Silicone grease nanoparticles loaded with SHAP oligopeptide as well as preparation method and application of silicone grease nanoparticles

Abstract

The invention provides a silicone grease nano-particle loaded with SHAP oligopeptide as well as a preparation method and application of the silicone grease nano-particle. According to the application disclosed by the invention, turbulence stimulation of human umbilical vein endothelial cells is simulated by virtue of treatment of oscillation shearing force, and immunofluorescence, immunoblotting, THP1 adhesion experiments and the like are used for the first time, so that the situation that the SHAP oligopeptide cannot play an obvious role independently is found, while the SHAP oligopeptide can effectively protect the phosphorylation level of MST1 / 2 in HUVECs caused by turbulence stimulation after being loaded in silicon lipid (SLS), so that the SHAP oligopeptide can be used for preparing the HUVECs. Therefore, the activation of endothelial cells is reduced. Furthermore, the invention innovatively discovers and verifies the treatment effect of the silicone grease nanoparticles loaded with the SHAP oligopeptide on the atherosclerosis. In conclusion, the silicone grease nanoparticles loaded with the SHAP oligopeptide, provided by the invention, provide a new thought for relieving and treating the atherosclerosis.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a silica liposome nanoparticle, in particular to a silica liposome nanoparticle loaded with a SHAP short peptide, a preparation method and application thereof. Background Art

[0002] Atherosclerosis (AS) is a process of plaque formation in blood vessels involving various cells, lipids, and debris tissues. It is a chronic vascular inflammation mediated by multiple risk factors and is a cholesterol accumulation disease caused by the retention of low-density lipoprotein (LDL) in the arterial intima. Under pathological conditions, atherosclerotic lesions can reduce blood flow in the vascular lumen by more than 50% and may cause angina pectoris, especially during exercise or stress. When plaques contain a large amount of fat and activate inflammation, the lesions may become unstable or even rupture. If this happens in the coronary arteries, it may cause local thrombosis, completely blocking blood flow and eventually leading to myocardial infarction. Plaques can also escape from the heart to the brain, causing stroke. Despite tremendous efforts to understand and prevent cardiovascular disease (CVD), CVD remains the leading cause of death in the world due to its complex pathology.

[0003] The Hippo signaling pathway plays an important role in biological processes such as organ growth and development, tissue regeneration, tumorigenesis and development, and immune response activation, and has been widely reported and studied. It is particularly common in various tumors, such as gastric cancer (GC). Mammalian Hippo kinases MST1 and MST2 (MST1 / 2) can phosphorylate LATS1 and LATS2 kinases, which in turn phosphorylate YAP and TAZ (YAP / TAZ) proteins, leading to their inactivation in the cytoplasm. When the Hippo signaling pathway is shut down, YAP / TAZ are dephosphorylated and translocated to the nucleus to control the transcription of target genes. Therefore, proper regulation of MST1 / 2 kinase activity is essential for the correct control of YAP / TAZ activity. In fact, loss of MST1 / 2 kinase activity and gene knockout have been shown to lead to tumor hyperproliferation. However, due to the rare occurrence of MST1 / 2 kinase mutations found in cancer, it is still unclear how the Hippo (MST1 / 2) tumor suppressor activity is shut down during tumorigenesis and whether it is possible to turn this activity back on for therapeutic purposes. Silicosomes are composed of a mesoporous silica core surrounded by a lipid bilayer that can encapsulate drugs within the pores and within the bilayer itself. Studies have shown that silicosomes have excellent long blood circulation ability and good in vivo safety.

[0004] SHAP peptides have been shown to protect the activity of MST1 / 2 kinases, thereby inhibiting the activity of the Hippo signaling pathway. At the same time, SHAP peptides have been shown to inhibit the occurrence of gastric cancer. However, the effect of SHAP peptides on atherosclerosis is still unclear. Therefore, further exploring the role and mechanism of SHAP peptides in the development of atherosclerosis is one of the important issues in this field. Summary of the invention

[0005] In view of the deficiencies in the prior art, the object of the present invention is to provide a silica liposome nanoparticle loaded with a SHAP short peptide, a preparation method and application thereof.

[0006] In the first aspect of the present invention, a method for preparing silica liposome nanoparticles loaded with SHAP short peptide is provided, characterized in that it comprises the following steps:

[0007] Step 1: Prepare MSNPs loaded with SHAP short peptides: Take MSNP ethanol suspension, centrifuge, discard the supernatant and disperse the precipitate in water; weigh SHAP short peptide and dissolve it in water, add it to MSNP water suspension and incubate to allow SHAP short peptide to be fully adsorbed on MSNP; after centrifugation again, disperse the precipitate in PBS for the preparation of SHAP-silicasome (SHAP-SLS) loaded with SHAP;

[0008] Step 2: Preparation of liposomes: Distearoylphosphatidylcholine (DSPC) / Cholesterol (Chol) / DSPE-PEG2000 (distearoylphosphatidylethanolamine-polyethylene glycol 2000) mixture was heated and dissolved with ethanol, PBS was added to the mixture, and probe ultrasonic treatment was performed to obtain liposomes, which were used as biomembranes for encapsulating MSNPs;

[0009] Step 3: Preparation of SHAP-silicasome (SHAP-SLS): Take the liposome prepared in step 2, add the SHAP-MSNP prepared in step 1, and ultrasonicate with an ice bath probe to obtain SHAP-silicasome (SHAP-SLS) with a complete envelope; resuspend the precipitate in PBS after centrifugation, and centrifuge again at a low speed to remove the agglomerated particles with incomplete envelope and the metal debris detached from the ultrasonic probe to obtain silica liposome nanoparticles loaded with SHAP short peptides.

[0010] Furthermore, the amino acid sequence of the SHAP short peptide is shown in SEQ ID NO.1;

[0011] Furthermore, in step 1, the concentration of the MSNP ethanol suspension is 15-25 mg / mL, preferably 20 mg / mL;

[0012] Furthermore, the speed and time of the two centrifugations in step 1 are both 12000-18000 rpm for 15-25 min, preferably both are 15000 rpm for 20 min;

[0013] Furthermore, in step 1, water is ddH 2 O;

[0014] Furthermore, the incubation time in step 1 is 5-15 min, preferably 10 min;

[0015] Further, the molar ratio of DSPC / Chol / DSPE-PEG2000 in the DSPC / Chol / DSPE-PEG2000 mixture in step 2 is 50-65:35-45:1-5, preferably 60:37:3;

[0016] Furthermore, the heating and dissolving in step 2 is heating and dissolving at 60-70° C., preferably heating and dissolving at 65° C.;

[0017] Furthermore, the ultrasonic treatment time in step 2 is 8-12 minutes, preferably 10 minutes; the ultrasonic treatment conditions are a duty cycle of on / off 8-12s / 4-6s, a power output of 60-70W, preferably a duty cycle of on / off 10s / 5s, and a power output of 65W;

[0018] Furthermore, the size of the liposomes prepared in step 2 is 50-200 nm, preferably 150 nm; the concentration is 15-25 mg / mL, preferably 20 mg / mL;

[0019] Furthermore, the ultrasonic treatment time in step 3 is 4-6 minutes, preferably 5 minutes; the ultrasonic treatment conditions are a duty cycle of on / off 8-12s / 4-6s, a power output of 60-70W, preferably a duty cycle of on / off 10s / 5s, and a power output of 65W;

[0020] Furthermore, the centrifugal speed and time in step 3 are both 12000-18000 rpm for 15-25 min, preferably 15000 rpm for 20 min;

[0021] Furthermore, the speed and time of low-speed centrifugation in step 3 are 2000-4000 rpm for 2-4 min, preferably 3000 rpm for 3 min.

[0022] Furthermore, the step 3 further includes a step of characterizing the physicochemical properties of SHAP-silicasome, specifically: the uniformity and integrity of the MSNP and silicasome lipid membranes are characterized by cryo-electron microscopy; the particle size and zeta potential are measured by a Malvern DLS instrument; the drug loading of each carrier is determined by subtraction, and the amount of unencapsulated SHAP detected during the preparation process (mL) is measured by OD in a UV-visible spectrophotometer. 280 Determine; Encapsulation efficiency EE% = [SHAP total amount (m 0 )-Unpackaged SHAP(m 1 )] / [SHAP total (m 0 )]×100%.

[0023] Furthermore, the preparation method of the MSNP specifically comprises the following steps:

[0024] Step a: Add water and CTAC solution into a container and heat while stirring;

[0025] Step b: adding triethanolamine aqueous solution to the heated container described in step a, continuing stirring, then adding tetraethyl silicate, maintaining the reaction temperature, continuing the reaction until the upper oil phase reacts completely, and then terminating the reaction;

[0026] Step c: After the solution in the reaction container in step b is cooled to room temperature, anhydrous ethanol is added and allowed to stand overnight to allow the MSNP to fully flocculate, the precipitated MSNP solution is divided into another container, centrifuged and the supernatant is discarded, and then a hydrochloric acid / ethanol mixed solution is added, and the precipitate is redispersed by water bath ultrasound; the above precipitation redispersion operation is repeated 3 times to fully remove the residual surfactant CTAC;

[0027] Step d: After the last centrifugation and discarding the supernatant, add anhydrous ethanol and re-disperse the precipitate by water bath ultrasound; repeat the operation of resuspending the precipitate with anhydrous ethanol after centrifugation 3 times to fully remove the residual hydrochloric acid in the system; after the last centrifugation and resuspending the precipitate, centrifuge at a low speed to remove the large particles agglomerated during the synthesis process, and take the supernatant to obtain the MNSP finished product with uniform particle size and stable dispersion.

[0028] Furthermore, in step a, the CTAC solution is a 20-30% CTAC solution, preferably a 25% CTAC solution;

[0029] Furthermore, in step a, the temperature is heated to 80-90° C., preferably 85° C.;

[0030] Furthermore, the stirring time in step b is 25-35 min, preferably 30 min;

[0031] Furthermore, the reaction time in step b is 2.5-3.5h, preferably 3h;

[0032] Furthermore, the centrifugal speed and time in step c are 8000-12000 rpm for 0.8-1.2 h, preferably 10000 rpm for 1 h;

[0033] Furthermore, in the step c, the volume ratio of hydrochloric acid to ethanol in the hydrochloric acid / ethanol mixed solution is 1:45-50, preferably 1:49;

[0034] Furthermore, the water bath ultrasound time in step c is 25-35 min, preferably 30 min;

[0035] Furthermore, the centrifugal speed and time in step d are 8000-12000 rpm for 0.8-1.2 h, preferably 10000 rpm for 1 h;

[0036] Furthermore, the speed and time of low-speed centrifugation in step d are 4000-5000 rpm for 8-12 min, preferably 4500 rpm for 10 min.

[0037] Furthermore, the step d further includes a drying, weighing and storage step, specifically: taking an empty 1.5 mL centrifuge tube, weighing and recording it on an analytical balance, taking 1 mL of the MSNP finished solution into an empty centrifuge tube, centrifuging at 15,000 rpm for 20 min to completely precipitate the MSNP in the solution, removing the supernatant, and drying it in a 65°C oven. Taking it out and weighing it at different time periods, after the weight stabilizes, subtracting the weight of the empty centrifuge tube from the weight of the centrifuge tube containing the dry precipitate, the mass concentration of the MSNP is obtained and recorded, and the prepared MSNP is stored in a 4°C refrigerator for subsequent use.

[0038] Furthermore, the step d may further include a step of preparing fluorescently labeled MSNPs, specifically, adding 3-aminopropyltriethoxysilane (APTES) to the MSNP ethanol suspension, stirring overnight under heating conditions, and obtaining MSNP-NH 2 ; After centrifugation and washing the precipitate with ethanol, Dy680-NHS dye was added and stirred overnight at room temperature to obtain Dy680 fluorescently labeled MSNPs.

[0039] Further, the concentration of the MSNP ethanol suspension is 15-25 mg / mL, preferably 20 mg / mL;

[0040] Further, the stirring overnight under the heating condition is stirring at 75-85°C at a speed of 400-500 rpm overnight, preferably stirring at 80°C at a speed of 500 rpm overnight;

[0041] Further, the centrifugal speed and time are 12000-18000 rpm for 15-25 min, preferably 15000 rpm for 20 min;

[0042] Further, the concentration of the Dy680-NHS dye is 0.5-1.5 mg / mL, preferably 1 mg / mL; preferably, the Dy680-NHS dye is dissolved in DMF;

[0043] Furthermore, the stirring at room temperature overnight is stirring at a speed of 400-500 rpm at room temperature overnight, preferably stirring at a speed of 500 rpm at room temperature overnight.

[0044] In the second aspect of the present invention, a SHAP short peptide-loaded silica liposome nanoparticle is provided, characterized in that the silica liposome nanoparticle is prepared by the preparation method of the SHAP short peptide-loaded silica liposome nanoparticle according to the first aspect of the present invention.

[0045] In the third aspect of the present invention, there is provided use of the SHAP short peptide-loaded silica liposome nanoparticles described in the second aspect of the present invention in the preparation of a drug for alleviating and / or treating atherosclerosis.

[0046] In the fourth aspect of the present invention, there is provided a use of the SHAP short peptide-loaded silica liposome nanoparticles described in the second aspect of the present invention in the preparation of a drug for reducing endothelial cell inflammatory response or endothelial cell activation.

[0047] Furthermore, the endothelial cells are human umbilical vein endothelial cells.

[0048] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0049] Compared with the prior art, the present invention has the following advantages and progress:

[0050] The present invention aims to explore the effects and influences of liposome nanoparticles loaded with SHAP short peptide on atherosclerosis in human umbilical vein endothelial cells and mouse models, and to explore its inflammatory mechanism. At the cellular level, the present invention utilizes oscillating shear force treatment to simulate turbulent stimulation of human umbilical vein endothelial cells, and uses immunofluorescence, immunoprotein blotting, and THP1 adhesion experiments, etc., to discover for the first time that SHAP short peptide alone does not play a significant role, and SHAP short peptide loaded with liposomes (SLS) can effectively protect the phosphorylation level of MST1 / 2 in HUVECs caused by turbulent stimulation, thereby reducing the activation of endothelial cells. The present invention also verifies the size, stability and other physical and chemical properties of liposome nanoparticles and liposome nanoparticles loaded with SHAP short peptide. Furthermore, the present invention innovatively discovered and verified the therapeutic effect of liposome nanoparticles loaded with SHAP short peptide on atherosclerosis. Specifically, the present invention has an effect on ApoE - / - Mice were subjected to partial ligation of the left common carotid artery, turbulent stimulation was simulated in vivo, and a high-fat diet was given to induce the occurrence of atherosclerosis; free SHAP and silica liposome nanoparticles loaded with SHAP short peptide were injected into the model mice through the tail vein, and it was found through in vivo, in vitro and HE staining that the development of atherosclerosis was significantly inhibited after SHAP-SLS treatment, and the effect was significantly better than that of SHAP short peptides at the same concentration; En Face staining of the left common carotid artery of mice showed that the level of p-MST1 increased significantly after SHAP-SLS treatment and the expression of VCAM-1 decreased significantly. In summary, the silica liposome nanoparticles loaded with SHAP short peptides provided by the present invention provide a new idea for the relief and treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0052] Figure 1 : Simple diagram of turbulence model.

[0053] Figure 2 : SHAP short peptide HPLC chromatogram.

[0054] Figure 3:Turbulence stimulation can cause endothelial cell activation. (A) HUVECs were collected after 2 hours of turbulence stimulation, and qPCR was performed using primers of ICAM1, VCAM1, and IL-1β to detect their changes after turbulence (n=6). (B) Human umbilical vein endothelial cells were stimulated with turbulence for 2 hours. Immunofluorescence assay to detect the phosphorylation level of MST1 (n=6) Scale bar: 10μm. * indicates P value less than 0.05, ** indicates P value less than 0.01, *** indicates P value less than 0.001, and ns indicates no statistical significance.

[0055] Figure 4 : In vitro cell experiments on the therapeutic effect of SHAP. (A) Umbilical vein endothelial cells were stimulated by turbulence and treated with SHAP short peptides, and proteins were extracted for western blotting experiments. p-MST1 / 2 antibody, MST1 antibody, GADPH antibody and corresponding protein precipitation were used. (B) Umbilical vein endothelial cells were stimulated by shear force in vitro, and the extracted proteins were verified by immunoprecipitation and western blotting. PP2Aa, PP2Ac, STRN3 and GAPDH antibodies were used to detect the corresponding protein levels. (C) Umbilical vein endothelial cells were stimulated by turbulence, and the phosphorylation level of MST1 was detected by immunofluorescence experiment (n=6) Scale bar: 10μm.

[0056] Figure 5 : SHAP short peptide does not affect endothelial cell activation. (AB) SHAP short peptide treated HUVECs with 2 small turbulence stimulations and collected the cells for 12 hours. qPCR was performed using primers for ICAM1 and VCAM1 to detect their changes after turbulence (n=6). * indicates P value less than 0.05, ** indicates P value less than 0.01, *** indicates P value less than 0.001, and ns indicates no statistical significance.

[0057] Figure 6 :High concentration of SHAP short peptide affects cell activity. HUVECs were incubated with high and low doses of SHAP, and cell activity was detected. It was found that under SHAP (High), cell activity was significantly inhibited. SHAP (Low): 2μg / ml, SHAP (High): 50μg / ml (n=6). * indicates P value less than 0.05, ** indicates P value less than 0.01, *** indicates P value less than 0.001, and ns indicates no statistical significance.

[0058] Figure 7:Characteristic analysis of nanoparticles (SHAP-SLS). (A) The figure shows the transmission electron microscopy of SLS and SHAP-SLS nanoparticles. Scale bar: 50nm. (B) The figure shows the characterization of the size and Zeta potential of SLS and SHAP-SLS nanoparticles. Zeta potential can be used as an important parameter to evaluate the stability of nanoparticle colloids.

[0059] Figure 8 : SHAP-SLS inhibits HUVECs activation. (A) The phosphorylation level of MST1 was detected by immunofluorescence assay (n=6). (BC) The protein in endothelial cells after turbulence stimulation was extracted and the levels of p-MST1 / 2 and VCAM-1 were detected (n=3). (D) The adhesion of monocytes was observed by co-incubating fluorescently labeled THP-1 cells with endothelial cells after turbulence stimulation (n=6). (EF) The mRNA levels of ICAM-1 and CCL2 in endothelial cells after four treatments after turbulence stimulation were detected (n=6). Two-way ANOVA with Bonferroni post-hoc test. * indicates P value less than 0.05, ns indicates no statistical significance.

[0060] Fig. 9 : SHAP-SLS inhibits the progression of atherosclerosis. (AB) The left picture shows the accumulation of atherosclerotic plaques in model mice in vivo and in wax discs. The right picture shows the partial left common carotid vessels of model mice injected with PBS / SHAP / SLS / SHAP-SLS and HE staining. (CD) En Face staining was performed on some blood vessels in the left common carotid plaque area of ​​mice to detect the level of p-MST1. The picture shows the immunofluorescence image. MST1 / p-MST1 was labeled with green fluorescence, VE-Cadherin was labeled with red fluorescence, and cell nuclei were labeled with DAPI (blue), n=4. VCAM-1 was used to detect the level of inflammation in the plaque area. (E) En Face staining was performed on some blood vessels in the left common carotid plaque area of ​​mice to detect the level of p-MST1. VCAM-1 was labeled with red fluorescence, VE-Cadherin was labeled with green fluorescence, and cell nuclei were labeled with DAPI (blue), n=4. VCAM-1 was used to detect the level of inflammation in the plaque area. One-way ANOVA with Bonferroni post-hoc test. * indicates P value less than 0.05, ns indicates no statistical significance.

[0061] Fig.10:Nano drugs do not affect blood lipid levels. (AD) CHO: plasma cholesterol, TG: triglycerides, LDL-C: low-density lipoprotein, HDL-C: low-density lipoprotein, (n=11). One-way ANOVA with Bonferroni post-hoc test. ns indicates no statistical significance. DETAILED DESCRIPTION

[0062] The present invention provides a liposome nanoparticle loaded with a SHAP short peptide, a preparation method and an application thereof. The present invention is specifically described below in conjunction with the embodiments to facilitate further understanding of the present invention by those skilled in the art. However, the embodiments described below are only a part of the embodiments of the present invention and should not be regarded as any form of limitation to the present invention. It should be pointed out that adjustments and improvements made by those of ordinary skill in the art based on the concept of the present invention should be regarded as the scope of protection of the present invention. The specific technical operation steps and operators are not indicated in the embodiments, and are carried out according to the general technical conditions described in the literature of the field or the relevant product instructions.

[0063] Example

[0064] Part I Experimental Materials and Methods

[0065] 1. Aseptic Isolation and Culture of Primary Human Umbilical Vein Endothelial Cells

[0066] 1. After the delivery, the fresh sterile umbilical cord was separated and stored in a glass bottle containing sterile 1×HEPES buffer solution and stored in a refrigerator at 4°C. The cell separation operation needed to be completed within 48 hours to ensure cell activity (the umbilical cord was obtained from the Department of Obstetrics of Tianjin Medical University General Hospital and was reviewed by the Medical Ethics Committee of Tianjin Medical University General Hospital with the approval number: IRB2020-KY-102);

[0067] 2. Prepare separation instruments in advance and pressurize them (microscissors, 500mL beaker, 50mL beaker, ligature and metal head, etc.) to ensure sterility, and prepare the required large glass culture dishes, syringes (with a capacity of at least 10mL), instruments and disposable sterile gloves; spread collagen in 10cm cell culture dishes in advance, and determine the number of 10cm culture dishes to be laid according to the length of the umbilical cord. Spread collagen in the dishes for at least 30 minutes;

[0068] 3. Prepare a 37°C water bath, place it in a biosafety cabinet for UV disinfection in advance, add 1xHEPES to a large beaker, place it in a water bath to preheat, pour preheated trypsin into a small beaker; take another 50ml centrifuge tube and pour in an appropriate amount of preheated M199 culture medium;

[0069] 4. The whole process of isolating endothelial cells should be performed in a biological safety cabinet. First, take out the syringe aseptically and put it into a large glass culture dish with good high pressure. Prepare the metal heads and ligatures required for this cell separation and put them into the large glass dish for later use. Pour the umbilical cord into another large glass culture dish, change sterile gloves, carefully check the appearance of the umbilical cord for damage, pinholes, etc., and observe whether the ends of the umbilical cord are neat. If the ends are not neat, they can be trimmed appropriately.

[0070] 5. Determine the location of the umbilical vein, insert the metal head into the openings at both ends of the umbilical vein, and use a ligature to secure the metal head on the outside of the umbilical cord. Gently push the umbilical cord with your hands to squeeze out the remaining fluid.

[0071] 6. Use a 20ml syringe to absorb an appropriate amount of HEPES sterile buffer, insert the metal head at one end, and make sure it is tightly inserted; insert an empty syringe at the other end, push the buffer from one end, fill the umbilical cord completely, and check if there is any leakage that is invisible to the naked eye; after checking, use an empty syringe to draw liquid from the other end. Wash the umbilical cord twice with the buffer, and finally drain all the liquid in the umbilical cord;

[0072] 7. Use a syringe to draw up the pancreatic enzyme solution and fill the umbilical cord completely with pancreatic enzyme. You can squeeze out a little from the other end to prevent the residual buffer from diluting the pancreatic enzyme (to ensure that the endothelial cells are fully digested by pancreatic enzyme). Use the syringe to draw back and forth several times at both ends;

[0073] 8. Place the umbilical cord with pancreatic enzymes into a large beaker containing HEPES in a 37°C water bath for 8 minutes;

[0074] 9. Carefully remove the umbilical cord with the syringe, check again whether the connection between the syringe and the metal head and between the metal head and the umbilical cord is tight, carefully rub the umbilical cord from top to bottom twice (this process takes about 2 minutes), use the syringe to draw out the pancreatic enzyme solution containing endothelial cells in the umbilical cord from one end;

[0075] 10. Inject the pancreatic enzyme solution into a 50 mL centrifuge tube containing M199 culture medium; use a syringe to suck out the culture medium and pancreatic enzyme mixture again, inject it into the umbilical vein again, and rub it repeatedly for 2 more times to terminate the effect of the residual pancreatic enzyme in the umbilical cord and digest the remaining endothelial cells as much as possible;

[0076] 11. Use a syringe to suck out all the liquid in the umbilical cord and inject it into the above centrifuge tube. Then open the plug at the other end, place it on top of the centrifuge tube, and gently squeeze out the liquid inside;

[0077] 12. After tightening the centrifuge tube, put it into the centrifuge and centrifuge it at 1000 rpm for 5 minutes;

[0078] 13. After centrifugation, discard the supernatant in the tube and keep the precipitate. Resuspend the precipitate in M199 medium until the precipitate is completely dispersed;

[0079] 14. Transfer the reselected cells and culture medium into a culture dish covered with collagen, place it in an incubator, and change the medium every other day;

[0080] 15. Change the medium every 2-3 days according to the cell status. At this time, the cells are P0. After the cells are fully grown, they are passaged at a ratio of 1:2 or 1:3 according to the cell status. At this time, they are P1. Cells separated from different umbilical cord sources are mixed together to prevent individual differences from affecting the experimental results. Cells are passaged to P5 and frozen in time.

[0081] 2. Establishing a fluid stepped shear force system

[0082] 1. Prepare experimental supplies; place the glass plate of the appropriate size in a large glass dish, prepare the matching chamber, connecting hose and rubber pad; rinse the above supplies carefully twice with tap water, double distilled water and triple distilled water, and then perform high pressure;

[0083] 2. After high pressure, place in a clean bench, cool to room temperature, use a suction pump to absorb the residual water on the glass plate, and pre-lay collagen for more than 1 hour;

[0084] 3. Recover collagen and, depending on the experimental requirements, plate endothelial cells on a glass plate; carefully transfer them to an incubator to adhere overnight;

[0085] 4. Follow Figure 1 As shown, assemble a blood flow shear force simulation system;

[0086] 5. Use hemostatic forceps to clamp all open lines;

[0087] 6. Pour 400mL of M199 culture medium containing 10% FBS into the system so that all pipes are filled with culture medium. Turn on the peristaltic pump to start the liquid flowing in the pipes;

[0088] 7. Make a "sandwich" structure by assembling the rectangular glass plate with endothelial cells, a rubber pad of matching size, and the flow chamber, and clamp them with a clean long-tailed ticket clip;

[0089] 8. Aseptically connect the "sandwich" structure interface and the corresponding pipeline interface of the system in an ultra-clean workbench to complete the construction of the system;

[0090] 9. Gently release the hemostatic forceps that previously clamped the pipeline, carefully check and empty the remaining bubbles in the entire system;

[0091] 10. After the fluid system runs stably, adjust the flow rate of the peristaltic pump according to the size of the glass plate. For specific parameters, see

[0092] Table 1:

[0093]

[0094] Table 1: Turbulent flow velocity correspondence table

[0095] 11. After the basic construction of the system is completed, if a turbulence experiment is to be carried out, a syringe needs to be connected to the system pipeline and connected to the suction pump, and the suction pump frequency is adjusted to 60Hz;

[0096] 12. Check again for bubbles in the tubing and place the sandwich with the cells facing downward.

[0097] 13. Finally, place the system in 5% CO 2 , 37℃ cell incubator, and pay attention to whether the system is running normally and stably, and control the system running time according to experimental requirements.

[0098] 3. Real-time quantitative PCR (qPCR)

[0099] ●Total RNA extraction and quantification (Beijing Quanshijin RNA extraction kit)

[0100] 1. Take out the treated cells, add PBS and wash 3 times, discard the PBS for the last time;

[0101] 2. Add 1 mL of Trizol solution to each dish, use a pipette to blow until all cells fall off in the solution, and transfer the cell mixture to an EP tube labeled in advance;

[0102] 3. Extract the RNA of the cells according to the instructions of the kit, and finally add 80-100 μL of RNase-free ultrapure water according to the amount of cells;

[0103] 4. Measure RNA concentration using NanoDrop 2000;

[0104] 5. If reverse transcription of RNA is not performed on the same day, the extracted RNA should be placed in a -80°C refrigerator for short-term storage to avoid repeated freezing and thawing (which can easily lead to degradation).

[0105] RNA reverse transcription and real-time fluorescence PCR

[0106] 1. Reverse transcribe RNA into cDNA according to the reverse transcription kit steps. After the reaction is completed, add primers of the target gene sequence and perform QPCR according to the recommended system and procedures;

[0107] 2. QPCR system: 2×Taq q-PCR Mix (10 μL), cDNA and RNAase free water (total volume of 9 μL), qPCR primer (1 μL, synthesized by Shanghai Sangon Biotechnology Co., Ltd.).

[0108] 3. The reaction procedure is as follows:

[0109]

[0110] 4.qPCR primer sequences:

[0111] Primer sequence (5'-3') Primer name (species Human) CAGCCAGATGCAATCAATGCC hCCL2 Cre1-For TGGAATCCTGAACCCACTTCT hCCL2 Cre2-Rev GAAGGTGAAGGTCGGAGTC hGAPDH Cre1-For GAAGATGGTGATGGGATTTC hGAPDH Cre2-Rev CGAACCCAAACAAAGGCAGA hVCAM1-Cre1-For ACAGGATTTTCGGAGCAGGA hVCAM1-Cre2-Rev ATGCCCAGACATCTGTGTCC hICAM1-Cre1-For GGGGTCTCTATGCCCAACAA hICAM1-Cre2-Rev

[0112] IV. Cell Immunofluorescence Staining

[0113] 1. Pre-plated cells on an immunofluorescence chamber. After the cells were treated, the medium was discarded and washed three times with PBS buffer;

[0114] 2. Add an appropriate amount of 4% paraformaldehyde solution, let it stand at room temperature for 15 minutes, then discard the fixative, slowly adhere to the wall and add PBS to wash 3 times for 5 minutes to wash away the excess paraformaldehyde;

[0115] 3. Add appropriate amount of 0.5% Triton X-100 cell permeabilization solution for permeabilization and incubate at room temperature with slow shaking for 30 minutes;

[0116] 4. Discard the permeabilization solution and add goat serum to block at room temperature for 60 minutes;

[0117] 5. Discard the blocking solution, incubate the primary antibody, dilute the primary antibody solution with the antibody diluent at a ratio of 1:100-1:200, add 70-80 μL of the diluted primary antibody to each well, seal the chamber with a sealing film (to prevent water evaporation), and incubate on a shaker at 4°C overnight;

[0118] 6. Add PBS to wash the primary antibody 3 times, 5 minutes each time;

[0119] 7. Incubate with fluorescent secondary antibody, dilute the secondary antigen solution according to the ratio of the primary antibody, add 70-80 μL of diluted secondary antibody to each well, seal with sealing film, and incubate at room temperature in the dark for 45-60 minutes;

[0120] 8. Add PBS to wash away the residual secondary antibody 3 times for 5 minutes in the dark, pry open the chamber, remove the residual liquid, drop an appropriate amount of DAPI mounting medium to seal the slide, and place it in a light-proof humid box.

[0121] 9. Photographed using a laser confocal microscope.

[0122] 5. Western Blotting

[0123] Extraction of total cell protein (taking 6-well plate as an example)

[0124] 1. Discard the cell culture medium, gently wash with pre-cooled PBS three times, add 100 μL protein lysis buffer to each well, place on ice and use a cell scraper to collect cells into a 1.5 mL EP tube.

[0125] 2. Ultrasonic disruption, 3 seconds each time, 3 seconds off, repeat 3 times, and centrifuge the cell lysate at 4℃ 12,000rpm for 15 minutes.

[0126] 3. Pipette the cell supernatant and measure the solution volume in a new EP tube. Add 5 μL protein to the 96-well plate and quantify by BCA method. Add 5x SDS loading buffer to the remaining sample by volume and mix well.

[0127] 4. Boil in a 100℃ metal bath for 10 minutes. Calculate the sample loading volume according to the required loading amount and sample concentration for immunoblotting experiments. The protein can be stored at -20℃ for later use.

[0128] VI. Co-immunoprecipitation experiment

[0129] 1. Take out the treated cells, discard the culture medium in the dish, and gently wash twice with pre-cooled PBS;

[0130] 2. Add 500 μL IP lysis buffer to each culture dish and lyse on ice for 30 minutes;

[0131] 3. Collect the cell lysate into a pre-cooled EP tube, centrifuge at 3000 rpm, 5 min, 4°C, and transfer the supernatant into a new pre-cooled EP tube;

[0132] 4. Transfer part of the supernatant to a new centrifuge tube, and further ultrasonically disrupt the remaining part, with 3 seconds of disruption each time, 3 seconds of rest, and 3 cycles of disruption;

[0133] 5. Centrifuge the cell lysate after ultrasound at 12000 rpm, 15 min, 4°C;

[0134] 6. Mix the supernatant with the supernatant from step 4 and detect the protein concentration of the sample;

[0135] 7. Divide the lysate into two parts, aspirate 1000ug protein in one part, add IP primary antibody according to the antibody manual, shake slowly at 4℃ overnight, aspirate the remaining part as input, add 5×SDS loading buffer in proportion to the volume, boil in a 100℃ metal bath for 10 minutes, and store the sample at -20℃;

[0136] 8. Take 20ul of agarose bead suspension (bead content is 50%) for every 1000ug protein sample and wash with IP Buffer, centrifuge at 3000rpm, 4℃ for 2 minutes, repeat the wash 3 times, then resuspend the beads with an equal volume of IP Buffer, add to the protein lysis buffer in step 4, and shake slowly at room temperature for 2h;

[0137] 9. Centrifuge at 3000 rpm, 4°C for 2 minutes, discard the supernatant, add IP Buffer to resuspend the beads and wash, centrifuge at 3000 rpm, 4°C for 2 minutes, repeat the wash 3 times;

[0138] 10. Remove the supernatant by centrifugation, add an equal volume of 2xSDS to the beads, mix well, boil in a 100℃ metal bath for 5 minutes, cool on ice and then load.

[0139] 7. Hematoxylin-eosin staining (H&E)

[0140] 1. Take out the frozen sections and let them stand at room temperature until the water mist on the sections evaporates completely. Then soak and wash them twice with PBS, 5 minutes each time, to completely clean the embedding medium OCT.

[0141] 2.4% paraformaldehyde immersion fixation for 15 minutes;

[0142] 3. Put in PBS and soak and wash twice, 5 minutes each time;

[0143] 4. Prepare hematoxylin staining solution, soak for 3-5 minutes (depending on the type of tissue to be stained), soak once in running water, and observe the coloring of the cell nucleus under a microscope to decide whether to re-stain;

[0144] 5. Prepare eosin staining solution, soak for 1 minute, soak again in running water, and observe the cytoplasm staining under a microscope to decide whether to re-stain;

[0145] 6. Prepare anhydrous ethanol gradient dehydration solution in a fume hood: 75%, 85%, 95%, 100% (I), 100% (II), and immerse and dehydrate for 5 seconds in sequence;

[0146] 7. In a fume hood, make it transparent and soak in xylene (I) for 1 minute; xylene (II) for 1 minute;

[0147] 8. Dry xylene in a fume hood, drop an appropriate amount of neutral gum on the slide, and seal the slide with a coverslip, making sure to cover all tissues and without bubbles;

[0148] 9. Take photos using an inverted microscope.

[0149] 8. Biochemical index examination

[0150] 1. Total cholesterol assay kit

[0151] Mouse plasma stored at -80°C was taken out and melted on ice. 2 μL plasma was taken from each mouse and added to a 96-well plate. Standards and blank controls were added. 200 μL working solution was quickly added to each well and the plates were incubated at 37°C for 10 minutes. The wavelength of the microplate reader was set to 505 nm, and the total plasma cholesterol concentration was calculated according to the formula.

[0152] 2. Triglyceride Assay Kit

[0153] Take 2 μL of plasma from each mouse and add it to the well plate, add the standard and blank control, quickly add 200 μL of working solution to each well, incubate at 37°C for 10 minutes, set the wavelength of the microplate reader to 505 nm, and calculate the plasma triglyceride concentration according to the formula.

[0154] 3. Low / High Density Lipoprotein Cholesterol Assay Kit

[0155] 1.8 μL of plasma was taken from each mouse and added to the well plate, and the corresponding standard and blank control were added. 180 μL of R1 working solution was added to each well, and the well was incubated at 37°C for 5 minutes. The wavelength of the microplate reader was set to 600 nm to read the R1 value. Subsequently, 60 μL of R2 working solution was added to each well, and the well was incubated at 37°C for 5 minutes. The wavelength was kept constant, and the R2 value was read. The plasma low-density lipoprotein cholesterol / high-density lipoprotein cholesterol concentration was calculated according to the formula.

[0156] IX. Experimental Animals and Construction of Atherosclerosis Model

[0157] 1. Experimental Animals

[0158] All experimental operations were in compliance with the regulations of the Experimental Animal Management Committee of Tianjin Medical University and the Animal Experiment Welfare Ethics Review of the Department of Laboratory Animal Science of Tianjin Medical University, number: TMUaMEC 2021014.

[0159] All mice used in this experiment were ApoE knockout mice, and 6-8 week old male mice were selected for the experiment.

[0160] 2. Construction of Atherosclerosis Model

[0161] Take ApoE from 6-8 weeks old - / - Mice were subjected to partial ligation (PL) of the left common carotid. After ligation, the left common carotid was in a turbulent state, and the successful establishment of the atherosclerosis model could be observed 4 weeks later.

[0162] 10. Statistical Methods

[0163] The experimental data were analyzed and plotted using GraphPad Prism 8 software. For all quantitative experimental results in the study, each group of data was tested to see if they conformed to normal distribution. Those that conformed to normal distribution were expressed as mean ± standard error (Mean ± SEM), and the unpaired-independent samples T test was used to compare the two groups of continuous variables; those that did not conform to normal distribution were compared between the two groups using the Mann-Whitney test; multiple groups were further compared using one-way ANOVA or two-way ANOVA. P values ​​were marked on the graph, and P values ​​less than 0.05 were considered significant; those not marked were all P>0.05.

[0164] 11. Preparation of Mesoporous Silica Nanoparticles (MSNP) by Sol-Gel Method

[0165] 1. Prepare 25% CTAC (hexadecyltrimethylammonium chloride) solution: weigh 10 g CTAC and place it in a 50 mL centrifuge tube, add 30 mL ultrapure water, and heat and sonicate at 37°C until completely dissolved;

[0166] 2. Take 171 mL of ultrapure water from a measuring cylinder and pour it into a 250 mL beaker. Add 9 mL of 25% CTAC solution and place it on a magnetic stirrer at 550 rpm. Heat to 85°C while stirring with a 1.5 cm magnetic rod.

[0167] 3. Weigh 0.72g of triethanolamine (TEA-ol) in a 15mL centrifuge tube, add ultrapure water to make up the volume to 4mL, shake and mix, uniformly add to a beaker with a reaction temperature of 85°C, continue stirring for 30 minutes, and then uniformly pour 6mL of tetraethyl silicate (TEOS) into the beaker, maintain the reaction temperature, observe the changes in the reaction system at all times, and fine-tune the speed according to the changes. Continue the reaction until the upper oil phase reacts completely (about 3h), and then terminate the reaction;

[0168] 4. After the solution in the beaker has cooled to room temperature, add 120 mL of anhydrous ethanol and let it stand overnight to allow the MSNP to fully flocculate. The settled MSNP solution is divided into 50 mL centrifuge tubes and centrifuged at 10,000 rpm for 1 h. The supernatant is discarded and 25 mL of a mixed solution of hydrochloric acid / ethanol (hydrochloric acid: ethanol = 10 mL: 490 mL) is added to the tube. The precipitate is redispersed by water bath ultrasound for 30 min. Repeat the above operation 3 times to fully remove the residual surfactant CTAC;

[0169] 5. After the last centrifugation, discard the supernatant, add 25mL of anhydrous ethanol to the centrifuge tube, and re-disperse the precipitate by water bath ultrasound. Repeat the operation of centrifuging at 10,000rpm for 1h and resuspending the precipitate with anhydrous ethanol 3 times to fully remove the residual hydrochloric acid in the system. After the last centrifugation and resuspending the precipitate, centrifuge at 4,500rpm for 10min to remove the large particles agglomerated during the synthesis process, and take the supernatant to obtain the MNSP finished product with uniform particle size and stable dispersion;

[0170] 6. Take an empty 1.5mL centrifuge tube, weigh it on an analytical balance and record it, take 1mL of MSNP solution into an empty centrifuge tube, centrifuge it at 15000rpm for 20min to completely precipitate the MSNP in the solution, remove the supernatant, put it in a 65℃ oven to dry, take it out and weigh it at different time periods, and when the weight stabilizes, subtract the weight of the empty centrifuge tube from the weight of the centrifuge tube containing the dry precipitate to obtain the mass concentration of MSNP and record it. The prepared MSNP is stored in a 4℃ refrigerator for subsequent experiments.

[0171] 12. Preparation of SHAP-loaded silicasomes

[0172] 1. Preparation of fluorescently labeled MSNPs: 2 mL of 20 mg / mL MSNP was added with 4 μL of 3-aminopropyltriethoxysilane (APTES) and stirred at 80 °C at 500 rpm overnight to obtain MSNP-NH 2 . 15

[0173] The mixture was centrifuged at 000 rpm for 20 min, and the precipitate was washed with ethanol. Then, 40 μL of 1 mg / mL Dy680-NHS dye (dissolved in DMF) was added and stirred at 500 rpm at room temperature overnight to obtain Dy680 fluorescently labeled MSNPs, which can be used for the subsequent preparation of fluorescently labeled silicasome or SHAP-silicasome.

[0174] 2. Preparation of MSNPs loaded with SHAP peptides: Take 1 mL of 20 mg / mL MSNP ethanol suspension, centrifuge at 15000 rpm for 20 min, and disperse it in ddH 2 Weigh 20 mg of SHAP and dissolve it in 20 mL of ddHO. 2 O, add MSNP and incubate for 10 min to allow SHAP to fully adsorb on MSNP. After centrifugation at 15000 rpm for 20 min, the precipitate was dispersed in PBS for the preparation of SHAP-silicasome.

[0175] 3. Preparation of liposomes: 100 mg DSPC (distearoylphosphatidylcholine) / Chol (cholesterol) / DSPE-

[0176] A mixture of PEG2000 (distearoylphosphatidylethanolamine-polyethylene glycol 2000) (molar ratio 60:37:3) was dissolved by heating with 200 μL of ethanol at 65°C, and PBS was added to the mixture to 5 mL. The probe was ultrasonically treated for 10 min with a duty cycle of on / off 10 s / 5 s and a power output of 65 W to obtain liposomes with a size of about 150 nm and a concentration of 20 mg / mL, which were used as biofilms to encapsulate MSNPs.

[0177] 4. Preparation of SHAP-silicasome: Take 2 mL of liposome with a concentration of 20 mg / mL, add the prepared SHAP-MSNP, and ultrasonicate the probe on ice for 5 minutes, with a working cycle of on / off 10s / 5s and a power output of 65 W to obtain SHAP-silicasome (SHAP-SLS) with complete membrane. Centrifuge at 15000 rpm for 20 minutes, resuspend the precipitate in 1 mL of PBS, and centrifuge at 3000 rpm for 3 minutes to remove the agglomerated particles with incomplete membrane and the metal debris detached from the ultrasonic probe.

[0178] 5. Characterization of the physicochemical properties of SHAP-silicasomes: The homogeneity and integrity of the MSNP and silicasome lipid membranes were characterized by cryo-electron microscopy. Particle size and zeta potential were measured by Malvern DLS instrument. The drug loading of each carrier was determined by subtraction. Briefly, the amount of unencapsulated SHAP (mL) detected during the preparation was measured by OD in a UV-visible spectrophotometer. 280 Determine. Encapsulation efficiency EE% = [SHAP total amount (m 0 )-Unpackaged SHAP(m 1 )] / [SHAP total (m 0 )]×100%.

[0179] Part II Experimental Results and Conclusions

[0180] 1. Acquisition and quality control identification of SHAP short peptides

[0181] According to the amino acid sequence of SHAP short peptide (NLKKDLVRRIKMLEYAL, SEQ ID NO.1), Qiangyao Biotechnology Company synthesized and obtained SHAP short peptide. At the same time, the synthesized SHAP short peptide was quality controlled and identified. The purity w was 98.29% ( Figure 2 ), which meets the experimental requirements.

[0182] 2. SHAP short peptide has no effect on the activation of endothelial cells after turbulent stimulation

[0183] 1. Turbulence stimulation can significantly activate endothelial cells

[0184] In order to verify that turbulent stimulation can activate endothelial cells, thereby causing the secretion of a series of adhesion factors and inflammatory factors. First, we built a fluid shear force system in vitro to simulate the stimulation of turbulence on human umbilical vein endothelial cells (HUVECs). Through qPCR experiments, it was found that after turbulent stimulation, it can be clearly seen that the RNA levels of VCAM-1, ICAM-1, and IL-1β in human umbilical vein endothelial cells increased significantly ( Figure 3 A), then we also used the fluid shear force system to simulate turbulence for stimulation, and found through immunofluorescence experiments that the phosphorylation of MST1 kinase upstream of the Hippo signaling pathway was significantly reduced ( Figure 3 B).

[0185] 2. Protective effect of SHAP short peptide on MST1 phosphorylation

[0186] We then constructed an in vitro fluid shear force system to simulate turbulent flow stimulation using endothelial cells treated with SHAP short peptides and untreated umbilical vein endothelial cells. The results showed that after turbulent flow stimulation, the expression level of p-MST1 / 2 decreased significantly. [29-31] However, the addition of SHAP short peptide did not significantly affect the expression of p-MST1 ( Figure 4 A). Further immunoprecipitation experiments were performed to detect the binding of the three subunits of PP2A (PP2Aa, PP2Ac, and STRN3). It was found that turbulent stimulation significantly reduced the binding of STRN3 to PP2Ac, but this phenomenon was not reversed after treatment with the SHAP short peptide ( Figure 4 B). We then used immunofluorescence to further explore the effect of SHAP treatment on endothelial cell MST1 phosphorylation. The results confirmed that SHAP short peptide treatment did not significantly improve the reduction in MST1 phosphorylation levels caused by turbulence stimulation ( Figure 4 C).

[0187] 3. SHAP short peptide cannot protect endothelial activation induced by turbulence

[0188] In order to verify the protective effect of SHAP short peptide on human umbilical vein endothelial cells, we built a fluid shear force system in vitro to simulate the stimulation of turbulence on human umbilical vein endothelial cells (HUVECs). Through qPCR experiments, it was found that after turbulent stimulation, the RNA levels of VCAM-1 and ICAM-1 in human umbilical vein endothelial cells increased significantly, while after treatment with SHAP short peptide, the secretion of adhesion factors was not significantly reduced. These results confirm that the protective effect of SHAP short peptide on human umbilical vein endothelial cells is not obvious ( Figure 5 A, B).

[0189] 4. High concentration of SHAP short peptide affects cell activity

[0190] While drugs are working, they can be toxic to cells when used at too high a dose. We converted animal doses into cell doses for experiments and found that higher SHAP concentrations significantly reduced the cell activity of HUVECs by characterizing endothelial cell activity ( Figure 6 ).

[0191] Conclusion: SHAP short peptide did not play a significant role in in vitro cell experiments. After endothelial cells were stimulated by simulated turbulence in vitro, WB experiments and IP experiments were used to verify that SHAP short peptide treatment of cells did not protect the phosphorylation of MST1 / 2 kinase, and SHAP short peptide did not affect the binding of PP2Aa, PP2Ac, and STRN3.

[0192] 3. After loading with nanocarriers, the protective effect of SHAP on endothelial cell activation in vitro was significantly enhanced

[0193] 1. Characterization of Nanodrugs (SHAP-SLS)

[0194] The size and stability of nanoparticles are crucial to their effectiveness, so we analyzed the physical characteristics of nanomedicines. First, we loaded the SHAP short peptide onto silica liposomes (SLS), and characterized the size and Zeta membrane potential of the two nanoparticles (silica liposome nanoparticles and silica liposome nanoparticles loaded with SHAP short peptides). The results showed that the constructed nanomedicine had a suitable size and good stability ( Figure 7 A, B).

[0195] 2. SHAP-SLS inhibits HUVECs activation

[0196] We stimulated human umbilical vein endothelial cells with turbulent flow and treated them with SHAP short peptide (SHAP-SLS) loaded with nanocarriers to explore whether it could play a role. Through immunofluorescence and WB experiments, we confirmed that SHAP-SLS could significantly protect the phosphorylation of MST1 / 2 and reduce the expression of adhesion factor VCAM-1 protein level ( Figure 8 AC). THP-1 monocyte adhesion experiments also confirmed that SHAP-SLS treatment significantly reduced the inflammatory response of endothelial cells induced by turbulence ( Figure 8 D). The same results were confirmed by detecting the mRNA levels of adhesion factors ICAM-1 and VCAM-1 ( Figure 8 EF).

[0197] Conclusion: This invention proves that after loading with nanocarriers, SHAP-SLS can more effectively protect the phosphorylation level of MST1 / 2 in HUVECs after turbulent stimulation compared with SHAP short peptide, thereby reducing the activation of endothelial cells. 4. After loading with nanocarriers, the therapeutic effect of SHAP on atherosclerosis is significantly enhanced

[0198] 1. SHAP-SLS inhibits the progression of atherosclerosis

[0199] We established a group of 8-week-old atherosclerosis model mice by partial ligation of the left common carotid ligation, and then intravenously injected SHAP short peptide and SHAP-SLS of the same concentration for 4 weeks. Through in vivo, in vitro and HE staining, it was found that the development of atherosclerosis was significantly inhibited after SHAP-SLS treatment, and the effect was better than that of SHAP short peptide of the same concentration ( Fig. 9 AB). En Face staining of the left common carotid artery of mice revealed that the level of p-MST1 increased significantly after SHAP-SLS treatment and the expression of VCAM-1 decreased significantly ( Fig. 9 CE).

[0200] 2. Nanomedicine does not affect blood lipid levels

[0201] We tested the blood lipid levels of the model mice and found that there was no significant change in the blood lipid levels of the four groups of mice ( Fig.10 ), which shows that the therapeutic effect of SHAP short peptide on atherosclerosis is not achieved by changing blood lipid levels.

[0202] Conclusion: By constructing an atherosclerosis mouse model, the present invention further confirmed that SHAP-SLS loaded with nanocarriers can play a significant role in anti-atherosclerosis, reduce the activation of endothelial cells in the left common carotid artery of mice, and protect the phosphorylation of MST1 / 2.

[0203] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. For those skilled in the art, any modification and change made to the above embodiment according to the technical essence of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A method for preparing silica liposome nanoparticles loaded with SHAP short peptide, characterized in that: The steps include: Step 1: Prepare MSNPs loaded with SHAP peptides: Take MSNP ethanol suspension, centrifuge, discard the supernatant and disperse the precipitate in water; weigh SHAP peptides and dissolve them in water, add them to MSNP water suspension and incubate to allow SHAP peptides to be fully adsorbed on MSNPs; centrifuge again, disperse the precipitate in PBS and use it for the preparation of SHAP-loaded liposomes; Step 2: Preparation of liposomes: The mixture of DSPC / Cholesterol / DSPE-PEG2000 was heated and dissolved with ethanol, PBS was added to the mixture, and the mixture was subjected to ultrasonic treatment to obtain liposomes, which were used as biofilms to encapsulate MSNPs; Step 3: Preparation of SHAP-silicasome: Take the liposomes prepared in step 2, add the SHAP-MSNP prepared in step 1, and sonicate with an ice bath probe to obtain SHAP-silicasome with a complete membrane; resuspend the precipitate in PBS after centrifugation to obtain silica liposome nanoparticles loaded with SHAP short peptides.

2. The method for preparing SHAP short peptide-loaded silica nanoparticles according to claim 1, characterized in that: The amino acid sequence of the SHAP short peptide is shown in SEQ ID NO.

1.

3. The method for preparing SHAP short peptide-loaded silica nanoparticles according to claim 1, characterized in that: The incubation time in step 1 is 5-15 min, preferably 10 min.

4. The method for preparing SHAP short peptide-loaded silica liposome nanoparticles according to claim 1, characterized in that: The molar ratio of DSPC / Cholesterol / DSPE-PEG2000 in the DSPC / Cholesterol / DSPE-PEG2000 mixture in step 2 is 50-65:35-45:1-5, preferably 60:37:

3.

5. The method for preparing SHAP short peptide-loaded silica liposome nanoparticles according to claim 1, characterized in that: The preparation method of the MSNP specifically comprises the following steps: Step a: Add water and CTAC solution into a container and heat while stirring; Step b: adding triethanolamine aqueous solution to the heated container described in step a, continuing stirring, then adding tetraethyl silicate, maintaining the reaction temperature, continuing the reaction until the upper oil phase reacts completely, and then terminating the reaction; Step c: After the solution in the reaction container in step b is cooled to room temperature, anhydrous ethanol is added and allowed to stand overnight to allow the MSNP to fully flocculate, the precipitated MSNP solution is divided into another container, centrifuged and the supernatant is discarded, and then a hydrochloric acid / ethanol mixed solution is added, and the precipitate is redispersed by water bath ultrasound; the above precipitation redispersion operation is repeated 3 times to fully remove the residual surfactant CTAC; Step d: After the last centrifugation and discarding the supernatant, add anhydrous ethanol and re-disperse the precipitate by water bath ultrasound; repeat the operation of resuspending the precipitate with anhydrous ethanol after centrifugation 3 times to fully remove the residual hydrochloric acid in the system; after the last centrifugation and resuspending the precipitate, centrifuge at a low speed to remove the large particles agglomerated during the synthesis process, and take the supernatant to obtain the MNSP finished product with uniform particle size and stable dispersion.

6. The method for preparing SHAP short peptide-loaded silica liposome nanoparticles according to claim 5, characterized in that: In the step a, the temperature is heated to 80-90°C, preferably 85°C.

7. The method for preparing SHAP short peptide-loaded silica nanoparticles according to claim 5, characterized in that: The reaction time in step b is 2.5-3.5 h, preferably 3 h.

8. A liposome nanoparticle loaded with SHAP short peptide, characterized in that: The SHAP short peptide-loaded silica liposome nanoparticles are prepared by the preparation method of any one of claims 1 to 7.

9. Use of the SHAP short peptide-loaded silica liposome nanoparticles according to claim 8 in the preparation of a drug for alleviating and / or treating atherosclerosis.

10. Use of the SHAP short peptide-loaded silica liposome nanoparticles according to claim 8 in the preparation of a drug for reducing endothelial cell inflammatory response or endothelial cell activation.

Images