Preparation method and application of BMP2-loaded nucleic acid nanowire ball

Abstract

The invention discloses a preparation method and application of a loaded BMP2 (bone morphogenetic protein) nucleic acid nanowire ball. The preparation method comprises the following steps: (1) cyclizing a 5 '-phosphorylated single-stranded DNA (deoxyribonucleic acid) template as shown in SEQ ID NO.01 and a single-stranded DNA probe as shown in SEQ ID NO.02 into an annular single-stranded DNA template by using T4DNA ligase; and (2) hybridizing the annular single-stranded DNA template prepared in the step (1) with a primer as shown in SEQ ID NO.03, mixing with phi29DNA polymerase and BMP2, carrying out rolling circle amplification, and then carrying out high-salt purification and precipitation, thereby obtaining the BMP2-loaded nucleic acid nanowire cluster (DNA NFs). The DNA NFs are used as an entrapment material of the BMP2, and the DNA NFs are degraded by in-vivo nuclease to control the release of the BMP2, so that the release period of the BMP2 can be greatly prolonged, the degradation of the BMP2 is delayed, and the BMP2 can be stably released in an osteogenesis period of one month.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedical materials, and in particular relates to a preparation method and application of a BMP2-loaded nucleic acid nanowire cluster. Background Art

[0002] A large number of bone defect cases caused by trauma, infection, tumors and degeneration require more effective treatments. Traditional treatments, including autologous bone grafts, allogeneic bone grafts and xenografts, have been used clinically. However, these methods have some limitations, such as limited supply, increased patient trauma in obtaining autologous bone grafts, and the potential immune response of allogeneic and xenografts. These limitations have prompted researchers to explore new strategies to replace traditional treatments. Therefore, researchers have synthesized many biomaterials for promoting bone healing, including synthetic polymers, ceramics, bioactive glasses, demineralized bone matrices and their mixtures, which have been widely studied in synthetic bone scaffolds. Bioactive growth factors, such as bone morphogenetic proteins (BMPs), platelet-rich plasma (PRP) and vascular endothelial growth factor (VEGF), have also been found to be very useful in bone tissue engineering. Among the many growth factors, bone morphogenetic protein 2 (BMP2) has been shown to have a significant osteogenesis-promoting effect and has therefore become an important additive for many synthetic bone scaffolds.

[0003] However, the half-life of BMP2 is very short, and in order to induce sufficient new bone formation, supraphysiological doses are usually required. High-dose administration may lead to serious clinical complications, such as inflammation, ectopic bone formation, and even increase the risk of inducing tumors. In addition, the production cost of BMP2 is high and the process is complicated. The economic benefits of large-dose application are low, which imposes a heavy burden on patients. Therefore, how to effectively control the release and degradation of BMP2 in vivo, reduce the dosage of BMP2, and achieve the slow release of BMP2 throughout the bone defect repair cycle to ensure its biological function is an important topic in the current field of bone biomaterial research and development. At present, the field of biomaterial research and development mainly explores the use of collagen-like substances as scaffold materials to control the release of BMP2, but the effect of collagen-like materials in prolonging the release cycle of BMP2 is still limited. Summary of the invention

[0004] The present invention aims to overcome the defects of the prior art and provide a method for preparing BMP2-loaded nucleic acid nanowires.

[0005] Another object of the present invention is to provide an application of the BMP2-loaded nucleic acid nanowires prepared by the above preparation method.

[0006] The technical solution of the present invention is as follows:

[0007] A method for preparing a BMP2-loaded nucleic acid nanowire comprises the following steps:

[0008] (1) cyclizing the 5'-phosphorylated single-stranded DNA template as shown in SEQ ID NO.01 and the single-stranded DNA probe as shown in SEQ ID NO.02 into a circular single-stranded DNA template using T4 DNA ligase;

[0009] (2) After hybridizing the circular single-stranded DNA template prepared in step (1) with the primer shown in SEQ ID NO.03, the template is mixed with phi29 DNA polymerase and BMP2 for rolling circle amplification, and then purified and precipitated with high salt to obtain the BMP2-loaded nucleic acid nanowire cluster.

[0010] In a preferred embodiment of the present invention, in the BMP2-loaded nucleic acid nanocluster, 1 ng of BMP2 is loaded per 4 mg of nucleic acid nanocluster.

[0011] Application of the BMP2-loaded nucleic acid nanowires prepared by the above preparation method in the preparation of an osteogenic induction composition.

[0012] In a preferred embodiment of the present invention, the osteoinductive composition comprises chitosan as a porous scaffold and the loaded BMP2 nucleic acid nanoclusters loaded in the loose porous structure of the porous scaffold.

[0013] An osteogenic induction composition, the effective component of which includes the BMP2-loaded nucleic acid nanowires prepared by the above preparation method.

[0014] In a preferred embodiment of the present invention, the active ingredient is the BMP2-loaded nucleic acid nanocluster.

[0015] In a preferred embodiment of the present invention, chitosan is further included as a porous scaffold, and the BMP2-loaded nucleic acid nanoclusters are loaded in the loose porous structure of the chitosan.

[0016] The beneficial effects of the present invention are:

[0017] 1. The present invention uses DNA NFs as the encapsulation material of BMP2 and utilizes the in vivo nuclease to degrade DNANFs to control the release of BMP2, which can greatly prolong the release cycle of BMP2 and delay its degradation, so that BMP2 can be stably released within a one-month osteogenic cycle.

[0018] 2. The present invention uses chitosan as a porous scaffold loaded with BMP2 nucleic acid nanowires for application in in vivo bone defect repair. Chitosan further slows the release of BMP2 in vivo, ensuring that BMP2 remains stably released during the 2-month in vivo osteogenesis cycle. Experiments have shown that its osteogenesis performance is better than that of ordinary chitosan-encapsulated BMP2.

[0019] 3. In the present invention, DNA NFs improve the sustained release performance of BMP2. Under the condition of bone injury of the same size, the dosage of BMP2 is reduced from μg level to ng level. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the preparation principle of BMP2-loaded nucleic acid nanowires in Example 1 of the present invention.

[0021] Figure 2 The characterization of the BMP2-loaded nucleic acid nanowires prepared in Example 1 of the present invention is shown.

[0022] Figure 3 It shows that the nucleic acid nanowires loaded with BMP2 in Example 2 of the present invention slowly release BMP2 and delay the degradation of BMP2 under the control of nuclease.

[0023] Figure 4 It shows that the BMP2-loaded nucleic acid nanowires in Example 3 of the present invention exhibit better osteogenic properties than naked BMP2 at the cellular level.

[0024] Figure 5 The synthesis and characterization of the BMP2 nucleic acid nanocluster chitosan (CS) porous scaffold in Example 4 of the present invention are shown.

[0025] Figure 6 It shows that the BMP2-loaded nucleic acid nanowires loaded on chitosan scaffolds in Example 5 of the present invention exhibit better osteogenic performance than the BMP2-loaded chitosan scaffolds at the animal level. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0027] Example 1

[0028] like Figure 1 As shown, this embodiment uses the rolling circle amplification (RCA) method to prepare DNA nanowires, and adds BMP2 to the reaction system to achieve the encapsulation of BMP2 by DNA nanowires, which specifically includes the following steps:

[0029] (1) A 5'-phosphorylated single-stranded DNA (ssDNA) template (Template sequence: gaattcgtcgtcgttcgaacgacgttgaattcgtcgtcgttcgaacgacgttgaattcgtcgtcgtcgttcgaacgacgtt, SEQ ID NO.01, containing a specific EcoRI restriction site: gaattc, and a site sequence that is easily recognized by nucleases in vivo: gtcgtcgttcg) and a single-stranded DNA probe (Probe sequence: cgacgaattcaacgtcgttc, SEQ ID NO.02) were circularized into a circular single-stranded DNA template using T4 DNA ligase; that is, 30 pmol of the single-stranded DNA template was added to a 50 μL reaction mixture containing 1× ligation buffer (50 mM Tris-HCl pH 7.6, 10 mM MgCl2, 1 mM ATP, 1 mM DTT) and 20 U / μL of T4 DNA ligase, after incubation at 15°C for 1 h, was treated with exonuclease I (1 U / μL) and exonuclease III at 37°C for 1 h, followed by heat inactivation at 80°C for 15 min to obtain a circularized single-stranded DNA template;

[0030] (2) The resulting circularized single-stranded DNA template was hybridized with 0.5 μM of primer (Primer sequence: cgaacgacgac, SEQ ID NO.03) in 1× isothermal amplification buffer (20 mM Tris-HCl pH 8.8, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween 20, 0.2 mM dNTP) at 95°C for 5 min. After cooling to room temperature, phi29 DNA polymerase (New England BioLabs Inc.) was added to a final concentration of 0.2 U / μL. BMP2 was also added to a final concentration of 1 μg / mL. Rolling circle amplification was performed at 30°C for 30 h. The synthesis process was as follows: Figure 1 If BMP2 is not added to the rolling circle amplification process, an empty nucleic acid nanocluster can be obtained. The obtained DNA nanocluster is purified by high salt precipitation using a saturated sodium chloride solution (6M) to obtain a BMP2-loaded nucleic acid nanocluster.

[0031] The morphology of the BMP2-loaded nucleic acid nanowires obtained in this example was observed using a scanning electron microscope. Figure 2As shown in A, its morphology is like a nanoflower, and the particle size is about 1μm. The successful encapsulation of BMP2 is determined by measuring the particle size and potential through UV spectroscopy analysis, electron microscope element analysis, and Zetasizer potentiometer. UV spectroscopy analysis shows that the BMP2-loaded nucleic acid nanowires have the characteristic peaks of BMP2, while the nucleic acid nanowires without BMP2 encapsulation do not have the characteristic peaks of BMP2 ( Figure 2 B). Electron microscopic elemental analysis showed that the BMP2-loaded nucleic acid nanocluster contained sulfur, which is unique to proteins, while the nucleic acid nanocluster without BMP2 only contained carbon, oxygen, nitrogen and phosphorus, which are contained in nucleic acids ( Figure 2 C). Zeta potential analyzer measurement shows that pure nucleic acid nanocluster is negatively charged, with a Zeta potential of less than -30; BMP2 is an amphoteric electrolyte, with a Zeta potential of about -15; and the Zeta potential of the BMP2-loaded nucleic acid nanocluster also drops to about -45, which is the superposition of BMP2 and nucleic acid nanocluster ( Figure 2 D) The above experimental results indicate that nucleic acid nanowires were successfully synthesized and loaded with BMP2.

[0032] Example 2

[0033] The BMP2-loaded nucleic acid nanowires prepared in Example 1 were immersed in ordinary DMEM culture medium and DMEM culture medium containing 10% serum (FBS, which contains a large amount of nuclease).

[0034] This example found that Figure 3 As shown in A, since ordinary DMEM culture medium does not contain nuclease, BMP2 is completely bound to the nanospheres and can remain unreleased for at least 10 days; while in DMEM culture medium containing 10% serum, since it contains nuclease, after the nanospheres are degraded, BMP2 is slowly released and accumulated. From the accumulation curve, it can be seen in this embodiment that the release of BMP2 reaches a peak at about 10 days.

[0035] This embodiment also detects the release curve, such as Figure 3 As shown in B, if the BMP2-loaded nucleic acid nanowires are directly treated with the nuclease EcoRI, the enzyme cleavage efficiency of EcoRI is very high. Figure 3 As shown in C, EcoRI can cleave a large number of nanowires within 1 hour, so BMP2 can be released quickly within 1 hour, and then the release gradually decreases, and no longer releases after 3 days. However, ordinary DMEM medium without nuclease cannot cleave nanowires ( Figure 3 C), so BMP2 is not released at all ( Figure 3B). The DMEM medium containing 10% serum contains nuclease, but the concentration and specificity are not as good as the external EcoRI nuclease. However, the serum environment is more consistent with the microenvironment in the body, and the degradation of nanowires by nuclease in the body can be simulated through serum degradation experiments. The serum-treated nanowires began to slowly degrade after 1 day and continued for a period of time, and the degradation was completed in 10-20 days ( Figure 3 C), so BMP2 achieved a slow release after 1 day, reached a peak release after 10 days, and decreased release after 20 days, which is consistent with the accumulation experiment ( Figure 3 B). The above results indicate that nucleases can release BMP2 by degrading BMP2-loaded nucleic acid nanoclusters. Nucleases in the serum-simulated in vivo microenvironment may achieve the slow degradation of nanoclusters in vivo and the long-term sustained release of BMP2.

[0036] In this example, BMP2 and BMP2-loaded nucleic acid nanowires were simultaneously treated with DMEM culture medium containing 10% serum, and the degradation of BMP2 at different time points was detected. It was found that BMP2 began to degrade in the serum environment in vitro within 1-3 days, and the residual BMP2 on the 20th day was less than 20%; while the BMP2-loaded nucleic acid nanowires were able to slowly release BMP2 and alleviate its degradation. Similar to the results of the aforementioned accumulation and release experiments, BMP2 reached a peak at about 10 days, and was still able to maintain a level of more than 60% at 20 days. The experimental results show that the BMP2-loaded nucleic acid nanowires can slowly release BMP2 under the action of nucleases, protect it from rapid degradation, and maintain its relatively high level in the system for a considerable period of time ( Figure 3 D).

[0037] In this example, BMP2 and BMP2-loaded nucleic acid nanowires were simultaneously used to treat cultured mesenchymal stem cells to detect the activation of BMP2 downstream signals. Figure 3As shown in Figure E, phosphorylated Smad1 / 5 (p-Smad1 / 5), an indicator of BMP2 downstream signal activation, can be activated in 1 hour under the stimulation of naked BMP2, and then decrease to maintain a low level; while the nucleic acid nanocluster encapsulated with BMP2 can slowly release BMP2 under the action of nuclease, and the downstream signal of BMP2 begins to show significant activation after 1 day, and gradually increases with the accumulation of BMP2, and still maintains a relatively high activation level at 5 days. The above experimental results show that nucleic acid nanocluster can effectively solve the problem of short half-life and easy degradation of BMP2, maintain the concentration of BMP2 in the system for a relatively long time, and activate the BMP2 signal of the cultured cells therein. Since the osteogenic differentiation cycle of mesenchymal stem cells is more than 21 days, slowly releasing BMP2 and maintaining a relatively high level of BMP2 in the system for a long time has better potential to induce osteogenic differentiation of mesenchymal stem cells than the rapid degradation of naked BMP2 in the system after treating cells.

[0038] Example 3

[0039] According to the calculation in this embodiment, 4 mg of nucleic acid nanowires are loaded with 1 ng of BMP2, so this embodiment can release the same amount of BMP2 to simultaneously treat mesenchymal stem cells with BMP2-loaded nucleic acid nanowires and naked BMP2 to induce their osteogenic differentiation.

[0040] like Figure 4 As shown in AD, BMP2-loaded nucleic acid nanowires showed better osteogenic differentiation potential than naked BMP2 at the cellular level. Within 7 days, the number of alkaline phosphatase (ALP)-positive cells undergoing early osteogenic differentiation was higher in the BMP2-loaded nucleic acid nanowire group than in the naked BMP2 group ( Figure 4 AB); At the late stage of osteogenic differentiation on day 21, this example used Alizarin Red to stain the calcium nodules that characterize mature osteocytes. This example found that the calcium nodule deposition in the BMP2 nucleic acid nanowire group was more than that in the naked BMP2 group ( Figure 4 CD).

[0041] By detecting gene expression, this example found that the expression of osteogenic differentiation-related transcription factor RUNX2 in the naked BMP2 group was higher than that in the loaded BMP2 nucleic acid nanowire group at 4 hours, and there was no significant difference in expression at 3 days, and the loaded BMP2 nucleic acid nanowire group was higher than the naked BMP2 group at 7 days; because within 1 day, naked BMP2 can quickly activate BMP2 signals and stimulate the expression of early osteogenic differentiation genes, but because naked BMP2 cannot maintain a high level for a long time, the induction of late gene expression is surpassed by the loaded BMP2 nucleic acid nanowire group that slowly releases BMP2.

[0042] The expression of OSX, another transcription factor related to osteogenic differentiation, appeared later than RUNX2. At 3 days, the expression of OSX in the naked BMP2 group was higher than that in the group loaded with BMP2 nucleic acid nanowires. However, at 7 days, it showed the same trend as RUNX2, with the expression of OSX in the group loaded with BMP2 nucleic acid nanowires higher than that in the naked BMP2 group. The expression of OCN, the latest osteoblast marker gene, showed significant differences between the two groups at 7 days, with the expression of OSX in the group loaded with BMP2 nucleic acid nanowires higher than that in the naked BMP2 group.

[0043] The above experimental results show that naked BMP2 can induce the expression of osteogenic-related genes in the short term, but because of its short half-life and rapid degradation, it is impossible to maintain a high concentration of BMP2 in the system for a long time; the slow release of BMP2 induced by loaded BMP2 nucleic acid nanowires can maintain the concentration of BMP2 in the system for a longer time. Although the early induction of osteogenic gene expression level is weak, the ability to induce long-term osteogenic differentiation is stronger.

[0044] Example 4

[0045] This example further demonstrates through in vivo experiments that BMP2-loaded nucleic acid nanowires have better potential for inducing osteogenic differentiation than naked BMP2, and can effectively solve the problem of rapid degradation of BMP2 in vivo and high concentration usage.

[0046] In this example, a porous scaffold containing BMP2 (CS-BMP2), a porous scaffold containing empty nucleic acid nanocluster (see Example 1 for specific preparation) (CS-RCA), and a porous scaffold containing loaded BMP2 nucleic acid nanocluster (CS-RCA-BMP2) ( Figure 5 A), Porous scaffolds without additives containing only the scaffold component chitosan (CS).

[0047] The specific synthesis steps of each sample include the following:

[0048] (1) 2 g of CS was dissolved in 50 mL of 2 vol% acetic acid solution (1:25) and mechanically stirred at 320 r / min for 3 h until it was completely dissolved to prepare a CS acidic solution.

[0049] (2) Pour the above CS acid solution into a plastic mold for synthesizing porous scaffolds (specifically, a cylindrical mold with a diameter of 6 mm and a height of 3 mm is used, and 100 μL of CS acid solution is required to fill the mold), and then add 1 M NaOH solution drop by drop. It can be observed that the CS porous scaffold precursor gradually precipitates according to the shape of the mold. At the same time, the surface pH value of the porous scaffold precursor is measured using pH test paper until the pH value is 7. After rinsing the synthesized porous scaffold precursor with saline for 3-5 times, the surface moisture is absorbed.

[0050] The chitosan scaffold (CS) group directly used 3M type I collagen solution to encapsulate the surface. The construction of CS-BMP2, CS-RCA and CS-RCA-BMP2 was sequentially adding the corresponding encapsulation component BMP2 (in this embodiment, 5 μL of 200 ng / mL BMP2 solution was added to ensure the encapsulation of 1 ng of BMP2), DNA NFs without BMP2 encapsulation (in this embodiment, 4 mg of empty DNA NFs was added), and DNA NFs encapsulating BMP2 (in this embodiment, three concentration gradients were set, namely, adding 400 ng, 2 mg and 4 mg of BMP2-loaded DNA NFs) to the above-mentioned porous scaffold precursor, and then using 3M type I collagen solution to encapsulate the surface.

[0051] The pH of the 3M type I collagen solution is 4. After the pH is adjusted to 7 by adding 1M NaOH solution drop by drop, solidification occurs, and the encapsulation process is completed.

[0052] Each group of synthesized porous scaffolds is subjected to vacuum freeze drying for 72 hours to complete the preparation of each group of porous scaffolds, which can be frozen and stored in a -80 degree refrigerator for a long time.

[0053] The morphology of the porous scaffold containing BMP2 nucleic acid nanoclusters was observed by scanning electron microscopy ( Figure 5 B), it can be seen that the loaded BMP2 nucleic acid nanoclusters are located in the loose and porous structure of the chitosan scaffold, maintaining an intact morphology.

[0054] At the same time, this example detected the release of BMP2 from the porous scaffold loaded with BMP2 nucleic acid nanowires, and found that the presence of chitosan can further slow the release of BMP2 ( Figure 5 CD).

[0055] Example 5

[0056] In this example, a critical bone defect model of rat skull was established. CS, CS-BMP2, CS-RCA and CS-RCA-BMP2 prepared in Example 4 were respectively implanted into the bone defect sites, and then micro-CT was used to evaluate the bone defect repair at 1 month and 2 months.

[0057] like Figure 6As shown, CS, CS-BMP2 and CS-RCA were unable to repair skull bone defects within 2 months. CS-BMP2 may contain too low a concentration of BMP2. Generally, 5 μg of BMP2 is required to repair bone defects in the critical skull bone defect model of rats. Only 1 ng of BMP2 was used in this example. However, CS-RCA-BMP2 can partially repair skull bone defects at low concentrations (400 ng, containing 100 pg of BMP2) and medium concentrations (2 mg, containing 500 pg of BMP2); and can almost completely repair skull bone defects at high concentrations (4 mg, containing 1 ng of BMP2).

[0058] The above results indicate that nucleic acid nanoclusters loaded with BMP2 can greatly reduce the total amount of BMP2 used, achieve bone defect repair in vivo, and solve the current problem of excessive use of BMP2 as a bone repair material, which easily causes inflammation and tumor risks.

[0059] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for preparing a BMP2-loaded nucleic acid nanowire, characterized in that: The steps include: (1) cyclizing the 5'-phosphorylated single-stranded DNA template as shown in SEQ ID NO.01 and the single-stranded DNA probe as shown in SEQ ID NO.02 into a circular single-stranded DNA template using T4 DNA ligase; (2) After hybridizing the circular single-stranded DNA template prepared in step (1) with the primer shown in SEQ ID NO.03, the template is mixed with phi29 DNA polymerase and BMP2 for rolling circle amplification, and then purified and precipitated with high salt to obtain the BMP2-loaded nucleic acid nanowire cluster.

2. The preparation method according to claim 1, characterized in that: In the BMP2-loaded nucleic acid nanocluster, every 4 mg of the nucleic acid nanocluster is loaded with 1 ng of BMP2.

3. Use of the BMP2-loaded nucleic acid nanowires prepared by the preparation method according to claim 1 or 2 in the preparation of an osteoinductive composition.

4. The use according to claim 3, characterized in that: The osteogenic induction composition comprises chitosan as a porous scaffold and the loaded BMP2 nucleic acid nanowires loaded in the loose porous structure of the porous scaffold.

5. An osteogenic induction composition, characterized in that: The effective components thereof include the BMP2-loaded nucleic acid nanowires prepared by the preparation method according to claim 1 or 2.

6. An osteoinductive composition according to claim 5, characterized in that: The effective component is the BMP2-loaded nucleic acid nanowire cluster.

7. An osteoinductive composition according to claim 5 or 6, characterized in that: It also includes chitosan as a porous scaffold, and the BMP2 nucleic acid nanowires are loaded in the loose porous structure of the chitosan.

Images