in Example 3, wherein A is a fruit setting phenotype graph, and B is a fruit setting rate statistical graph; lowercase letters a and b represent significant differences at the 5% level.

[0030] Figure 5 The figures are statistical graphs of soluble sugar content in anthers of the wild-type WT and the STP2 gene overexpressing plant OE:STP2-1 under high temperature in Example 4, wherein A is a statistical graph of glucose content, B is a statistical graph of fructose content, and C is a statistical graph of sucrose content; lowercase letters a and b represent significant differences at the 5% level. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with the examples and accompanying drawings. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods of the following examples that do not specify specific conditions are usually performed under normal conditions or under conditions recommended by the manufacturer. The content that is not described in detail in this specification sheet belongs to the prior art known to professionals in the field. The experimental materials used in the following examples, if not otherwise specified, can be purchased by conventional biochemical reagent companies.

[0032] The tomato variety used in the following examples is the conventional tomato variety CR (Condine Red), and the wild-type tomato plant WT without genetic modification is used as a control.

[0033] Example 1 Construction of STP2 gene overexpression vector and transgenic tomato

[0034] The sequence of the STP2 gene (Solyc09g075820) was obtained from the tomato genome database (https: / / solgenomics.net / ). The full gene DNA sequence is shown in SEQ ID NO.3, the nucleotide sequence of the protein coding region is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the STP2 gene is shown in SEQ ID NO.2. The STP2 overexpression pFGC1008-3HA vector was constructed with reference to the Gateway manual, and the upstream primer and downstream primer were designed using Primer5 software, as shown below:

[0035] Upstream primer (SEQ ID NO.4):

[0036] AGGCGCGCCATGGCCGGTGGAGGATTTAC;

[0037] Downstream primer (SEQ ID NO.5):

[0038] ACGCGTCGACCAACCGAGAAGTGGGATCAT.

[0039] RNA from tomato anthers was extracted and cDNA was obtained by reverse transcription. Using cDNA as a template, the upstream primers and downstream primers were used to amplify the full length of the tomato STP2 gene coding region and purified using a common DNA purification kit. The amplified product was connected to the overexpression vector pFGC1008-3HA with a 35S promoter, and the plate was transformed by heat shock at 42°C, with resistance to chloramphenicol. After the recombinant plasmid was successfully constructed, it was transformed into GV3101 Agrobacterium tumefaciens by electroporation to obtain an Agrobacterium strain that can be used to construct STP2 overexpression materials.

[0040] Sow the sterilized tomato seeds in the sowing medium, cut the cotyledons after 7 days, and adopt the Agrobacterium infection method to infect the tomato cotyledons with the Agrobacterium obtained in the above steps, transform the recombinant plasmid into the cotyledons, and use the totipotency of plant cells to carry out tissue culture to obtain T0 generation transgenic tomatoes.

[0041] T0 transgenic tomato seedlings were tested by qRT-PCR. RNA from tomato anthers was extracted and cDNA was obtained by reverse transcription. Using cDNA as a template, the following forward and backward primers of the STP2 gene were designed to detect gene expression levels:

[0042] qRT-PCR forward primer (SEQ ID NO.6):

[0043] ACCGGAGCAGTCAACGTTCT;

[0044] qRT-PCR post primer (SEQ ID NO.7):

[0045] ACCATGGCTAAGGTTGTCTGAATGA.

[0046] The wild-type plant WT was used as the control to compare the expression of the STP2 gene in the T0 generation plants. The lines with STP2 gene expression upregulated by more than 20 times compared with the wild-type WT plants were selected, and they were continuously self-pollinated to obtain two homozygous T2 generation lines, OE:STP2-1 and OE:STP2-2 (as shown in Figure 2A). Figure 1 shown).

[0047] The following examples all used the T2 generation plants of the OE:STP2-1 homozygous strain as the material for the experiments. Example 2 Study on the heat resistance of pollen in homozygous plants overexpressing the STP2 gene

[0048] The entire process of pollen microspore development from the tetrad stage to the binucleate stage is sensitive to high temperature, especially the pollen that is about to split and enter the binucleate stage in the mononucleate stage. About 45 days after sowing tomato seeds, the plants enter the flowering stage. Put the tomato plants that have just opened the first flower into a high temperature box at 33 / 28℃ (day / night) to make the pollen in the mononucleate stage experience 3 days of high temperature treatment. After 3 days, take the flowers that just opened that day to observe the morphology of pollen grains and determine the in vitro germination rate of pollen. Plants in the normal temperature control group were cultured in a climate box at 25 / 20℃ (day / night).

[0049] Method for observing pollen grain morphology: Take a fully opened tomato flower that morning, shake the pollen in the anther evenly onto the conductive glue surface of the metal stage, and spray gold for 5 minutes in an Eiko Model IB5 ion plating machine (Japan). Then use a Hitachi Model TM-1000 scanning electron microscope (Japan) to observe the pollen grain morphology and take photos for statistics.

[0050] Method for detecting the in vitro germination rate of pollen: Take a fully opened tomato flower that morning, and evenly shake the pollen in the anther onto a glass slide with 40 μL of pollen in vitro germination solution. After culturing at 28°C in the dark for 1 hour, add 20 μL of 0.1% aniline blue staining solution. After staining in the dark for 5 minutes, observe the pollen germination under a fluorescence microscope and take photos for statistics.

[0051] The results are as follows Figure 2 A and B in Figure 3 As shown in A and B in Figure 1, high temperature significantly increased the pollen deformity rate and significantly reduced the in vitro germination rate of wild-type WT plants. However, the pollen grain deformity of STP2 gene overexpressing plants after high temperature treatment was lower than that of wild-type pollen, and the pollen germination rate was significantly increased.

[0052] Example 3 Study on the fruit setting rate of homozygous plants overexpressing STP2 gene under high temperature

[0053] About 45 days after sowing tomato seeds, the plants enter the flowering stage. After the first flower of the tomato plant has just opened, it is treated under high temperature stress of 33 / 28℃ (day / night) for 3 days, and then placed back under normal culture conditions for growth. After 15 days, the fruit setting situation is observed and photographed for statistics. Figure 4 As shown in A and B in Figure 1, the fruit setting rate of STP2 overexpressing plants after high temperature treatment was significantly higher than that of wild-type WT plants, which has application value in actual production.

[0054] Example 4 Study on the sugar content in anthers of homozygous plants overexpressing the STP2 gene

[0055] The tomato plants with the first flower just opened were placed in a high temperature box at 33 / 28℃ (day / night) to make the pollen in the mononucleate stage experience high temperature treatment for 3 days. After 3 days, the anthers of the flowers that had just fully opened that day were sampled to measure the glucose, fructose and sucrose content in the anthers.

[0056] Sugar content determination method: Take 0.05g of anther sample and grind it in liquid nitrogen. Add 1mL of ddH2O and extract it in a water bath at 80℃ for 30min, shaking and mixing the sample every 5min. Centrifuge at 12000g at 4℃ for 10min and take the supernatant. Dilute the supernatant 25 times with 80% acetonitrile, filter the solution through a 0.22μm nylon membrane, and analyze it by high performance liquid chromatography (HPLC).

[0057] The results are as follows Figure 5 As shown in Figures AC, the glucose and fructose contents in the anthers of the STP2 gene overexpressing plants under high temperature were higher than those of the wild type, indicating that STP2 promoted the accumulation of hexose in anthers under high temperature.

[0058] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of the STP2 gene or the protein encoded by it in improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature.

2. The use of the STP2 gene or the protein encoded by it according to claim 1 in improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature, characterized in that: The nucleotide sequence of the protein coding region of the STP2 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the STP2 gene is shown in SEQ ID NO.

2.

3. A method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature, characterized in that: Overexpression of the STP2 gene in tomato.

4. The method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature according to claim 3, characterized in that: The specific steps include: (1) constructing a vector for overexpressing the STP2 gene; (2) constructing an Agrobacterium genetically engineered bacterium containing the vector for overexpressing the STP2 gene in step (1); (3) Transforming tomato cotyledons with the genetically engineered Agrobacterium constructed in step (2), and obtaining transgenic plants by screening through a plant tissue cell culture method.

5. The method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature according to claim 4, characterized in that: In step (1), RNA from tomato anthers is extracted and reverse transcribed to obtain cDNA. The cDNA is used as a template and primers are used to amplify the tomato STP2 gene, and the amplified product is constructed into a vector.

6. The method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature according to claim 5, characterized in that: The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

7. The method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature according to claim 4, characterized in that: The vector used in step (1) is pFGC1008-3HA vector.

8. The method for improving the heat resistance of tomato pollen and / or the fruit setting rate at high temperature according to claim 4, characterized in that: In step (2), the genetically engineered Agrobacterium is Agrobacterium tumefaciens GV3101 strain.

9. Use of the method for improving the heat resistance of tomato pollen and / or the fruit setting rate under high temperature according to any one of claims 3 to 8 in cultivating high temperature resistant tomatoes.

Images