SNP (Single Nucleotide Polymorphism) site combination for identifying Fengcheng sheldrake variety and identification method thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) site combination for identifying the variety of Fengcheng shelducks and an identification method of the SNP site combination. The SNP site combination for identifying the variety of the Fengcheng sheldrake is selected from any one to five of FC1P sites to FC5P sites. The invention further provides an SNP primer combination and a detection method for identifying the Fengcheng sheldrake variety. The SNP primer combination and the detection method are easy and convenient to operate and high in accuracy.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and specifically relates to a SNP site combination and an identification method thereof for identifying Fengcheng Sheldon duck varieties. Background Art

[0002] The main production area of ​​Fengcheng Mallard is Fengcheng City, Jiangxi Province, and it is a national geographical indication product. Fengcheng Mallard is resistant to roughage, grows fast, has strong adaptability, is moderate in size, has high egg-laying performance, has tender meat, and is rich in nutrition. The feather color of Fengcheng Mallard is mainly gray-brown with pockmarks. The feathers on the head of the male duck are dark green, gradually fading toward the neck, and there is usually a circular white circle at the junction of the shoulder and neck. This feature is an important appearance mark that distinguishes Fengcheng Mallard from other Mallards. The feather color of the female duck is relatively light hemp, with hemp feathers all over the body slightly brown, and the feathers on the back and abdomen are gray hemp, which is slightly darker than the abdomen.

[0003] At present, the identification of Fengcheng Shelduck in the market mainly relies on morphological methods. The beak of Fengcheng Shelduck is green-yellow, with black beans on the tip of the beak, and the shanks and webbed feet are orange-yellow. These color characteristics are also its uniqueness. However, due to the moderate size of Fengcheng Shelduck and the fact that its body color is not much different from other shelduck varieties, Fengcheng Shelduck is very similar to many other local varieties, and the identification error rate is greatly increased, especially when identifying the hybrid offspring of Fengcheng Shelduck and other local duck varieties, it becomes more difficult to make correct classification and identification.

[0004] Single nucleotide polymorphism (SNP) mainly refers to the nucleotide sequence polymorphism caused by the mutation of a single nucleotide at the species genome level. It is a dimorphic marker with the characteristics of wide distribution, rich sites, genetic stability, and efficient detection. By utilizing the SNP marker sites with large breed differences in the individual genome nucleotide sequences, the variety identification is carried out through the combination of genotypes at different sites, and the identification results are more objective and accurate. Therefore, it has become more urgent to develop a product and method based on SNP markers that can accurately and effectively identify the Fengcheng Mallard variety. Summary of the invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and provide a SNP site combination and identification method for identifying Fengcheng Sheldon duck varieties, specifically adopting the following technical solutions: In a first aspect of the present invention, a SNP locus combination for identifying Fengcheng shepherd duck varieties is provided, which is selected from any 1 to 5 of the FC1P locus to the FC5P locus: FC1P is located at position 146869678 on chromosome 2 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is A or T; FC2P is located at position 16609651 on chromosome 3 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is G or A; FC3P is located at position 1230471 on chromosome 5 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is G or T; FC4P is located at position 15852704 on chromosome 11 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is T or C; FC5P is located at position 2344054 on chromosome 26 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is A or T.

[0006] The second aspect of the present invention provides a SNP primer combination for identifying Fengcheng Shelduck varieties, wherein the primer combination is a primer set for amplifying all SNP sites in the above-mentioned SNP site combination; The sequences of primers for each SNP site are: FC1F: GTCCTTTTCCGCATGGTTGA; FC1R:GGGTGCTTCCATATGACCTCC; FC2F:GGACATCTTCTGGCCTGACC; FC2R:GTGGGTCCACGATCTCCAAG; FC3F: CTGTGGATCCTCCGTGCTTC; FC3R:ACCGGGTGGAAATGGGAGTTT; FC4F: GGAATGGGACAGGCAAAAC; FC4R:ACACACGGAGACCCACAAT; FC5F: TTCACAAAACCGTGATGTGGG; FC5R:ATTTTTCCCCTCTCCCTACCG.

[0007] The third aspect of the present invention provides the use of the above-mentioned SNP primer combination in the identification of Fengcheng Shelduck variety.

[0008] A fourth aspect of the present invention provides a detection kit for identifying the Fengcheng Shelduck variety, the detection kit comprising the above-mentioned SNP primer combination.

[0009] A fifth aspect of the present invention provides a method for identifying the Fengcheng Shelduck variety, comprising the following steps: (1) Extracting total genomic DNA from ducks to be tested; (2) According to the selected SNP site combination, the above SNP primer combinations are respectively subjected to PCR amplification to obtain PCR amplification products; (3) sequencing the PCR amplification product to detect the genotype of the corresponding SNP site; (4) Determine whether the duck to be tested belongs to the Fengcheng Shelduck breed based on the genotype of the SNP site.

[0010] As a further preferred embodiment, the specific process of judging whether the duck to be tested belongs to the Fengcheng Sheep Duck variety is as follows: If one of the genotypes corresponding to the selected SNP site combination in the gene result does not match the genotype corresponding to Fengcheng Shelduck, it is determined that the duck to be tested does not belong to Fengcheng Shelduck; If the genotypes corresponding to the selected SNP site combination in the gene results all match the genotypes corresponding to the Fengcheng Shelduck, the probability that the duck to be tested belongs to the Fengcheng Shelduck is determined according to the Bayesian theorem.

[0011] As a further preferred implementation, the calculation formula of the Bayesian theorem is as follows: ; in, Pi Indicates the first i The frequency of the corresponding genotypes of other varieties in the SNP loci, i An integer from 1 to 5.

[0012] As a further preferred embodiment, the genotypes and genotype frequencies of the above SNP sites in other varieties are as follows: FC1P locus: When the genotype is TT, the genotype frequency in other varieties is 0.4356; when the genotype is TA, the genotype frequency in other varieties is 0; when the genotype is AA, the genotype frequency in other varieties is 0.5644; FC2P locus: When the genotype is GG, the genotype frequency in other varieties is 0.3386; when the genotype is AG, the genotype frequency in other varieties is 0.0035; when the genotype is AA, the genotype frequency in other varieties is 0.6579; FC3P locus: When the genotype is TT, the genotype frequency in other varieties is 0.3034; when the genotype is GT, the genotype frequency in other varieties is 0.0053; when the genotype is GG, the genotype frequency in other varieties is 0.6913; FC4P locus: When the genotype is TT, the genotype frequency in other varieties is 0.4339; when the genotype is TC, the genotype frequency in other varieties is 0.0123; when the genotype is CC, the genotype frequency in other varieties is 0.5538; FC5P locus: When the genotype is AA, the genotype frequency in other varieties is 0.3474; when the genotype is TA, the genotype frequency in other varieties is 0; when the genotype is TT, the genotype frequency in other varieties is 0.6526.

[0013] As a further preferred embodiment, the total genomic DNA of the duck to be tested is obtained by sampling blood from the wing vein of the individual duck to be tested.

[0014] The sixth aspect of the present invention provides the use of the above-mentioned SNP site combination or the above-mentioned SNP primer combination or the above-mentioned detection kit in Fengcheng Shelduck breeding.

[0015] The beneficial effects of the present invention are: The present invention provides five SNP sites (FC1P site to FC5P site) that affect the phenotype of Fengcheng shelduck, and also provides a primer combination for amplifying the five SNP sites, and the primer combination can be used to identify whether the duck breed is Fengcheng shelduck; according to Bayes' theorem, the probability of determining the genotype of any one SNP site as Fengcheng shelduck is as low as 69.66% and as high as 76.72%; the probability of determining the genotype of any two SNP sites as Fengcheng shelduck by the combined genotype is more than 84.10%; the probability of determining the genotype of any three SNP sites as Fengcheng shelduck by the combined genotype is more than 93.84%; the probability of determining the genotype of any four SNP sites as Fengcheng shelduck by the combined genotype is more than 97.83%; the probability of determining the genotype of five SNP sites as Fengcheng shelduck by the combined genotype is more than 99.33%. The probability of determining the genotype of the five SNP sites as Fengcheng shelduck is greater than 99%. The probability of excluding Fengcheng shelduck by the genotype of any one SNP site reaches 100%. Therefore, as long as the genotype of one SNP site does not match the corresponding genotype of Fengcheng Shelduck, the individual can be completely excluded from belonging to Fengcheng Shelduck; by selecting a combination of 3 SNP sites, the probability of accurately identifying Fengcheng Shelduck can reach more than 93%. The method of the present invention is easy to operate and has high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0017] Figure 1 Shown is a bar graph of genotype frequencies from FC1P site to FC5P site. DETAILED DESCRIPTION

[0018] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0019] The present invention provides a SNP site combination for identifying Fengcheng shepherd duck varieties, which is selected from any 1 to 5 of the FC1P site to the FC5P site (as shown in Table 1): Table 1 Five SNP loci affecting the phenotype of Fengcheng Shelduck The screening method for the above SNP loci is as follows: first, determine the local duck breeds that are similar in appearance and widely circulated in the market, such as Fengcheng Mallard, Jinding Duck, Chaohu Mallard, Shaoxing Mallard, Zhongshan Mallard, Jinyun Mallard and Youxian Mallard, and divide them into two groups: Fengcheng Mallard and other ducks; calculate the allele frequency of each SNP locus separately, and then compare the two groups of results to screen out SNP loci with a frequency of 0 or 1 in Fengcheng Mallard and a great difference from other ducks.

[0020] In addition, the inventors designed a primer combination for identifying the Fengcheng Mallard variety, the primer combination comprising any 1-5 of the primer pairs in Table 2: Table 2 Primer combinations for identifying Fengcheng duck breeds The inventors used the primer combination for identifying the Fengcheng shepherd duck variety to identify the Fengcheng shepherd duck variety, and the identification method includes the following steps: (1) Extracting total genomic DNA from ducks to be tested; (2) According to the selected SNP site combination, PCR amplification is performed using the primer combination for identifying the Fengcheng Shelduck variety; (3) Sequencing the PCR amplification product to determine the genotype; (4) Based on the genotype results, determine whether the duck to be tested belongs to the Fengcheng Shelduck breed.

[0021] If one of the genotypes corresponding to the selected SNP site combination does not match the genotype corresponding to the Fengcheng Shelduck, it is determined that the duck to be tested does not belong to the Fengcheng Shelduck; if all the genotypes corresponding to the selected SNP site combination match the genotype corresponding to the Fengcheng Shelduck, the probability that the duck to be tested belongs to the Fengcheng Shelduck is determined according to the Bayesian theorem.

[0022] In the identification method of the present invention, preferably, genomic DNA is obtained by sampling blood from the wing vein of the duck to be tested. The present invention has no particular limitation on the method for extracting genomic DNA, and conventional extraction methods in the art can be used. Preferably, in the embodiment of the present invention, genomic DNA is extracted using the phenol-chloroform method.

[0023] In the identification method of the present invention, one or several sites among FC1P-FC5P are used to identify the Fengcheng shepherd duck variety, and corresponding upstream and downstream primers are used for PCR amplification. The present invention has no special limitation on the PCR amplification method, and conventional PCR amplification methods in the art can be used.

[0024] Preferably, the genotype and gene frequency of the SNP loci in Fengcheng Mallard and other varieties are shown in Table 3 and Figure 1 shown.

[0025] Table 3 Genotype and gene frequency of 5 SNP loci in Fengcheng duck and other breeds Among them, the genotype frequency of other varieties refers to the detection of the genotype frequency of this group by grouping Jinding duck, Chaohu Mallard, Shaoxing Mallard, Zhongshan Mallard, Jinyun Mallard and Youxian Mallard.

[0026] For example, if the three SNP sites FC1P, FC2P, and FC3P are selected and the joint genotypes are TT, GG, and TT, then the probability that the individual belongs to Fengcheng Mallard is P=1 / (1+0.4356×0.3386×0.3034)=0.9572.

[0027] Example 1 In this embodiment, 25 each of Fengcheng Mallard, Jinding Duck, Chaohu Mallard, Shaoxing Mallard, Zhongshan Mallard, Jinyun Mallard and Youxian Mallard were randomly purchased from the breeding farm, and blood was collected from the wing vein. The duck breeds were identified according to the following steps: (1) Extraction of total DNA First, genomic DNA was extracted using the phenol-chloroform method. The specific steps are as follows: ① Mark the sample number on a 1.5 mL sterile centrifuge tube, draw 20 μL of the corresponding numbered duck anticoagulated whole blood into the corresponding centrifuge tube, add 600 μL DNA extraction solution and 10 μL proteinase K, seal the centrifuge tube with a sealing film, shake it slightly to mix, and place it on a shaker (60℃, 180 rpm) for 30 minutes to lyse; remove the fully digested centrifuge tube from the shaker and centrifuge it for 5 minutes (12,000 rpm) to precipitate the undigested blood clots; ② Carefully aspirate the supernatant with a pipette tip, add 1 / 10 volume (about 55 μL) of 3 mol / L sodium acetate (pH=5.2), shake upside down until no layers are separated, let stand at 4℃ for 10 min, then add 300 mL of phenol-chloroform-isoamyl alcohol (25:24:1), shake vigorously until no layers are separated, then let stand at 4℃ for 10 min, and centrifuge at 12,000 r / min for 10 min; ③Pipette the DNA supernatant into a new sterilized 1.5 mL centrifuge tube, then add 1 mL of -20°C pre-cooled anhydrous ethanol to the DNA supernatant, gently mix to precipitate the DNA, and then pick out the DNA with a clean pipette tip; ④ After picking out the precipitated DNA, add 500 μL of 75% ethanol precooled at -20℃, repeatedly blow and wash the DNA, pour out the ethanol, repeat this step 2-3 times, and finally suck out the excess 75% ethanol in the centrifuge tube with a yellow pipette tip; ⑤ Place the DNA in a ventilated place to air dry for about two hours. After it is air-dried, add 200 μL of TE solution into the centrifuge tube to dissolve and dilute it.

[0028] (2) PCR amplification After DNA was extracted, PCR amplification was performed using primers for the four SNP sites in the table below.

[0029] Table 4 Primers for 4 SNP sites The PCR system (20 μL) was as follows: 2 μL of DNA template, 1.0 μL of each forward and reverse primer (10 ng / μL), 10 μL of 2×PCR reagent in the Tiangen PCR kit, and the rest was made up with ultrapure water.

[0030] The PCR program was: first denaturation at 94° C. for 5 min, then 94° C. for 30 s, 55° C. for annealing for 30 s, and 72° C. for extension for 30 s, for a total of 35 cycles, and finally 72° C. for post-extension for 10 min, and storage at 4° C. The PCR instrument was a Bio-Rad T100 gradient PCR instrument from the United States.

[0031] (3) Sequencing and analysis The amplified products were sent to Shanghai Sangon Biotech Co., Ltd. for sequence polymorphism detection and genotype determination. According to the sequencing results, the probability of 25 individuals with genotypes of TT, GG, TT and TT at the four loci being Fengcheng Shelduck was 99.68%, so all 25 individuals were identified as Fengcheng Shelduck, with an identification accuracy of 100%. The remaining individuals did not fully meet the genotypes of TT, GG, TT and TT, so they were determined to be non-Fengcheng Shelduck.

[0032] The above and the accompanying drawings describe the embodiments of the present application. Specific examples are used herein to illustrate the principles and implementation methods of the present application. However, the above embodiments are only used to help understand the core idea of ​​the present application. The present application is not limited to the above specific implementation methods. The above specific implementation methods are merely illustrative and not restrictive. Under the enlightenment of the present application, ordinary technicians in this field can make different modifications and changes to the technical solutions and / or implementation methods without departing from the purpose of the present application and the scope of protection of the claims to achieve the same or equivalent technical effects, which should all belong to the protection scope of the present application.

Claims

1. A SNP locus combination for identifying Fengcheng Shelduck variety, characterized in that: Any 1 to 5 selected from FC1P site to FC5P site: FC1P is located at position 146869678 on chromosome 2 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is A or T; FC2P is located at position 16609651 on chromosome 3 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is G or A; FC3P is located at position 1230471 on chromosome 5 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is G or T; FC4P is located at position 15852704 on chromosome 11 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is T or C; FC5P is located at position 2344054 on chromosome 26 of the Ji'an red-haired duck reference genome PRJNA893649, and its polymorphism is A or T.

2. A SNP primer combination for identifying Fengcheng Shelduck variety, characterized in that: The primer combination is a primer set for amplifying all SNP sites in the SNP site combination of claim 1; The sequences of primers for each SNP site are: FC1F: GTCCTTTTCCGCATGGTTGA; FC1R:GGGTGCTTCCATATGACCTCC; FC2F:GGACATCTTCTGGCCTGACC; FC2R:GTGGGTCCACGATCTCCAAG; FC3F: CTGTGGATCCTCCGTGCTTC; FC3R:ACCGGGTGGAAATGGGAGTTT; FC4F: GGAATGGGACAGGCAAAAC; FC4R:ACACACGGAGACCCACAAT; FC5F: TTCACAAAACCGTGATGTGGG; FC5R:ATTTTTCCCCTCTCCCTACCG.

3. Use of the SNP primer combination described in claim 2 in the identification of Fengcheng Shelduck varieties.

4. A detection kit for identifying the Fengcheng Shelduck variety, characterized in that: The detection kit comprises the SNP primer combination according to claim 2.

5. A method for identifying the Fengcheng Shelduck variety, characterized in that: The following steps are involved: (1) Extracting total genomic DNA from ducks to be tested; (2) performing PCR amplification according to the selected SNP site combination using the SNP primer combination described in claim 2 to obtain PCR amplification products; (3) sequencing the PCR amplification product to detect the genotype of the corresponding SNP site; (4) Determine whether the duck to be tested belongs to the Fengcheng Shelduck breed based on the genotype of the SNP site.

6. The identification method according to claim 5, characterized in that: The specific process of determining whether the duck to be tested belongs to the Fengcheng Sheldon variety is as follows: If one of the genotypes corresponding to the selected SNP site combination in the gene result does not match the genotype corresponding to Fengcheng Shelduck, it is determined that the duck to be tested does not belong to Fengcheng Shelduck; If the genotypes corresponding to the selected SNP site combination in the gene results all match the genotypes corresponding to the Fengcheng Shelduck, the probability that the duck to be tested belongs to the Fengcheng Shelduck is determined according to the Bayesian theorem.

7. The identification method according to claim 6, characterized in that: The calculation formula of the Bayesian theorem is as follows: ； in, Pi Indicates the first i The frequency of the corresponding genotypes of other varieties in the SNP loci, i An integer from 1 to 5.

8. The identification method according to claim 7, characterized in that: The genotypes and genotype frequencies of the SNP loci in other varieties are as follows: FC1P locus: When the genotype is TT, the genotype frequency in other varieties is 0.4356; when the genotype is TA, the genotype frequency in other varieties is 0; when the genotype is AA, the genotype frequency in other varieties is 0.5644; FC2P locus: When the genotype is GG, the genotype frequency in other varieties is 0.3386; when the genotype is AG, the genotype frequency in other varieties is 0.0035; when the genotype is AA, the genotype frequency in other varieties is 0.6579; FC3P locus: When the genotype is TT, the genotype frequency in other varieties is 0.3034; when the genotype is GT, the genotype frequency in other varieties is 0.0053; when the genotype is GG, the genotype frequency in other varieties is 0.6913; FC4P locus: When the genotype is TT, the genotype frequency in other varieties is 0.4339; when the genotype is TC, the genotype frequency in other varieties is 0.0123; when the genotype is CC, the genotype frequency in other varieties is 0.5538; FC5P locus: When the genotype is AA, the genotype frequency in other varieties is 0.3474; when the genotype is TA, the genotype frequency in other varieties is 0; when the genotype is TT, the genotype frequency in other varieties is 0.6526.

9. The identification method according to claim 5, characterized in that: The total genomic DNA of the duck to be tested is obtained by collecting blood from the wing vein of the individual duck to be tested.

10. Use of the SNP locus combination according to claim 1, the SNP primer combination according to claim 2, or the detection kit according to claim 4 in Fengcheng Shelduck breeding.

Images