Application of lactobacillus plantarum X86 for promoting growth and development of rat offspring

Abstract

The invention belongs to the field of probiotic application, and particularly relates to application of lactobacillus plantarum X86 for promoting growth and development of rat offspring. The invention relates to an application of lactobacillus plantarum X86 in promoting the growth and development of rat offspring, in particular to an application of lactobacillus plantarum X86 in promoting the growth and development of rat offspring. The step of promoting the growth and development of the offspring of the rat comprises the steps of improving the newborn litter weight, the 7-day-old weight and the 14-day-old weight of the offspring rat, increasing the thymus index, the heart index and the liver index of the offspring of the rat, increasing the expression quantity of Occludin mRNA in the intestinal tract of the offspring of the rat and the like. According to the invention, the health of animal offspring is indirectly promoted through maternal ingestion of probiotics, and rat tests prove that the method has good effects of promoting growth and regulating intestinal flora so as to enhance early intestinal health and prevent intestinal inflammation. The use of antibiotics can be reduced from the source by preventing bacterial infection, and the development of drug resistance is restrained.

Description

Technical Field

[0001] The invention belongs to the field of probiotic application, and specifically relates to the application of a strain of Lactobacillus plantarum X86 for promoting the growth and development of rat offspring. Background Art

[0002] In 2020, my country began to promote the reduction of veterinary antibiotic use. At the same time, in animal husbandry production practice, diseases of young animals are common after birth. Among them, lamb diarrhea and calf diarrhea are common and frequently occurring diseases of young animals in animal husbandry-developed areas, which seriously affect the growth and development of young animals. It is urgent to develop effective alternative antibiotics and methods to prevent and treat such diseases.

[0003] Existing methods for promoting the growth and development of animal offspring and improving their disease resistance include Chinese herbal medicines, trace elements and vitamins. Lactic acid bacteria are a type of microbial preparation with multiple important functions, and have potential application value for the growth and development of the body and the improvement of immunity. At present, there are methods for using probiotics to prevent and treat diseases of human and livestock offspring. In addition, the application of microbial preparations in the early life stages of animals, such as the embryonic period, may greatly improve their later health and production performance. Compared with later interventions using vaccines or feed additives after the birth of animals, embryonic interventions may be more effective. During pregnancy and lactation, the mother not only provides nutrition, but also delivers many bioactive ingredients to the offspring through the placenta and breast milk, which has a significant impact on the growth and development of the offspring and the maturation of the immune system. The establishment of bacterial communities in the embryonic period has a long-term impact on the intestinal health and nutrient absorption of the offspring. However, the existing methods mostly use probiotic intervention after the birth of animals.

[0004] In order to ensure the healthy and stable development of animal husbandry, it is an important health strategy to indirectly promote the growth and development of offspring and improve their disease resistance by intervening in maternal animals. Summary of the invention

[0005] The object of the present invention is to provide a strain of Lactobacillus plantarum X86 that promotes the growth and development of rat offspring, which can promote the growth and development of rat offspring and regulate intestinal flora. After intake in late pregnancy and early lactation of rats, the newborn litter weight, 7-day-old and 14-day-old body weight of offspring rats can be increased, and the thymus, heart and liver indexes of rat offspring are increased, as well as the expression of Occludin mRNA in the intestine of rat offspring. At the same time, the intake of Lactobacillus plantarum X86 in late pregnancy and early lactation has a significant effect on the intestinal microbial community structure of rat offspring, increasing the abundance of Lactobacillus and Romboutsia in the intestine, while reducing the abundance of Escherichia-Shigella and Staphylococcus. This method is an effective bacterial agent and method for developing alternative antibiotic products to promote the growth and development of animal offspring and regulate intestinal flora.

[0006] In order to achieve the above invention object, the specific technical solution of the present invention is:

[0007] Application of Lactobacillus plantarum X86 in promoting the growth and development of rat offspring.

[0008] Furthermore, in the application, the promotion of growth and development of rat offspring includes increasing the litter weight at birth, 7-day-old and 14-day-old of the offspring rats, increasing the thymus, heart and liver indexes of the offspring rats, and increasing the expression of Occludin mRNA in the intestines of the offspring rats.

[0009] The present invention also protects the use of Lactobacillus plantarum X86 in regulating the intestinal flora of rat offspring.

[0010] Furthermore, in the application, the regulation includes increasing the abundance of Lactobacillus and Romboutsia in the intestines of rat offspring, while reducing the abundance of Escherichia-Shigella and Staphylococcus.

[0011] Furthermore, in the application, the regulation includes increasing the abundance of Firmicutes and Bacteroidota, and reducing the abundance of Proteobacteria, Verrucomicrobiota and Actinobacteriota at the phylum level; significantly reducing the abundance of Actinobacteriota in the intestines of rat offspring; at the genus level, X86 increases the abundance of Lactobacillus and Romboutsia, and reduces the abundance of Escherichia-Shigella, Akkermansia, and Staphylococcus; and significantly increases the abundance of Lactobacillus and Christensenellaceae_R-7_group in the intestines of rat offspring.

[0012] Furthermore, in the above-mentioned application, Lactobacillus plantarum X86 is taken in by rats (late pregnancy and early lactation); that is, it is taken in during the pregnancy and lactation period of the mother, not after the animal is born.

[0013] Further, in the above application, the intake of Lactobacillus plantarum X86 is 0.5×10 9 CFU.

[0014] Furthermore, in the above-mentioned application, the method of taking Lactobacillus plantarum X86 is oral administration.

[0015] Furthermore, in the above-mentioned application, the Lactobacillus plantarum X86 was deposited in the General Microbiology Center of the China Culture Collection Administration on February 27, 2023, with a deposit number of CGMCC No. 26704, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0016] Furthermore, in the above application, the intake time of Lactobacillus plantarum X86 is from 7 days before delivery to 14 days after delivery, a total of 21 days.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (I) The present invention provides a method for promoting growth and development of animals and improving their disease resistance, which indirectly promotes the health of animal offspring through maternal intake of probiotics. Experiments on rats have shown that this method has good effects in promoting growth and regulating intestinal flora to enhance early intestinal health and prevent intestinal inflammation. This method has the potential to be extended to humans and a variety of animals.

[0019] (ii) By preventing bacterial infections, we can reduce the use of antibiotics and curb the development of drug resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the growth phenomenon of Lactobacillus plantarum X86 on MRS agar plate;

[0021] Figure 2-1 Diagram of ear tagging for rat females;

[0022] Figure 2-2 Diagram of oral gavage for female rats;

[0023] Figure 2-3 This is a picture of a mother rat with her pups;

[0024] Figure 3-1 Weigh the litter weight of rat offspring;

[0025] Figure 3-2 Weighing of individual rat offspring;

[0026] Figure 3-3 for the dissection of rat offspring;

[0027] Figure 3-4This is a graph showing the litter size of rats and the weight changes of offspring rats after rats ingested Lactobacillus plantarum X86 during pregnancy and lactation;

[0028] Among them: A. litter size; B. litter weight at birth; C. weight at 7 days after birth; D. weight at 14 days after birth;

[0029] Figure 4 This is a graph showing changes in organ coefficients in offspring of rats after they ingested Lactobacillus plantarum X86 during pregnancy and lactation;

[0030] Among them: A. thymus; B. heart; C. liver; D. spleen. E. lungs; F. kidneys;

[0031] Figure 5 The graph shows the changes in the mRNA expression of inflammatory cytokines and tight junction proteins in the intestine of rat offspring after rats ingested Lactobacillus plantarum X86 during pregnancy and lactation.

[0032] Among them: A.IL-1β; B.IL-6; C.Occludin D.ZO-1; E.Claudin-1; F.Cldn-3;

[0033] Figure 6 This is a graph showing the difference in intestinal flora of rat offspring after rats ingested Lactobacillus plantarum X86 during pregnancy and lactation;

[0034] Among them: A. PCoA analysis based on weighted-unifrac; B. PLS-DA analysis based on weighted-unifrac; C. Lefse analysis;

[0035] Figure 7 This is a graph showing changes in the intestinal flora composition of rat offspring after rats ingested Lactobacillus plantarum X86 during pregnancy and lactation;

[0036] Among them: A is the comparison of the two groups of rats at the phylum level; B is the bacterial phylum with significant differences; C is the comparison of the two groups of major genera at the genus level; D is the bacterial genus with significant differences. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes and modifications to the present invention, but these equivalent forms also fall within the scope defined by the claims attached to the application.

[0038] The Lactobacillus plantarum X86 mentioned in this application has been deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on February 27, 2023, with the deposit number CGMCC No. 26704, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; this strain was recorded in Chinese Patent 2023104445200.

[0039] In the present application, % not specifically mentioned indicates the mass percentage, that is, wt%.

[0040] Embodiment 1:

[0041] Preparation of Lactobacillus plantarum X86 cell suspension

[0042] 1. Materials and Methods

[0043] 1. Materials and reagents

[0044] 1.1 Instruments and reagents

[0045] Sterilizer, clean bench (Sujing Antai Company), ultra-low temperature refrigerator (DW-HL328, Zhongke Meiling), constant temperature shaker (Eppendorf Company), high-speed refrigerated centrifuge (5810R, Eppendorf Company), small desktop centrifuge (5424, Eppendorf Company), water purifier (NW Series), spectrophotometer, MRS solid culture medium (Qingdao Haibo Company), MRS broth culture medium (Qingdao Haibo Company), PBS solution, Lactobacillus plantarum X86 strain (preservation number is CGMCC No.26704).

[0046] 1.2 Probiotic strains

[0047] Lactobacillus plantarum X86 was deposited in the General Microbiology Center of China Culture Collection Administration on February 27, 2023, with the deposit number CGMCC No. 26704, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0048] 2. Methods

[0049] 2.1 Activation of Lactobacillus plantarum X86

[0050] Take out the Lactobacillus plantarum X86 strain stored at -80℃, and quickly shake it in a 37℃ water bath to melt. Inoculate the bacterial solution with 2% of the MRS broth medium, and culture it at 37℃ and 180rpm for 15h; take the cultured bacterial solution and culture it again once, and the resulting bacterial solution is used for subsequent experiments. Inoculate the bacterial solution with streaks on MRS solid medium, culture it at 37℃ for 48h, and observe the colony morphology.

[0051] 2.2 Preparation of Lactobacillus plantarum X86 cell suspension

[0052] Cell washing: transfer the cell culture medium to a 15mL centrifuge tube, centrifuge at 6000 rpm for 8 minutes, and discard the supernatant. Add PBS solution to the cell pellet, blow and mix, centrifuge again at 6000 rpm and discard the supernatant. Add an appropriate amount of PBS to the cell pellet, blow and mix to make a cell suspension. Cell concentration determination: preheat the spectrophotometer and put the bacterial liquid tube in. First measure the OD value of the PBS liquid and adjust it to zero, then measure the OD600 of the sample tube. Cell dilution: calculate the number of cells according to the OD value, and finally use PBS solution or saline to prepare 1×10 Lactobacillus plantarum X86. 9 CFU / mL cell suspension, stored at 4℃.

[0053] 3. Results and Discussion

[0054] Lactobacillus plantarum X86 grows very quickly in MRS liquid culture medium. After 6 hours of culture, the bacterial solution becomes obviously turbid and a small amount of precipitation appears at the bottom of the test tube. Figure 1 The growth morphology of Lactobacillus plantarum X86 on MRS solid medium. Lactobacillus plantarum X86 forms milky white, smooth, raised, medium-sized colonies with neat edges in MRS solid medium. After observing the colonies formed on the MRS plate, it was found that all colonies had the same morphology, indicating that the Lactobacillus plantarum X86 strain was not contaminated by foreign bacteria and was well preserved.

[0055] Example 2: Preparation of pregnant rats and animal experiment on rats gavaged with Lactobacillus plantarum X86

[0056] 1. Materials and Methods

[0057] 1. Experimental animals and strains

[0058] SPF SD rats (weight: male 400 g, female 280 g-330 g, housed in a barrier system), cell suspension of Lactobacillus plantarum X86 (1×10 9 CFU / mL).

[0059] 2. Methods

[0060] 2.1 Animal Ethics Statement

[0061] Animal experiments were performed in accordance with the guidelines and regulations of the Institutional Animal Care and Use Committee (IACUC) to ensure the welfare treatment of the animals. All procedures of handling and restraint, gavage, blood collection, and anesthesia were performed in accordance with strict ethical standards to minimize any potential harm or suffering to the rats. Animal experiments were approved by the Ethics Committee of the School of Life Sciences of Sichuan University (SCU2203016).

[0062] 2.1 Rat breeding and mating

[0063] Rats were housed in cages at a ratio of 1:2-3 between male and female. The female rats were checked for vaginal plugs on the morning of the second day after being housed. The vaginal plugs were used to determine whether the mating of the rats was successful. The successfully mated rats were housed in a barrier system at 22°C and 40%-70% humidity, and were provided with sterilized breeding feed for rats and mice (Chengdu Dashuo Company) and free access to water.

[0064] 2.2 Grouping of pregnant rats

[0065] After 14 days of pregnancy, the rats were finally confirmed to be pregnant by palpation. The 16 rats confirmed to be pregnant were randomly divided into a control group and a Lactobacillus plantarum X86 gavage group, with 8 rats in each group. Figure 2-1 ). Pregnant rats were housed in single cages in a barrier system at 22°C and 40%-70% humidity, and were provided with breeding feed specifically for rats and free access to drinking water.

[0066] 2.3 Rat gavage test

[0067] Rats were gavaged at the same time every day. Rats in the Lactobacillus plantarum X86 gavage group were gavaged with 0.5 mL of Lactobacillus plantarum X86 cell suspension (1×10 9 CFU / mL), and the control group rats were gavaged with an equal amount of normal saline. The gavage needle used for rats was rounded at the tip. The rats were gavaged by experimenters with animal experiment operation licenses. The whole process was gentle and the gavage technique was accurate and rapid ( Figure 2-2 ). The gavage time of rats was from 7 days before delivery to 14 days after delivery, a total of 21 days. After the gavage, the rats continued to be housed in the barrier system. After the gavage, the state of each rat was carefully observed and the time of the rat's delivery was recorded. After the daily gavage, the mental state of each rat was carefully observed to prevent gavage damage.

[0068] 2.4 Parturition in rats

[0069] The behavior of the rats was observed daily, and the time of delivery was recorded.

[0070] 3. Results and Discussion

[0071] The probability of rat pregnancy confirmed by vaginal plug is not high. In this experiment, the probability of rat pregnancy is about 60%. In order to obtain a sufficient number of pregnant rats, it is necessary to increase the number of mating female rats. This experiment finally obtained 16 pregnant rats for animal testing ( Figure 2-3 ). During the whole period of intragastric administration, the rats did not show any abnormalities and no abortion occurred. All rats gave birth smoothly and had good maternal behavior after delivery. No rats bit their pups or refused to breastfeed.

[0072] Example 3: Growth and development measurement of rat offspring

[0073] 1. Materials and methods

[0074] 1. Experimental Animals

[0075] Pregnant SD rats were divided into two groups: a control group and a Lactobacillus plantarum X86 gavage group, with 8 rats in each group.

[0076] 2. Instruments and reagents

[0077] Weighing scale, veterinary fully automatic blood cell analyzer (BC-2800Vet, Shenzhen Mindray Bio-Medical Electronics Co., Ltd.)

[0078] 2. Methods

[0079] 2.1 Litter size and weight of offspring in rats

[0080] After the rats give birth, the litter size is recorded. The rat pups are picked up with a sterile cotton swab and placed on a scale covered with sterile paper to accurately weigh the birth weight of the rat offspring. To prevent the offspring from being affected by the smell of the rat offspring, a separate pair of cotton swabs is used for each rat's offspring. Figure 3-1 ), continue to feed, and continue to gavage Lactobacillus plantarum X86 suspension daily for 14 days. On the 7th and 14th days after the rats were born, the weight of each offspring of each rat was weighed ( Figure 3-2 ), and the results are averaged.

[0081] 2.2 Determination of organ coefficients in rat offspring

[0082] Two offspring of each rat were randomly selected and weighed, and the cervical vertebrae were dislocated. Figure 3-3 ), the organs (heart, liver, spleen, lung, kidney and thymus) were removed and weighed, and the organ index was calculated. The data of the two offspring of each rat were averaged.

[0083] 2.3 Blood routine test of rat offspring

[0084] Blood was collected from the rat offspring by cervical dissection, and about 0.2 mL of blood was collected in a 1.5 mL centrifuge tube. The white blood cells, three types of white blood cells, red blood cells, platelets and hemoglobin in the blood of the rat offspring were analyzed on a blood cell analyzer.

[0085] 3. Results and Discussion

[0086] 3.1 Litter size in rats

[0087] According to statistics, there was no statistical difference in the litter size between the control group and the Lactobacillus plantarum X86 group (p>0.05). The average litter size of the control group (15.13) was slightly larger than that of the control group (14.00) ( Figure 3-4 (A).

[0088] Table 1. Litter size of rat offspring

[0089]

[0090] 3.2 Body weight of rat offspring

[0091] Depend on Figure 3-4 It can be seen that there was no statistical difference in litter weight and weight of offspring at 7 and 14 days of age between the control group and the Lactobacillus plantarum X86 group ( Figure 3-4 BD, p>0.05). The average litter weight of the control group rats (103.70g) was greater than that of the control group (98.46g) because the number of litters of the control group rats was greater than that of the control group. The weight of the offspring of the Lactobacillus plantarum X86 group rats at 7 days and 14 days of age was greater than that of the control group. The results showed that after gavage of pregnant and lactating rats with Lactobacillus plantarum X86 group, the early weight of the offspring increased. Since the early weight of the offspring is positively correlated with their physical fitness, gavage of pregnant and lactating rats with Lactobacillus plantarum X86 group can promote the growth and development of the offspring.

[0092] Table 2. Litter weights of rat offspring

[0093]

[0094] 3.3 Determination of organ coefficients in rat offspring

[0095] Two rats were randomly selected from the two groups for determination of organ coefficients, and the average values ​​were taken for plotting. The weights of the rats and the weights of the organs (thymus, heart, liver, spleen and kidney) were shown in Table 3. The organ coefficients of the rats were calculated according to the following formulas, and the results are shown in Table 4.

[0096] Organ coefficient = organ weight (g) × 100 / body weight (g)

[0097] From Table 4 and Figure 4As shown in Figures B and C, the heart and liver coefficients of the offspring of rats in the Lactobacillus plantarum X86 group were significantly greater than those in the control group. In addition, the thymus coefficient of the offspring of rats in the Lactobacillus plantarum X86 group was greater than that in the control group, but the difference was not significant ( Figure 4 However, the lung index of the control group was significantly greater than that of the Lactobacillus plantarum X86 group ( Figure 4 E, p<0.0001). The above results show that after oral administration of Lactobacillus plantarum X86 group to pregnant and lactating rats, the organ weight of their offspring was affected, and the organ coefficients of thymus, heart and liver of the offspring of rats were increased, but the lung coefficient of the offspring of rats was significantly reduced.

[0098] Table 3. Weight of various organs of rat offspring

[0099]

[0100]

[0101] Table 4. Organ coefficients of rat offspring

[0102]

[0103] 3.4 Blood routine of rat offspring

[0104] Two rats from the two groups were randomly selected for blood routine test, and the average value was taken for graphing. The blood cell (leukocyte, lymphocyte, monocyte, neutrophil and erythrocyte) and hemoglobin content of the rat offspring are shown in Table 5. As shown in Table 5, the number of blood cells in the offspring of the rats in the Lactobacillus plantarum X86 group was less than that in the control group, and the difference was significant except for erythrocytes (p<0.05). The results showed that after gavage of pregnant and lactating rats, the Lactobacillus plantarum X86 group had a significant effect on the hematological indicators of the rat offspring.

[0105] Table 5. Blood cell counts and hemoglobin content of rat offspring

[0106]

[0107] Example 4: Expression of inflammatory cytokines and tight junction protein gene mRNA in the intestine of rat offspring

[0108] 1. Materials and Methods

[0109] 1. Materials

[0110] Oven, ultra-low temperature refrigerator, ice machine, cracking medium (MP company), grinder (MP 24), Animal tissue total RNA extraction kit (Vazyme), tin foil, Ultra-micro-spectrophotometer (IMPLEN), reverse transcription kit (Shanghai Bioengineering), SGExcel FastSYBR Master Mix, quantitative PCR system (StepOne Plus, ABI).

[0111] 2. Methods

[0112] 2.1 Extraction and reverse transcription of RNA from rat tissues

[0113] 2.1.1 Total RNA extraction

[0114] (1) Preparation of consumables: stainless steel medicine spoons, ophthalmic scissors, and ophthalmic tissue forceps are wrapped in tin foil, baked in a constant temperature oven at 180°C for 4 h, and then taken out and set aside after cooling to room temperature;

[0115] (2) After taking the tissue out of the -80°C freezer, thaw it on ice;

[0116] (3) Cut about 20 mg of tissue into a tube containing lysis medium (MP Company) and add lysis solution;

[0117] (4) Place the lysis medium tube in a grinder (MP -24), start the 3rd gear, 30s / time, pause for 30s, grind several times in this way, the total grinding time is 2-5min, when the tissue in the tube is homogenized and there is no obvious tissue block;

[0118] (5) Place the lysis medium tube in a centrifuge and centrifuge at 12000g for 2 min;

[0119] (6) Carefully aspirate 500 μL of the supernatant and transfer it to a 1.5 mL RNase-free centrifuge tube;

[0120] (7) Total RNA was extracted according to the instructions of the Animal Tissue Total RNA Extraction Kit (Vazyme). The RNA was placed on ice and after the concentration and purity were determined, it was stored at -80°C for later use.

[0121] 2.1.2 RNA concentration and purity determination

[0122] RNA concentration and purity were determined in The test was performed on an ultra-micro spectrophotometer (IMPLEN). The detection wells were cleaned with RNase-free H2O, and 1 μL RNase-free H2O was added to zero. 1 μL of RNA sample was taken for measurement, and the A260 / A230, A260 / A280 ratios and RNA concentration (μg / mL) were recorded. RNA samples with A260 / A280 readings between 1.8 and 2.2 were reverse transcribed. The RNA samples were diluted with RNase-free H2O to a template RNA content of 500 ng.

[0123] 2.1.3 Reverse transcription

[0124] The reverse transcription kit of Sangon was used for operation according to the instructions, and the reaction solution was prepared on ice. The reverse transcription system was prepared according to Table 1, and the reverse transcription reaction was performed according to Table 2. The cDNA was stored at -20°C.

[0125] Table 1. RNA reverse transcription reaction system

[0126] Reagents Usage Template RNA 500ng 2×II M-MLV RT Mix 10μL <![CDATA[RNase-free ddH2O]]> To 20μL

[0127] Table 2. RNA reverse transcription reaction procedure

[0128] Temperature(℃) Time (min) 25 5 42 30 85 5

[0129] 2.1.4 qRT-PCR primer design and synthesis

[0130] NCBI Primer Blast and the online primer design website of Sangon Biotechnology Co., Ltd. (https: / / store.sangon.com / nwePrimerDesign) were used to design qRT-PCR primers for related genes. qRT-PCR primer synthesis was completed by Shanghai Sangon Biotechnology Co., Ltd. The primer information is shown in Table 3.

[0131] Table 3. qRT-PCR primers for rat genes

[0132]

[0133]

[0134] 2.1.5qRT-PCR reaction

[0135] The SGExcel FastSYBR Master Mix of Bioengineering Co., Ltd. was used for qRT-PCR reaction, and the qRT-PCR amplification of each gene was performed according to the reaction system in Table 4 and the reaction program in Table 5.

[0136] Table 4. qRT-PCR reaction system

[0137] Reagents Volume (μL) SGExcel FastSYBR Master Mix(2×) 10 Forward Primer (10μM) 0.4 Reverse Primer (10μM) 0.4 cDNA (10-fold dilution) 3.0 <![CDATA[ddH2O]]> 6.2

[0138] Table 5. qRT-PCR reaction program

[0139]

[0140] (3) Expression fold calculation: GAPDH gene was used as internal reference and 2 -ΔΔCt The expression fold of each gene was calculated.

[0141] 3. Results and Discussion

[0142] Depend on Figure 5 It can be seen that the inflammatory cytokine IL-6 in the intestine of the offspring of rats in the Lactobacillus plantarum X86 gavage group was significantly reduced (p<0.05) ( Figure 5 Although IL-1β increased in the intestines of the offspring of rats given Lactobacillus plantarum X86, the difference was not significant ( Figure 5 Middle A). IL-6 is an important pro-inflammatory cytokine. The results showed that oral administration of Lactobacillus plantarum X86 to pregnant and lactating rats could reduce the intestinal inflammatory response in the offspring of rats ( Figure 5 In addition, the quantitative results of mRNA of four intestinal tight binding protein factors showed that after oral administration of Lactobacillus plantarum X86 to rats, the expression of Occludin gene mRNA in the intestine of offspring increased significantly (p<0.01), increasing by 28 times relative to the control group ( Figure 5 C). However, it was also found that the expression of Claudin-1 gene mRNA was significantly decreased ( Figure 5 E, p<0.01), but only decreased by 0.58 times. No difference was found in the expression of ZO-1 and Cldn3 gene mRNA ( Figure 5 (D, F) The results showed that intragastric administration of Lactobacillus plantarum X86 during pregnancy and lactation could significantly enhance the intestinal barrier of rat offspring.

[0143] Example 5: High-throughput sequencing analysis of 16S rRNA in intestinal contents of rat offspring

[0144] 1. Materials and methods

[0145] 1. Materials

[0146] 1.1 Experimental animals

[0147] Pregnant SD rats (SPF grade)

[0148] 1.2 Instruments and reagents

[0149] Liquid nitrogen, Soil DNA kit, AxyPrepDNA gel recovery kit (AXYGEN), Tris-HCl, agarose, TruSeqTM DNA Sample Prep Kit, Nanodrop spectrophotometer, QuantiFluor TM -ST blue fluorescence quantification system, Illumina Miseq PE300 sequencing platform (Shanghai Meiji Biotechnology Co., Ltd.).

[0150] 2. Methods

[0151] 2.1 Collection of intestinal content samples from rat offspring

[0152] The colon contents of the offspring of rats in the Lactobacillus plantarum X86 gavage group and the control group were collected aseptically in cryopreservation tubes, immediately frozen in liquid nitrogen after labeling, and stored in a -80°C refrigerator. They were transported on dry ice to Shanghai Meiji Biotechnology Co., Ltd. for subsequent experiments.

[0153] 2.2 DNA extraction

[0154] use The Soil DNAKit was used to extract DNA from the intestinal contents of rat offspring, and then the concentration and purity of the DNA were determined by Nanodrop and detected by gel electrophoresis.

[0155] 2.3 PCR amplification, library construction and Miseq sequencing

[0156] PCR amplified the V3-V4 region of the bacterial 16S rRNA gene. Primer sequences 338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT. Prepare the reaction solution according to the reaction system in Table 1, and perform PCR amplification according to the reaction procedure in Table 2. Detect the PCR product by 2% agarose gel electrophoresis, and use the AxyPrepDNA gel recovery kit (AXYGEN) to cut the gel and recover the PCR product. After elution with Tris-HCl, detect it by 2% agarose electrophoresis. Referring to the preliminary quantitative results of electrophoresis, the PCR product was quantified by QuantiFluor TM -ST blue fluorescence quantitative system for detection and quantification, and then mixed in corresponding proportions according to the sequencing requirements of each sample. The library was constructed using the TruSeqTM DNA Sample Prep Kit and sequenced based on the Illumina Miseq PE300 sequencing platform of Shanghai Meiji Biotechnology.

[0157] Table 1 PCR reaction system of bacterial 16S V3-V4 region

[0158] Reagents Volume (μL) 5×FastPfu Buffer 4 2.5mM dNTPs 2 Forward Primer (5μM) 0.8 Reverse Primer (5μM) 0.8 TransStart FastPfu Polymerase 0.4 BSA 0.2 Template DNA 10ng <![CDATA[ddH2O]]> up to 20

[0159] Table 2 PCR reaction procedures for bacterial 16S V3-V4 region

[0160]

[0161] 2.4 Bioinformatics analysis

[0162] The reads obtained by sequencing were spliced ​​and then quality controlled and filtered, OTU clustered and distinguished at different taxonomic levels. Bioinformatics analysis was performed on the MajorBio Cloud Platform (https: / / cloud.majorbio.com):

[0163] (1) Based on the results of OTU cluster analysis, the sequencing depth was tested, including species accumulation curve, Rankabundance curve, Good's Coverage curve and Shannon curve;

[0164] (2) Venn diagram analysis of the number of common and unique species at the genus and OTU levels for each group of samples;

[0165] (3) Alpha diversity analysis: Sobs, Chao, Shannon and Simpson indices of alpha diversity were analyzed at the OTU level;

[0166] (4) Beta diversity analysis: principal component analysis (PCoA) based on the unweighed unifrac algorithm;

[0167] (5) Based on OTU taxonomic information, the species composition and abundance were calculated at the phylum and genus levels;

[0168] (6) Performing inter-group difference significance analysis through Lefse to find biomarker species between different groups;

[0169] 2.5 Data Statistical Analysis

[0170] Data are expressed as Mean ± SD, and statistical analysis and plotting were performed on the Meiji Biocloud platform and Graphpad 8.0. Unpaired two-tailed t-tests were performed for two groups of data, and one-way ANOVA was used for multiple comparisons. All p values ​​were calculated at a 95% confidence level, p>0.05 was not significantly different, p<0.05 was significantly different, and p<0.01 was extremely significant.

[0171] 3. Results and Discussion

[0172] 3.1 Comparison of alpha diversity of intestinal flora in rat offspring

[0173] There was no significant change in the alpha diversity indices of the intestinal flora of rat offspring, such as the Chao index, Shannon index and Simpson index, indicating that the intake of Lactobacillus plantarum X86 by maternal rats had no significant effect on the species richness of the intestinal flora of their offspring.

[0174] 3.2 Beta diversity and Lefse analysis of intestinal flora in rat offspring

[0175] Beta diversity analysis showed that the intestinal flora composition of the offspring of rats after X86 intake was different from that of the control group (p<0.05, Figure 6 PLS-DA analysis also showed the same results ( Figure 6 (B) Lefse analysis found that the intestinal marker bacteria of the offspring of rats after X86 intake were

[0176] Christensenellaceae_R-7_group, RF39 and UCG-001, etc. Christensenellaceae_R-7_group belongs to the phylum Firmicutes, which is widely present in the intestines and mucosa of humans and animals. It is very important for host health and is significantly negatively correlated with metabolic diseases such as fat deposition and inflammation.

[0177] 3.3 Changes in intestinal flora composition in rat offspring

[0178] The microbiota, especially the intestinal microbiota, is essential for the development and balance of the immune system. The association between nutrition during pregnancy and lactation and the gut microbiome of the offspring may affect the physiology and disease susceptibility of the offspring. It has been reported that after mice were gavaged with A. muciniphila, A. muciniphila and Ruminococcus_1 were significantly enriched in the intestines of their offspring, and the fecal metabolic profile of the offspring of 3-week-old mice was changed, such as increasing the D-glutamine and D-glutamate metabolic pathways. In this experiment, there were significant differences in the intestinal flora of the offspring of rats in the X86 group compared with the control group. At the phylum level, X86 increased the abundance of Firmicutes and Bacteroidota, and reduced the abundance of Proteobacteria, Verrucomicrobiota, and Actinobacteriota ( Figure 7 X86 significantly reduced the abundance of Actinobacteriota in the intestines of rat offspring (p<0.05, Figure 7At the genus level, X86 increased the abundance of Lactobacillus and Romboutsia, and decreased the abundance of Escherichia-Shigella, Akkermansia, and Staphylococcus ( Figure 7 C). X86 significantly increased the number of Lactobacillus and

[0179] The abundance of the genus Christensenellaceae_R-7_group (p<0.05, Figure 7 In conclusion, X86 ingestion in late gestation and early lactation significantly affected the composition and abundance of gut microbiota in offspring.

[0180] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

[0181] This background section is provided to generally present the context of the invention, and the work of the presently named inventors, the work to the extent described in this background section, and aspects of this section that did not constitute prior art at the time of application are neither explicitly nor implicitly admitted to be prior art to the present invention.

Claims

1. Application of Lactobacillus plantarum X86 in promoting the growth and development of rat offspring.

2. The use according to claim 1, characterized in that: The method for promoting the growth and development of rat offspring includes increasing the birth weight, 7-day and 14-day body weight of rat offspring, increasing the thymus, heart and liver indexes of rat offspring, and increasing the expression of Occludin mRNA in the intestine of rat offspring.

3. Application of Lactobacillus plantarum X86 in regulating intestinal flora of rat offspring.

4. The use according to claim 3, characterized in that: The regulation includes increasing the abundance of Lactobacillus and Romboutsia in the intestine, while reducing the abundance of Escherichia-Shigella and Staphylococcus.

5. The use according to claim 3, characterized in that: The regulation includes increasing the abundance of Firmicutes and Bacteroidota, and reducing the abundance of Proteobacteria, Verrucomicrobiota and Actinobacteriota in the intestines of 3-week-old rat offspring at the phylum level; significantly reducing the abundance of Actinobacteriota in the intestines of rat offspring; increasing the abundance of Lactobacillus and Romboutsia, and reducing the abundance of Escherichia-Shigella, Akkermansia and Staphylococcus at the genus level; and significantly increasing the abundance of Lactobacillus and Christensenellaceae_R-7_group in the intestines of rat offspring.

6. The use according to any one of claims 1 to 5, characterized in that: Lactobacillus plantarum X86 was taken during the late pregnancy and early lactation period in rats.

7. The use according to any one of claims 1 to 5, characterized in that: The intake of Lactobacillus plantarum X86 is 0.5-10×10 9 CFU.

8. The use according to any one of claims 1 to 5, characterized in that: The intake method of Lactobacillus plantarum X86 is oral administration.

9. The use according to any one of claims 1 to 5, characterized in that: The Lactobacillus plantarum X86 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on February 27, 2023, with a deposit number of CGMCC No. 26704, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

10. The use according to claim 6, characterized in that: The intake time of Lactobacillus plantarum X86 was from 7 days before delivery to 14 days after delivery, a total of 21 days.

Images