Application of plateau tartary buckwheat

Abstract

The invention discloses application of plateau tartary buckwheat, and belongs to the technical field of medicines. The invention discloses application of plateau tartary buckwheat in preparation of weight-losing medicines or / and food. The invention further discloses a composition for losing weight. The composition comprises plateau tartary buckwheat and a pharmaceutically acceptable carrier. It is found that the plateau tartary buckwheat has good anti-obesity and lipid-lowering effects, plays a role through multiple anti-obesity mechanisms, and can relieve liver function damage, improve intestinal microbiota imbalance and reduce the levels of serum, liver, fat and intestinal inflammatory factors.

Description

Technical Field

[0001] The invention belongs to the technical field of medicines, and in particular relates to the application of plateau tartary buckwheat. Background Art

[0002] Obesity rates have been rising rapidly in recent years, with the highest incidence in countries where non-communicable diseases dominate, and have become an important global health issue. In addition to affecting the occurrence and development of metabolic diseases such as type 2 diabetes, obesity also increases the risk of depression and other neuropsychiatric diseases, and even increases the risk of cancer. Managing obesity requires a long-term, multimodal approach, such as a combination of lifestyle interventions, anti-obesity drugs, and bariatric surgery. Lifestyles mainly include exercise and calorie restriction, but they are difficult to adhere to, while anti-obesity drugs and bariatric surgery can incur high costs. Therefore, dietary intervention may be a potential way to control obesity and maintain health.

[0003] Plateau buckwheat (Fagopyrum tataricum (L.) Gaertn.) is a plant with both medicinal and edible properties, which is produced in areas with an altitude of more than 1,800 meters in southwestern China. The content of flavonoids (rutin and quercetin) in plateau buckwheat is much higher than that in common buckwheat (Moench), and is related to ecological conditions, and can prevent a variety of chronic diseases. The present invention explores the effect of buckwheat on obese mice induced by a high-fat diet through experimental research, in order to find a possible solution strategy to improve obesity, inflammation and metabolic disorders caused by a high-fat diet. Summary of the invention

[0004] The invention provides an application of plateau tartary buckwheat, which has good anti-obesity and lipid-lowering effects and exerts its effects through multiple anti-obesity mechanisms.

[0005] The invention also provides a composition, which uses plateau tartary buckwheat as a raw material medicine.

[0006] The technical solution adopted by the present invention is as follows:

[0007] The application of plateau tartary buckwheat disclosed in the invention is application in the preparation of weight loss medicines and / or foods.

[0008] In some embodiments of the present invention, the application is application in the preparation of medicines and / or foods for alleviating obesity induced by a high-fat diet.

[0009] In some embodiments of the present invention, the application is application in the preparation of a drug having weight loss and at least one of the following functions:

[0010] (1) Lowering blood lipids;

[0011] (2) Alleviate liver damage;

[0012] (3) Regulate intestinal flora;

[0013] (4) Anti-inflammatory.

[0014] In some embodiments of the present invention, the medicinal part of plateau tartary buckwheat is tartary buckwheat seeds and / or tartary buckwheat husk powder.

[0015] The invention discloses a composition for weight loss, comprising plateau tartary buckwheat and a pharmaceutically acceptable carrier.

[0016] In some embodiments of the present invention, the composition is a preparation prepared by conventional methods using plateau tartary buckwheat as a raw material and adding a pharmaceutically acceptable carrier.

[0017] In some embodiments of the present invention, the preparation is an oral preparation.

[0018] In some embodiments of the present invention, the preparation is a solid oral preparation.

[0019] In some embodiments of the present invention, the medicinal part of plateau tartary buckwheat is tartary buckwheat seeds and / or tartary buckwheat husk powder.

[0020] In some embodiments of the present invention, the plateau tartary buckwheat is directly used as medicine after being crushed.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] Plateau buckwheat has good anti-obesity and lipid-lowering effects, which work through multiple anti-obesity mechanisms.

[0023] The results of animal experiments showed that plateau buckwheat showed its anti-obesity and lipid-lowering effects by reducing biomarkers such as weight gain, Lee's index increase, hyperlipidemia, fasting blood glucose and insulin resistance index increased in mice induced by a high-fat diet.

[0024] Plateau buckwheat can also effectively regulate the mRNA transcription levels of genes related to liver lipid metabolism and alleviate liver function damage.

[0025] Effect of plateau tartary buckwheat on intestinal microbiota imbalance: Intestinal microbiota imbalance is one of the important factors in the occurrence of obesity. The applicant found that plateau tartary buckwheat can change the composition of intestinal microbiota and is negatively correlated with obesity-related parameters, indicating that plateau tartary buckwheat may play an anti-obesity effect by improving intestinal microbiota imbalance.

[0026] Anti-inflammatory effect of plateau buckwheat: Inflammation is another important characteristic of obesity. Plateau buckwheat can reduce the levels of inflammatory factors in serum, liver, fat, and intestines, showing its anti-inflammatory effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Flow chart for pharmacodynamic test investigation;

[0028] Figure 2 This is a graph showing the weight curve of mice;

[0029] Figure 3 The figure is a comparison chart of mouse body weight and Lee's index, where the left figure is a body weight comparison chart and the right figure is a Lee's index comparison chart;

[0030] Figure 4 This is a comparison chart of visceral indexes of mice in different groups;

[0031] Figure 5 This is a graph showing the results of investigating biochemical indicators in the serum of mice in different groups;

[0032] Figure 6 This is the result of the fasting blood sugar survey;

[0033] Figure 7 This is the OGTT survey result diagram;

[0034] Figure 8 The area under the curve bar graph and insulin resistance index result graph of the oral glucose tolerance test (OGTT) experiment in mice;

[0035] Fig. 9 This is the Oil Red O staining result of mouse liver tissue;

[0036] Fig.10 This is a graph showing the results of investigating the transcriptional levels of key regulatory factors in lipid metabolism;

[0037] Fig.11 This is a graph showing the results of investigating the transcriptional levels of factors related to fatty acid synthesis and lipogenesis;

[0038] Fig.12 This is the result of H&E staining of mouse liver tissue;

[0039] Fig.13 This is a graph showing the results of investigating the transcriptional levels of pro-inflammatory cytokines;

[0040] Fig.14 This is a graph showing the results of investigating the transcription level of the anti-inflammatory cytokine IL-10;

[0041] Fig.15 This is a graph showing the results of the quality inspection of white adipose tissue in the epididymis, inguinal region and perirenal region of mice;

[0042] Fig.16 This is a comparison of H&E staining of mouse epididymal adipose tissue (eWAT) and subcutaneous adipose tissue (sWAT);

[0043] Fig.17 This is the result of immunofluorescence staining of the macrophage infiltration marker F4 / 80;

[0044] Fig.18 is a micrograph of the macrophage infiltration marker F4 / 80;

[0045] Fig.19 This is the result of q-PCR investigation of inflammatory markers in epididymal white adipose tissue;

[0046] Fig. 20 This is the result of the leptin level investigation;

[0047] Fig.21 This is the result of the investigation of adiponectin level;

[0048] Fig. 22 This is the result of Elisa analysis of serum inflammatory factors in obese mice induced by high-fat diet (HFD);

[0049] Fig.23 This is the result of H&E staining of colon tissue;

[0050] Fig.24 This is the result of q-PCR investigation of inflammatory markers in colon tissue;

[0051] Fig.25 This is a graph showing the results of investigating the levels of secretory immunoglobulin A (sIgA) and lipopolysaccharide (LPS) in colonic tissue;

[0052] Fig.26 It is the fluorescence image of tight junction proteins occludin, claudin1, and ZO-1 in colon tissue;

[0053] Fig. 27 This is the result of investigating the expression levels of tight junction proteins occludin, claudin1, and ZO-1 in colon tissue;

[0054] Fig.28 This is the alpha diversity diagram of the effect of plateau buckwheat on the intestinal microorganisms of mice;

[0055] Fig.29 This is the β diversity diagram of the effect of plateau buckwheat on the intestinal microorganisms of mice;

[0056] Fig.30 This is a heat map of the correlation between plateau tartary buckwheat metabolites and obesity-related indicators in mice;

[0057] Fig.31 The present invention is a flow chart of the mechanism experimental study. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with specific examples and verification of the pharmacological effects of the composition, which are intended to explain the present invention rather than to limit it. Where specific conditions are not specified in the embodiments, they are carried out under conventional conditions or conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0059] All parts involved in this application refer to parts by weight unless otherwise specified.

[0060] Example 1

[0061] This example discloses a broad targeted metabolomics study of plateau buckwheat plants. Through plant broad targeted metabolomics technology, the active ingredients in the cortex powder of plateau buckwheat were qualitatively and quantitatively analyzed.

[0062] Sample preparation: Weigh 50 mg of plateau buckwheat powder and place it in a container. Add 1200 μL of -20°C pre-cooled 70v% methanol aqueous solution internal standard extract to the container (add less than 50 mg of extract at a ratio of 1200 μL of extract for every 50 mg of sample). Vortex the sample once every 30 minutes, 30 seconds each time, for a total of 6 times. After centrifugation (speed 12000 rpm, 3 minutes), aspirate the supernatant, filter the sample with a microporous filter membrane (pore size 0.22 μm), and store it in an injection bottle for subsequent UPLC-MS / MS analysis (Note: Chromatographic mass spectrometry acquisition conditions: The data acquisition instrument system mainly includes ultra-high performance liquid chromatography (UltraPerformance Liquid Chromatography, UPLC) (ExionLC TMAD, https: / / sciex.com.cn / ) and tandem mass spectrometry (Tandem mass spectrometry, MS / MS) (Applied Biosystems 4500QTRAP, https: / / sciex.com.cn / ). The liquid phase conditions mainly include: 1) Chromatographic column: Agilent SB-C18 1.8μm, 2.1mm*100mm; 2) Mobile phase: Phase A is ultrapure water (added with 0.1% formic acid), and Phase B is acetonitrile (added with 0.1% formic acid); 3) Elution gradient: 0.00min B phase ratio is 5%, within 9.00min, the B phase ratio increases linearly to 95%, and maintains at 95% for 1min, 10.00-11.10min, the B phase ratio is reduced to 5%, and balanced at 5% for 14min; 4) Flow rate 0.35mL / min; column temperature 40℃; injection volume 4μL. The mass spectrometry conditions mainly include: electrospray ionization (ESI) temperature 550°C; ion spray voltage (IS) 5500V (positive ion mode) / -4500V (negative ion mode); ion source gas I (GSI), gas II (GSII) and curtain gas (CUR) are set to 50, 60 and 25psi respectively, and the collision induced ionization parameter is set to high. The QQQ scan uses the MRM mode and the collision gas (nitrogen) is set to medium. Through further optimization of declustering potential (DP) and collision energy (CE), the DP and CE of each MRM ion pair were completed. According to the metabolites eluted in each period, a specific set of MRM ion pairs were monitored in each period. )

[0063] Results: A total of 479 level 1 substances were detected, including 11 types of active ingredients such as flavonoids, amino acids and their derivatives, nucleotides and their derivatives, phenolic acids, lipids, organic acids, terpenes, alkaloids, tannins, kuns, lignans and coumarins.

[0064] Example 2

[0065] This example discloses an experiment on the effect of plateau tartary buckwheat on reducing weight gain and abnormal glucose and lipid metabolism in mice induced by a high-fat diet (HFD).

[0066] This experiment was approved by the Animal Ethics Committee of Yunnan University of Chinese Medicine (Kunming, China) (R-062021084).

[0067] Fifteen male C57BL / 6J mice, 6 weeks old, weighing 18-22 g, were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd. (License SCXK (Beijing) 2019-0010). All experimental animals were kept in the Experimental Animal Center of Yunnan University of Traditional Chinese Medicine and maintained at a constant temperature (22-24°C) with a 12-h light / dark cycle. The breeding and use of animals were in accordance with the Regulations on the Administration of Experimental Animals in China.

[0068] After one week of adaptive feeding, 15 mice were randomly divided into 3 groups (n=5 / group), namely CFD group, HFD group and HFD+TB group. Among them, the CFD group was fed with the control MD12031 diet, the HFD group was fed with the high-fat MD12032 diet, and the HFD+TB group was fed with a customized feed made of tartary buckwheat flour. Compared with the high-fat MD12032 diet, the customized feed made of tartary buckwheat flour replaced the sources of carbohydrates, proteins and fat components of the high-fat diet with plateau tartary buckwheat flour, so that the calories of the two feeds were roughly equivalent. The control MD12031 diet, MD12032 diet and customized feed made of tartary buckwheat flour were all purchased from Jiangsu Medison Biotechnology Co., Ltd. In this embodiment, plateau tartary buckwheat flour was selected as the plateau tartary buckwheat cortex flour, which was provided by Yunnan Zhuti Tartary Buckwheat Biotechnology Development Co., Ltd. (Zhaotong, China). The mice were fed the above-mentioned experimental diet for 16 weeks and were given free access to food and water, as shown in the attached Figure 1 shown.

[0069] To reduce the stress and pain of the mice, the mice were euthanized by cervical dislocation. The mice's heartbeat and breathing stopped. After the mice were confirmed dead, liver, fat, colon, plasma and other samples were immediately collected and stored in an ultra-low temperature refrigerator for further analysis. The remaining corpse tissues of the mice were sealed in special bags and stored in a freezer designated by the Experimental Animal Center.

[0070] 1. Measure the body weight of mice.

[0071] 2. Determination of biochemical indicators.

[0072] Kits were used to measure total cholesterol, triglycerides, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, alanine aminotransferase, and aspartate aminotransferase in mouse serum.

[0073] Total cholesterol (T-CHO) assay kit (item number A111-1-1), triglyceride (TG) assay kit (item number A110-1-1), low-density lipoprotein cholesterol (LDL-C) assay kit (item number A113-1-1), high-density lipoprotein cholesterol (HDL-C) assay kit (item number A112-1-1), alanine aminotransferase (alanine aminotransferase / ALT / GPT) test kit (item number C009-2-1), aspartate aminotransferase (aspartate aminotransferase / AST / GOT) test kit (item number C010-2-1) were all provided by Nanjing Jiancheng Bioengineering Research Institute, and the specifications were all 96T. The test was performed strictly in accordance with the instructions of the kit.

[0074] 3. Histopathological sections

[0075] Part of the mouse liver, colon, and adipose tissue were taken for paraffin embedding and OCT embedding. Tissue sections with a thickness of about 4 μm were taken for pathological staining, hematoxylin-eosin staining and oil red O staining for liver tissue, and hematoxylin-eosin staining for colon and adipose tissue. After staining, the sections were sealed with glycerol gelatin and photographed for observation.

[0076] 4. Immunofluorescence detection of the expression levels of Claudin-1, occludin, and ZO-1 in mouse colon tissue and the expression level of F4 / 80 in adipose tissue

[0077] The mouse colon and adipose tissue sections were placed in environmentally friendly dewaxing solution I for 10 minutes-environmentally friendly dewaxing solution II for 10 minutes-environmentally friendly dewaxing solution III for 10 minutes-anhydrous ethanol I for 5 minutes-anhydrous ethanol II for 5 minutes-anhydrous ethanol III for 5 minutes-distilled water. Antigen repair was then performed. After the repair was completed, it was cooled naturally, and the slides were placed in PBS (PH7.4) solution and washed on a decolorizing shaker for 3 times, each time for 5 minutes. After the sections were slightly dried, circles were drawn around the tissue with a tissue pen, BSA was added, and the sections were blocked for 30 minutes. The prepared primary antibody was added, and the sections were placed flat in a wet box and incubated overnight at 4°C, and the secondary antibody was incubated at room temperature in the dark for 50 minutes. Then DAPI counterstained the nucleus: the slides were placed in PBS (PH7.4) solution, washed 3 times on a decolorizing shaker in the dark for 5 minutes, DAPI staining solution was added, and incubated at room temperature in the dark for 10 minutes. The incubated slides were placed in PBS (PH7.4) solution and washed on a decolorizing shaker for 3 times, 5 minutes each time, and then the autofluorescence quencher B solution was added for 5 minutes, and then rinsed with running water for 10 minutes to quench the tissue autofluorescence. Finally, the slides were sealed with anti-fluorescence quenching sealing agent.

[0078] The information of the main reagents and antibodies used in the experiment is shown in Tables 1 and 2 below.

[0079] Table 1 Main experimental reagents for immunofluorescence assay

[0080] Reagents factory Part Number Anhydrous ethanol Sinopharm Chemical Reagent Co., Ltd. 100092183 Environmentally friendly dewaxing liquid Wuhan Saiweier Biotechnology Co., Ltd. G1128 Citric acid antigen retrieval solution (PH6.0) Wuhan Saiweier Biotechnology Co., Ltd. G1202 EDTA antigen retrieval solution (PH9.0) Wuhan Saiweier Biotechnology Co., Ltd. G1203 EDTA antigen retrieval solution (PH8.0) Wuhan Saiweier Biotechnology Co., Ltd. G1206 PBS buffer Wuhan Saiweier Biotechnology Co., Ltd. G0002 Tissue Autofluorescence Quencher Wuhan Saiweier Biotechnology Co., Ltd. G1221 Bovine serum albumin (BSA) Wuhan Saiweier Biotechnology Co., Ltd. GC305010 DAPI staining reagent Wuhan Saiweier Biotechnology Co., Ltd. G1012 Anti-fluorescence fading mounting medium Wuhan Saiweier Biotechnology Co., Ltd. G1401

[0081] Table 2 Immunofluorescence antibody information and repair conditions

[0082]

[0083] 5.ELISA test

[0084] The expression levels of mouse serum sIgA, LPS, MCP-1, IL-6, IL-1β, TNF-α, IL-10, leptin, and adiponectin were detected using ELISA kits (purchased from Jiangsu Enzyme Biotechnology Co., Ltd., the product number is the name of the detection index), and the experimental procedures were performed strictly in accordance with the instructions.

[0085] 6. RT-qPCR detection of mRNA transcription levels of various indicators in mouse liver, colon and adipose tissue

[0086] Total RNA from liver, colon, and adipose tissue was extracted using RNAiso Plus (AKA704, TaKaRa). III 1 st Total RNA was reverse transcribed into cDNA using Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (11141ES10, Yisheng Biotechnology (Shanghai) Co., Ltd.). Relative mRNA levels were detected using the QuantStudi real-time fluorescence quantitative PCR detection system (Applied Biosystems). q-PCR SYBR Green Master Mix (Low Rox Plus) (11199ES03, Yisheng Biotechnology (Shanghai) Co., Ltd.), the cycle conditions are: 95°C pre-denaturation for 5 min, 95°C denaturation for 10 s, 60°C annealing / extension for 30 s, and 40 cycles.

[0087] Table 3 Primer sequences

[0088] mRNA Serial Number Forward primer (5'→3') Serial Number Reverse primer (5'→3') Ppar-α 1 ACCACTACGGAGTTCACGCATG 2 GAATCTTGCAGCTCCGATCACAC CD206 3 AGCCAACACCAGCTCCTCAAGA 4 CAAAACGCTCGCGCATTGTCCA C / ebpβ 5 CAACCTGGAGACGCAGCACAAG 6 GCTTGAACAAGTTCCGCAGGGT β-actin 7 CATTGCTGACAGGATGCAGAAGG 8 TGCTGGAAGGTGGACAGTGAGG Acc 9 CCACACCTTACTACGGAGCCAT 10 GCTTCTCTACGGTGAGCTGGAA Il-10 11 CGGGAAGACAATAACTGCACCC 12 CGGTTAGCAGTATGTTGTCCAGC Fas 13 CTGCGATTCTCCTGGCTGTGAA 14 CAACAACCATAGGCGATTTCTGG Cpt1α 15 GGCATAAACGCAGAGCATTCCTG 16 CAGTGTCCATCCTCTGAGTAGC Tnf-α 17 GGTGCCTATGTCTCAGCCTCTT 18 GCCATAGAACTGATGAGAGGGAG Ppar-γ 19 GTACTGTCGGTTTCAGAAGTGCC 20 ATCTCCGCCAACAGCTTCTCCT Il-6 21 TACCACTTCACAAGTCGGAGGC 22 CTGCAAGTGCATCATCGTTGTTC Il-1β 23 TGGACCTTCCAGGATGAGGACA 24 GTTCATCTCGGAGCCTGTAGTG

[0089] 7. Metagenomic testing of intestinal contents

[0090] The CTAB method was used to extract genomic DNA from intestinal contents. The concentration, integrity, and purity of DNA were tested using the Agilent 5400 fragment analyzer system. The NEBNext Ultra II DNA library preparation kit ( UltraTM DNA Library Prep Kit for Illumina, NEB, USA, Catalog #: E7370L) was used to construct the DNA library. After the DNA sample was qualified, the sample was fragmented to 350bp using a Covaris ultrasonic crusher, and the entire library preparation was completed by end repair, A-tailing, sequencing adapter, fragment screening, PCR amplification and purification steps. Then further PCR amplification, PCR products were purified by the AMPureXP system (Beverly, USA), and the library quality was evaluated by the Agilent 5400 fragment analyzer system (Agilent, USA), and finally the library concentration was quantified by QPCR (1.5nM). According to the effective library concentration and the target data volume, the qualified library was sequenced on the Illumina NovaSeq 6000 platform using the PE150 strategy.

[0091] 8. Statistical methods

[0092] First, the applicant used GraphPad software to perform descriptive statistical analysis on the data. By calculating indicators such as the mean, standard deviation, and standard error, the central tendency and dispersion of the data can be understood. Secondly, the applicant performed inferential statistical analysis using methods such as t-test or analysis of variance (ANOVA). By comparing the differences between different groups, it is possible to determine whether there are significant differences and perform hypothesis testing. The applicant used GraphPad software to calculate the p-value and judged whether the results were statistically significant based on the set significance level (usually 0.05). In addition, the applicant also performed correlation analysis to explore the correlation between variables by calculating non-parametric correlation coefficients such as Pearson correlation coefficient or Spearman.

[0093] 9. Results

[0094] 9.1 Plateau buckwheat can reduce HFD-induced weight gain and effectively improve abnormal glucose and lipid metabolism.

[0095] After 16 weeks of high-fat diet treatment, the body weight and Lee's index of mice in the HFD group and HFD+TB group increased significantly compared with those in the CFD group. Compared with the HFD group, plateau buckwheat intervention in the HFD+TB group inhibited the increase in body weight and Lee's index caused by the high-fat diet. Figure 2 , Figure 3 shown.

[0096] In addition, if Figure 4 As shown, compared with the HFD group, the addition of highland buckwheat to the diet significantly reduced the visceral indexes (liver, kidney, and pancreas) of mice.

[0097] like Figure 5 As shown, a high-fat diet caused lipid profile disorders in mice; while plateau buckwheat reversed this change, significantly reducing the levels of total cholesterol, triglycerides, and low-density lipoprotein cholesterol in the serum of mice, and increasing the level of high-density lipoprotein cholesterol.

[0098] In order to observe the effect of plateau buckwheat on the glucose metabolism ability of mice, we measured OGTT and insulin resistance index HOMA-IR; the specific experimental steps are as follows: after fasting for 8 hours, the basal blood glucose value of mice was first collected from the tail vein blood; the mice were given an oral glucose solution at a dose of 2g / kg body weight; blood samples were collected at different time points after loading (15, 30, 60, 90, 120 minutes) and blood glucose levels were measured; the blood glucose change curve over time was plotted, and the area under the blood glucose curve (AUC) was calculated to evaluate the glucose tolerance of mice. Blood samples were collected after fasting to measure insulin levels. The HOMA-IR value was calculated using the formula: HOMA-IR = 22.5FPG × FINS, where the FPG unit is mmol / L and the FINS unit is μU / mL. The results are shown in Figure 6-Figure 8 As shown in the results, the fasting blood glucose and OGTT of obese mice induced by high-fat diet were significantly higher than those of mice in the CFD group, and the HOMA-IR index was increased, causing a certain degree of insulin resistance. Plateau buckwheat reduced fasting blood glucose and alleviated the decline in glucose utilization induced by high-fat diet.

[0099] The above results indicate that feeding plateau tartary buckwheat can reduce the weight gain induced by a high-fat diet and effectively improve abnormal glucose and lipid metabolism.

[0100] 9.2 Plateau Tartary Buckwheat Improves Lipid Metabolism and Hepatic Inflammation in Mice

[0101] By observing the oil red O staining of liver tissue, it was found that the liver of HFD mice had more red lipid droplets infiltration compared with CFD mice, while plateau buckwheat effectively inhibited lipid accumulation in liver tissue, such as Fig. 9 shown.

[0102] Histological analysis of liver tissues stained with H&E showed that vacuolization was significantly increased in mice in the HFD group compared with the CFD group, indicating the presence of extensive hepatocyte steatosis. However, supplementation with highland tartary buckwheat (HFD+TB group) reduced the occurrence of vacuolization changes, indicating that highland tartary buckwheat has a protective effect against high-fat diet-induced hepatic steatosis, such as Fig.12 shown.

[0103] In qPCR analysis of liver samples, e.g. Fig.10 and Fig.11As shown in the results, the transcriptional levels of PPAR-γ, PPAR-α, and CPT1 / α, key regulators of lipid metabolism, were significantly decreased in the HFD group compared with the CFD group; in contrast, the transcriptional levels of FAS, ACC, and CEBP / β, which are associated with fatty acid synthesis and adipogenesis, were significantly increased in the HFD group. However, the HFD+TB group supplemented with plateau tartary buckwheat showed a reversal of these effects: compared with the HFD group, plateau tartary buckwheat increased the transcriptional levels of PPAR-γ, PPAR-α, and CPT1 / α, and decreased the transcriptional levels of FAS, ACC, and CEBP / β, approaching the levels of the CFD group. These changes suggest that plateau tartary buckwheat has the potential to regulate the transcriptional levels of genes involved in lipid metabolism and adipogenesis.

[0104] like Fig.13 and Fig.14 As shown in the results, compared with the CFD group, the HFD group significantly upregulated the transcriptional levels of the proinflammatory cytokines IL-1β, IL-6, and TNF-α, while downregulated the transcriptional levels of the anti-inflammatory cytokine IL-10. In contrast, the HFD+TB group supplemented with highland tartary buckwheat reversed these changes, restoring the transcriptional levels of these inflammatory markers to levels close to those observed in the CFD group. These findings suggest that high-fat diet-induced hepatic steatosis and increased cavitation are associated with altered expression of pro-inflammatory and anti-inflammatory cytokines, and that highland tartary buckwheat can effectively alleviate hepatic steatosis and increased cavitation.

[0105] 9.3 Plateau buckwheat inhibits HFD-induced fat accumulation and reduces adipose tissue inflammation

[0106] The results of weighing the white adipose tissue in the epididymis, inguinal region and perirenal region of mice are shown in the attached figure. Fig.15 The results showed that the mass of the HFD group increased significantly compared with the CFD group, and the HFD+TB group, which added highland buckwheat to the diet, reversed these changes: the HFD+TB group significantly reduced the mass of white adipose tissue compared with the HFD group.

[0107] like Fig.16 As shown, compared with the CFD group, the volume of epididymal and inguinal white adipose tissue cells in the HFD group was significantly increased, and the HFD+TB group supplemented with highland buckwheat in the feed reversed these changes: compared with the HFD group, the HFD+TB group significantly reduced the volume of white adipose tissue.

[0108] The above results indicate that plateau buckwheat can offset the expansion and accumulation of adipose tissue caused by a high-fat diet.

[0109] like Fig.17 and Fig.18As shown in the figure, immunofluorescence staining of the macrophage infiltration marker F4 / 80 showed that a large number of macrophages were recruited in the epididymal white adipose tissue in the HFD group, which was greater than that in the CFD group. However, the HFD+TB group, which added highland buckwheat to the diet, reduced the infiltration of macrophages in the adipose tissue.

[0110] The results of q-PCR analysis of inflammatory markers in epididymal white adipose tissue are shown in the attached figure. Fig.19 The results showed that compared with the CFD group, the transcription levels of IL-1β, IL-6 and TNF-α in the HFD group were significantly upregulated, and the transcription level of IL-10 was downregulated; compared with the HFD group, the transcription levels of IL-1β, IL-6 and TNF-α in the HFD+TB group supplemented with plateau tartary buckwheat were significantly downregulated, and the transcription level of IL-10 was upregulated; the transcription levels of IL-1β, IL-6, TNF-α and IL-10 in the FD+TB group tended to be similar to those in the CFD group.

[0111] As attached Fig. 20 and 21 As shown in the figure, compared with the HFD group, the leptin level of the HFD+TB group supplemented with highland buckwheat was reduced, and the adiponectin level was increased, tending to the level of the control group.

[0112] The above results indicate that plateau tartary buckwheat can effectively alleviate adipose tissue expansion, inflammatory cell infiltration and adipokine dysregulation induced by high-fat diet. Plateau tartary buckwheat shows the potential to improve adipose tissue dysfunction and inflammation induced by high-fat diet.

[0113] 9.4 Plateau Tartary Buckwheat Reduces Serum Inflammatory Levels in HFD-Induced Obese Mice

[0114] The results of serum ELISA analysis of high-fat diet-induced obese mice are shown in the attached figure. Fig. 22 As shown. Compared with the CFD group, the levels of LPS, TNF-α, IL-6, IL-1β and MCP-1 in the serum of mice in the HFD group increased significantly, while the levels of sIgA and IL-10 decreased significantly. Compared with the HFD group, the HFD+TB group, which added highland tartary buckwheat to the diet, reduced the levels of LPS, TNF-α, IL-6 and IL-1β, and significantly increased the levels of sIgA and IL-10.

[0115] The above results showed that abnormal changes in immune and inflammatory indicators occurred in the serum of obese mice induced by high-fat diet, indicating the existence of immune and inflammatory disorders. However, plateau tartary buckwheat intervention was able to reverse these abnormal changes and make them tend to the level of the control group.

[0116] 9.5 Plateau buckwheat repairs the intestinal mucosal barrier and reduces intestinal inflammation caused by a high-fat diet

[0117] The results of H&E staining of colon tissue are as follows Fig.23As shown in the results, the colon tissue of obese mice induced by high-fat diet showed pathological changes of inflammatory cell infiltration, indicating the presence of intestinal inflammation. However, the intervention of plateau tartary buckwheat was able to reduce this damage, showing its anti-inflammatory potential.

[0118] Specifically, compared with the CFD group, the levels of IL-1β, IL-6, and TNF-α in the colon tissue of the HFD group mice increased significantly, while the level of IL-10 decreased significantly. Compared with the HFD group, the HFD+TB group, which added highland buckwheat to the diet, showed a significant decrease in the levels of IL-1β, IL-6, and TNF-α, while a significant increase in the level of IL-10. The addition of highland buckwheat restored the levels of these inflammatory factors and made them tend to the levels of the control group, such as Fig.24 shown.

[0119] In addition, if attached Fig.25 As shown in the data, LPS levels in the colon tissue of high-fat diet-induced obese mice were significantly increased and sIgA levels were decreased, while intervention with plateau buckwheat could reverse this effect.

[0120] LPS is derived from the destruction of the intestinal barrier, so we further detected the expression level of tight junction proteins in colon tissue. Fig.26 and 27 As shown in the results, a high-fat diet reduced the expression levels of tight junction proteins (ZO-1, occludin, claudin1) in colon tissue, which further supported the impairment of intestinal barrier function. However, the addition of plateau tartary buckwheat was able to increase the expression levels of tight junction proteins and help repair the intestinal barrier.

[0121] 9.6 Plateau Tartary Buckwheat Modulates the Gut Microbiota of Mice Induced by a High-Fat Diet

[0122] Metagenomic sequencing was used to observe the changes in intestinal microbiota after high-fat diet and plateau buckwheat intervention. The Shannon index of mice in the HFD group was lower than that in the CFD group, indicating that the high-fat diet reduced the alpha diversity within the microbial community, while plateau buckwheat restored the diversity of the intestinal flora. Fig.28 shown.

[0123] The results of β-diversity analysis are shown in the attached Fig.29 As shown, the results showed that the community structure of the CFD group and the HFD+TB group with highland buckwheat added to the diet was more similar.

[0124] At the same time, the applicant performed LEfSe analysis on the HFD+TB group and the HFD group, with the filtering thresholds of Kruskal-Wallis and Wilcoxon tests lower than 0.01 and the LDA score greater than 2. The results are shown in Table 4.

[0125] Table 4 Analysis of LEfSe of dominant bacterial genera

[0126] Dominant bacteria Group LDA score P-value s__Phocaeicola_vulgatus Model Group 5.032 0.047 s__Duncaniella_dubosii Plateau Tartary Buckwheat Group 4.802 0.009 s__Duncaniella_sp__B8 Plateau Tartary Buckwheat Group 4.558 0.016 s__Muribaculum_gordoncarteri Plateau Tartary Buckwheat Group 4.162 0.028 s__Limosilactobacillus_reuteri Plateau Tartary Buckwheat Group 4.040 0.016 s__Parabacteroides_distasonis Plateau Tartary Buckwheat Group 4.011 0.009 s__Bacteroides_sp__HF_162 Plateau Tartary Buckwheat Group 3.525 0.028 s__Streptococcus_thermophilus Model Group 3.425 0.047 s__Caldibacillus_thermoamylovorans Model Group 3.425 0.009 s__Hungatella_hathewayi Plateau Tartary Buckwheat Group 3.356 0.028 s__Bacteroides_intestinalis Plateau Tartary Buckwheat Group 3.344 0.016 s__Limosilactobacillus_pontis Plateau Tartary Buckwheat Group 3.320 0.034 s__Enterocloster_clostridioformis Plateau Tartary Buckwheat Group 3.297 0.028 s__Phocaeicola_dorei Model Group 3.276 0.047 s__Bacteroides_xylanisolvens Model Group 3.275 0.016 s__Clostridium_tyrobutyricum Model Group 3.235 0.015 s__Sodaliphilus_pleomorphus Plateau Tartary Buckwheat Group 3.214 0.009 s__Lacrimispora_saccharolytica Plateau Tartary Buckwheat Group 3.150 0.047 s__Bacteroides_sp__A1C1 Model Group 3.121 0.009 s___Clostridium__scindens Plateau Tartary Buckwheat Group 3.107 0.047 s__Desulfovibrio_fairfieldensis Plateau Tartary Buckwheat Group 3.060 0.009 s__Lactobacillus_helveticus Model Group 3.041 0.009 s__Enterococcus_casseliflavus Model Group 3.015 0.047

[0127] The results showed that at the level of intestinal flora, the dominant genera in the HFD group were Streptococcus_thermophilus, Bacteroides_xylanisolvens, Enterococcus_casseliflavus, Clostridium_tyrobutyricum, Bacteroides_sp__A1C1, Lactobacillus_helveticus, Phocaeicola_dorei, Phocaeicola_vulgatus, and Caldibacillus_thermoamylovorans. Plateau tartary buckwheat specifically enriched Desulfovibrio_fairfieldensis, Limosilactobacillus_pontis, Bacteroides_intestinalis, Lacrimispora_saccharolytica, Muribaculum_gordoncarteri, Hungatella_hathewayi, Sodaliphilus_p leomorphus, Bacteroides_sp__HF_162, Duncaniella_sp__B8, Limosilactobacillus_reuteri, Clostridium__scindens, Parabacteroides_distasonis, Duncaniella_dubosii, Enterocloster_clostridioformis.

[0128] from Fig.30 It can be seen that at the species level, some intestinal bacteria are positively and negatively correlated with glycolipid metabolism and inflammatory indicators, indicating that these bacteria may affect the host's glycolipid metabolism and inflammation levels through positive or negative regulation.

[0129] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. The application of plateau tartary buckwheat is characterized by: Application in the preparation of weight loss medicines and / or foods.

2. The use according to claim 1, characterized in that: Application in the preparation of medicines and / or foods for alleviating obesity induced by a high-fat diet.

3. The use according to claim 1 or 2, characterized in that: Application in the preparation of medicines having weight loss and at least one of the following functions: (1) Lowering blood lipids; (2) Alleviate liver damage; (3) Regulate intestinal flora; (4) Anti-inflammatory.

4. The use according to claim 1 or 2, characterized in that: The medicinal parts of plateau tartary buckwheat are tartary buckwheat seeds and / or tartary buckwheat bark powder.

5. A composition for weight loss, characterized in that: The invention comprises plateau tartary buckwheat and a pharmaceutically acceptable carrier.

6. The composition according to claim 5, characterized in that The composition is prepared by using plateau tartary buckwheat as a raw material and adding a pharmaceutically acceptable carrier according to a conventional method.

7. The composition according to claim 6, characterized in that The preparation is an oral preparation.

8. The composition according to claim 6, characterized in that The preparation is a solid oral preparation.

9. The composition according to claim 5, characterized in that The medicinal parts of plateau tartary buckwheat are tartary buckwheat seeds and / or tartary buckwheat bark powder.

10. The composition according to claim 5, characterized in that The plateau buckwheat is crushed and used directly as medicine.

Images