Method for rapidly identifying wisteria microphylla and tetrastigma hemsleyanum

Abstract

The invention provides a PCR (Polymerase Chain Reaction) method for rapidly identifying sinomenium acutum radix tetrastigme and wisteria tetrastigme. The PCR method comprises the following steps: 1, extracting radix tetrastigme DNA (Deoxyribonucleic Acid) by a CTAB (Cetyltrimethyl Ammonium Bromide) method; 2, carrying out PCR (Polymerase Chain Reaction) amplification by using a pair of forward and reverse primers for amplifying the DNA (Deoxyribose Nucleic Acid) sequence of the FLS11 gene promoter region; and 3, carrying out agarose gel electrophoresis analysis, and detecting a PCR product under an ultraviolet gel imaging system. The rapid, convenient and reliable identification method is established, and the method is easy to operate, low in price, good in reproducibility and good in stability and can be directly used for rapidly identifying different types of radix tetrastigme.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for rapidly identifying large-leaf wisteria clover and small-leaf wisteria clover by using PCR technology. Background Art

[0002] Tetrastigma hemsleyanum is a perennial herbaceous plant of the genus Tetrastigma in the family Vitaceae. Its official name is Tetrastigma hemsleyanum, and its underground tubers are used as medicine. It has a long history of medicinal use and has unique therapeutic effects in the treatment of chronic hepatitis, high fever in children, and tumors. It is known as a "plant antibiotic" and is one of the new "Eight Flavors of Zhejiang Province".

[0003] At present, the academic and folk circles roughly divide Tripterygium wisteriae into two categories: Tripterygium wisteriae small-leaf and Tripterygium wisteriae large-leaf. Tripterygium wisteriae large-leaf is favored by growers because of its high tuber yield, short growth cycle and good stress resistance. Tripterygium wisteriae large-leaf has cold tubers and its medicinal effects are not as good as those of Tripterygium wisteriae small-leaf. And according to the latest research results, Tripterygium wisteriae small-leaf is significantly better than Tripterygium wisteriae large-leaf in the content of total flavonoids, total phenols, polysaccharides and triterpenoids. Due to the medicinal value of Tripterygium wisteriae tubers and the growth of market demand, there has been a phenomenon in the market of using Tripterygium wisteriae large-leaf as Tripterygium wisteriae small-leaf, which not only reduces the quality of Tripterygium wisteriae, but also brings risks to consumers.

[0004] At present, the distinction between small-leaf Wisteria striata and large-leaf Wisteria striata is mainly based on the following characteristics: the color and shape of the vines, the size and shape of the leaves, the leatheriness of the leaf surface, and the serrated characteristics of the leaf edges. However, since the medicinal part of striata is mainly the root tubers, which usually reach consumers in the form of powder products, the original shape and color of the root tubers are difficult to identify, and the microscopic characteristics are also destroyed, making identification complicated. Therefore, there is an urgent need to establish a method for rapid identification of striata species.

[0005] Although there are also methods for identifying cloverleaf green in the prior art, they cannot meet the needs of rapid and accurate identification. For example, CN118392599A discloses a method for tracing the origin of cloverleaf green using mineral elements and stable isotopes. 32 S and 10B analysis can complete the traceability of Tripterygium wilfordii. Although this isotope labeling method can accurately track and determine the content, its equipment cost is high, the operator must have a high level of professional skills and theoretical knowledge, and the experimental cycle is long. For example, CN109444275A discloses a UPLCMSMS method for rapid screening of Tripterygium wilfordii and Tripterygium wilfordii. This method screens Tripterygium wilfordii and Tripterygium wilfordii based on the chromatographic information and mass spectrometry information of the test sample to determine whether the test sample contains flavonoid characteristic compounds unique to Tripterygium wilfordii. However, easily oxidizable analytes such as polyphenol plant extracts may undergo oxidation reactions in the UPLCMSMS system, resulting in reduced and unstable analyte signals, affecting the accuracy of quantitative and qualitative analysis. And the system cannot accurately judge mixed samples of Tripterygium wilfordii and Tripterygium wilfordii.

[0006] Based on the molecular identification technology of Chinese medicinal material germplasm, we directly utilize the differences in the DNA sequences of Tripterygium wilfordii to develop a rapid identification method suitable for different types of Tripterygium wilfordii that is not affected by factors such as the growth and development stage, test site, and environmental conditions. This will be able to effectively overcome the above defects and meet market demand. Summary of the invention

[0007] The purpose of the present invention is to provide a method for quickly and accurately identifying and distinguishing large-leaf vine trifoliate green and small-leaf wisteria trifoliate green, which has the characteristics of high accuracy and repeatability, high versatility, suitable for batch identification, and has the characteristics of standardized experimental process, simple and fast operation, etc. The method can be used to distinguish the tuberous roots of large-leaf vine trifoliate green and small-leaf wisteria trifoliate green, and whether there is a situation where the two types of trifoliate green tuberous roots are mixed with each other, to ensure the uniformity of the quality of the Chinese medicinal material trifoliate green; at the same time, it can also be used for tracing the origin of trifoliate green.

[0008] In one aspect, the present invention provides a method for distinguishing large-leafed schefflera from small-leafed schefflera, characterized in that:

[0009] 1) Synthesizing specific primers: synthesizing a pair of specific primers according to the primer sequences SEQ ID NO.3 and SEQ ID NO.4;

[0010] 2) Extracting DNA samples of the to-be-tested Tripterygium wilfordii;

[0011] 3) PCR amplification;

[0012] 4) Check the quality of PCR amplification products, detect the promoter sequence, and determine the type of Tripterygium wilfordii.

[0013] In some embodiments, the step 1) also includes designing primers: according to the genome sequences of Psoralea corylifolia and Psoralea corylifolia, searching for the 2000 bp sequence before the start codon ATG of the ThFLS11 gene, and designing primers according to the sequence.

[0014] In some embodiments, the designed primers are: taking the difference position between the promoter sequence SEQ ID NO.1 of the flavonoids synthesis gene ThFLS11 of the large-leafed Wisteria sinensis and the promoter sequence SEQ ID NO.2 of the flavonoids synthesis gene ThFLS11 of the small-leafed Wisteria sinensis as the origin, finding the sequence of about 150bp before and about 150bp after the difference position, designing Indel (insertion / deletion) molecular marker primers, the forward primer nucleotide sequence SEQ ID NO.3 (SYQ-F: 5'TTGCTTAGATAATTTTAGAATAAATG 3') and the reverse primer nucleotide sequence SEQ ID NO.4 (SYQ-R: 5'GATCGAACACTATGGGAATG 3').

[0015] In some embodiments, the DNA sample is extracted in step 2) by using the CTAB (cetyltrimethylammonium bromide) method.

[0016] In some embodiments, the DNA sample extraction step is:

[0017] (1) Cut an appropriate amount of sample and place it in a mortar. Add liquid nitrogen. When the tissue sample becomes brittle, crush the plant tissue with a grinding rod. When the liquid nitrogen is about to evaporate, quickly grind it into a white-green powder and place it in a 2 mL centrifuge tube.

[0018] (2) Add 600 μL of C CTAB extract (CTAB 4 g, NaCl 16.364 g, 1 M Tris-HCl 20 ml, 0.5 M EDTA 8 ml, dilute to 200 ml, pH = 8.0), mix thoroughly, and place in a 65°C water bath for 30 min, inverting and mixing every 10 min;

[0019] (3) Add 600 μL of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, mix well, incubate in a 65°C water bath for 10 min, centrifuge at 12,000 rpm for 10 min, aspirate the supernatant with a micropipette, place in a clean centrifuge tube, add isopropanol equal to the supernatant volume, and let stand at -20°C for 30 min;

[0020] (4) Centrifuge at 12000 r / min for 10 min, discard the supernatant, wash twice with 75% ethanol, air-dry, and dissolve with TE (100 mM Tris-HCl, 1 mM EDTA, pH = 8.0) buffer;

[0021] (5) DNA sample quality check: Take 5 μL of DNA sample and perform 1.0% agarose gel electrophoresis at a voltage of 120 V for about 30 min. Detect DNA bands under a UV gel imaging system.

[0022] In some embodiments, the tissue sample is selected from different parts of Tripterygium wilfordii, including but not limited to roots, stems, and leaves of Tripterygium wilfordii.

[0023] Preferably, the roots are selected from dried or freeze-dried root tubers.

[0024] In some embodiments, the PCR amplification step in step 3) is performed using the ThFLS11 gene promoter DNA as a template and designed primers for amplification.

[0025] In some embodiments, the PCR amplification in step 3) is a 20 μL reaction system composed of the following components to complete PCR amplification.

[0026]

[0027]

[0028] In some embodiments, the reaction conditions of the PCR amplification in step 3) are: pre-denaturation at 98°C for 30s; then enter the cycle of denaturation at 98°C for 10s, annealing at 60°C for 5s, extension at 72°C for 10s, 35 cycles; and finally extension at 72°C for 1min.

[0029] In some embodiments, the quality check of the PCR amplification product in step 4) includes taking the PCR product, performing agarose gel electrophoresis, and detecting the PCR product under a UV gel imaging system.

[0030] Preferably: take 5 μL of PCR product, perform 1% agarose gel electrophoresis, voltage 120 V, electrophoresis time about 30 min, and detect PCR product bands under a UV gel imaging system.

[0031] In some embodiments, step 4) also includes analyzing the differences between different sequences to determine the type of Tripterygium wilfordii.

[0032] In some embodiments, in step 4), the type of the trifoliate green is determined according to the analysis results: the size of the PCR amplification product of the large-leaf trifoliate green vine is 348 bp, and the size of the PCR amplification product of the small-leaf trifoliate green vine is 305 bp.

[0033] In some embodiments, in step 4), the origin of the Tripterygium wilfordii is determined based on the analysis results.

[0034] In another aspect, the present invention provides a primer for distinguishing large-leafed vine trifoliate green and small-leafed wisteria trifoliate green, characterized in that the primer sequence is as follows:

[0035] SEQ ID NO.3: 5'TTGCTTAGATAATTTTAGAATAAATG 3';

[0036] SEQ ID NO. 4: 5'GATCGAACACTATGGGAATG 3'.

[0037] In another aspect, the present invention provides a kit comprising the primers SEQ ID NO.3 and SEQ ID NO.4.

[0038] In another aspect, the present invention provides the method for identifying the large-leafed vine trifoliate green and the small-leafed wisteria trifoliate green, and the use of the primers or the kit in identifying the large-leafed vine trifoliate green and the small-leafed wisteria trifoliate green.

[0039] The purpose of the present invention is achieved by the following method:

[0040] Flavonoid content is a key indicator for evaluating the efficacy of Tripterygium wilfordii. In the genome detection of Tripterygium wilfordii, a total of 26 FLS genes were found. These genes are responsible for encoding flavonol synthase, and their main function is to catalyze the synthesis of flavonoid compounds. In the promoter sequence of the flavonoid synthesis gene ThFLS11 of Tripterygium wilfordii, the insertion / deletion (Indel) phenomenon leads to differences in sequence length. For example, the differences between the promoter sequences of the flavonoid synthesis gene ThFLS11 of Tripterygium wilfordii and Tripterygium wilfordii can be used as two types of Tripterygium wilfordii. In order to accurately identify the FLS genes of these two types of Tripterygium wilfordii, the present invention designs specific PCR amplification primers, and the sequences of the primers are such as SEQ ID NO.3 and SEQ ID NO.4.

[0041] The beneficial effects achieved by the present invention are as follows:

[0042] The method for identifying two types of Tripterygium wilfordii provided by the present invention has the following advantages and positive effects compared with the prior art:

[0043] The identification method provided by the present invention can quickly and accurately identify different types of Tripterygium wilfordii. Compared with the traditional morphological identification method, it has the advantages of high accuracy and wide applicability. The identification method is based on DNA sequence differences to identify the type, has high accuracy, repeatability, low cost, and is suitable for batch detection and mixed identification.

[0044] The method of the invention can be used for identifying different types of Tripterygium wilfordii in various states such as roots, stems, leaves, tubers, decoction pieces, freeze-dried powder, etc., and has a wide range of applications.

[0045] The invention provides a pair of PCR universal primers required for identification, which are specific to two types of clover, and can effectively distinguish two types of known clover from different provinces. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1Flowchart for identifying small-leaf Wisteria serrata and large-leaf Wisteria serrata;

[0047] Figure 2 Two types of root morphology of Tripterygium wilfordii;

[0048] Figure 3 Comparison of promoter sequences of ThFLS11 in two types of Tripterygium wilfordii;

[0049] Figure 4 Agarose gel electrophoresis results of PCR products of Tripterygium wilfordii from different origins.

[0050] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention. DETAILED DESCRIPTION

[0051] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0052] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0053] Example 1 Extraction of sample DNA

[0054] A total of 46 tuber samples of Tripterygium wilfordii were collected (34 wild Tripterygium wilfordii and 12 mixed samples were collected from Zhejiang, Hunan, Fujian, Guangxi, Guizhou, Jiangxi, Anhui, etc.). Figure 2 shown.

[0055] The sample DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method commonly used for extracting plant DNA. The specific steps are as follows:

[0056] 1. Weigh 0.5 g of dried root sample of Tripterygium wilfordii and put it into a 2 mL centrifuge tube. Add a small steel ball and transfer it to a high-throughput tissue grinder. Grind at 50 Hz for 30 seconds to fully crush it.

[0057] 2. Add 600 μL CTAB extract (CTAB 4 g, NaCl 16.364 g, 1 M Tris-HCl 20 ml, 0.5 M EDTA 8 mL, dilute to 200 mL, pH = 8.0), mix thoroughly, and place in a 65 ° C water bath for 30 min, inverting and mixing once every 10 min;

[0058] 3. Add 600 μL of chloroform: isoamyl alcohol (24:1) to the centrifuge tube, mix well, incubate in a 65°C water bath for 10 min, centrifuge at 12,000 rpm for 10 min, aspirate the supernatant with a micropipette, place in a clean centrifuge tube, add isopropanol equal to the volume of the supernatant, and let stand at -20°C for 30 min;

[0059] 4. Centrifuge at 12000 r / min for 10 min, discard the supernatant, wash twice with 75% ethanol, air-dry, and dissolve with TE (100 mM Tris-HCl, 1 mM EDTA, pH = 8.0) buffer;

[0060] 5. DNA sample quality check: Take 5 μL DNA sample, perform 1.0% agarose gel electrophoresis at 120 V for about 30 min, and detect DNA bands under UV gel imaging system.

[0061] Example 2 Promoter sequence cloning

[0062] 1. According to the genome sequences of the large-leafed vine trifoliate green and small-leafed vine trifoliate green, search for the 2000bp sequence before the start codon ATG of the ThFLS11 gene, and design primers based on the sequence. The nucleotide sequence of the forward primer is: 5'GTAAAGGAGGAAAGTGTGCT 3'; the nucleotide sequence of the reverse primer is: 5'TCCGCAACCAACCTTATGAG 3'.

[0063] 2. PCR amplification is a 20 μL reaction system consisting of the following components

[0064]

[0065] 3. Amplification program: pre-denaturation at 98°C for 30 seconds; then enter the cycle, denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 10 seconds, 35 cycles; finally extension at 72°C for 1 minute.

[0066] 4. PCR amplification product quality check: Take 5 μL of PCR product, perform 1% agarose gel electrophoresis at a voltage of 120 V for about 30 min, and detect the PCR product bands under a UV gel imaging system.

[0067] 5. The samples were sent to Shanghai Sangon Biotech Co., Ltd. for promoter sequence detection.

[0068] Example 3 Sequence Difference Analysis

[0069] The differences between the different sequences were analyzed using Bioxm2.7.1 bioinformatics analysis software. Figure 3 shown.

[0070] Example 4 Indel molecular marker design

[0071] The promoter sequence of the flavonoids synthesis gene ThFLS11 of the large-leafed Wisteria sinensis Tripterygium wilfordii is shown in SEQ ID NO.1 and the promoter sequence of the flavonoids synthesis gene ThFLS11 of the small-leafed Wisteria sinensis Tripterygium wilfordii is shown in SEQ ID NO.2.

[0072] Taking the difference position between the promoter sequences of the two flavonoids biosynthesis genes ThFLS11 of the three leaves as the origin, the sequence of about 150bp before and after the difference position was found, and the Indel (insertion / deletion) molecular marker primers were designed, with the forward primer nucleotide sequence SEQ ID NO.3 (SYQ-F: 5'TTGCTTAGATAATTTTAGAATAAATG 3') and the reverse primer nucleotide sequence SEQ ID NO.4 (SYQ-R: 5'GATCGAACACTATGGGAATG 3'). The specific position in the target sequence is as follows Figure 3 Marked in.

[0073] Example 5 PCR amplification of sample DNA

[0074] 1. Design primer sequences according to the DNA sequence of the FLS11 gene promoter region. The forward primer nucleotide sequence is: 5'TTGCTTAGATAATTTTAGAATAAATG 3'; the reverse primer nucleotide sequence is: 5'GATCGAACACTATGGGAATG 3'.

[0075] 2. PCR amplification reaction system, consisting of the following components

[0076]

[0077] 3. Amplification program: pre-denaturation at 98°C for 30 seconds; then enter the cycle, denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, extension at 72°C for 10 seconds, 35 cycles; finally extension at 72°C for 1 minute.

[0078] Example 6 Agarose gel electrophoresis

[0079] Take 5 μL of PCR product, run 2% agarose gel electrophoresis, voltage 120V, electrophoresis time about 45min, detect PCR product bands under UV gel imaging system, the size of the PCR amplification product of large-leaf vine trifoliate green is 348bp, and the gel results show that the band is located between DNAMarker 500bp and 250bp, and is in the middle of the two standard bands of DNA Marker but slightly below. It is consistent with the product size of 348bp. The size of the PCR amplification product of small-leaf vine trifoliate green is 305bp, and the gel results show that the band is located between DNAMarker 500bp and 250bp, in the middle of the two standard bands, close to the 250bp position, and lower than the position of the PCR amplification product of large-leaf vine trifoliate green. It is consistent with the product size of 305bp. The mixed sample trifoliate green is mixed with two types of trifoliate green. Bands are run at the 348bp and 305bp positions. The results of agarose gel electrophoresis of PCR products were obtained by band analysis, as shown in Table 1 and Figure 4 .

[0080] Table 1 Agarose gel electrophoresis analysis results of PCR products

[0081]

[0082]

[0083]

[0084]

[0085] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only and are not intended to limit the content of this application.

Claims

1. A method for distinguishing large-leafed schefflera and small-leafed schefflera, characterized in that: The method comprises the following steps: 1) Synthesizing specific primers: synthesizing a pair of specific primers according to the primer sequences SEQ ID NO.3 and SEQ ID NO.4; 2) Extracting DNA samples of the to-be-tested Tripterygium wilfordii; 3) PCR amplification; 4) Agarose gel electrophoresis was used to detect the promoter sequence and determine the type of Tripterygium wilfordii.

2. The method according to claim 1, characterized in that: The gene amplified by PCR in step 3) is the promoter DNA region of the ThFLS11 gene, which has the gene sequence shown in SEQ ID NO.1 and SEQ ID NO.

2.

3. The method according to claim 2, characterized in that: In step 3), the PCR amplification primers have nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. The method according to claim 2, characterized in that: The reaction conditions of the PCR amplification in step 3) are: pre-denaturation at 98°C for 30s; then enter the cycle of denaturation at 98°C for 10s, annealing at 60°C for 5s, extension at 72°C for 10s, 35 cycles; and finally extension at 72°C for 1min.

5. The method according to claim 1, characterized in that: In step 4), the type of the trifoliate green was determined based on the electrophoresis band of the DNA Marker: the size of the PCR amplification product of the large-leaf trifoliate green vine was 348 bp, and the size of the PCR amplification product of the small-leaf trifoliate green vine was 305 bp.

6. The method according to claim 2, characterized in that: The promoter sequence of ThFLS11 is the flavonoid synthesis gene of large-leafed schefflera and small-leafed schefflera.

7. The method according to claim 1, characterized in that: In step 2), the CTAB (cetyltrimethylammonium bromide) method is used to extract the DNA sample.

8. A primer for rapid identification of large-leafed vine trifoliate green and small-leafed wisteria trifoliate green, characterized by: The primer sequences are as follows: SEQ ID NO.3: 5'TTGCTTAGATAATTTTAGAATAAATG 3'; SEQ ID NO. 4: 5'GATCGAACACTATGGGAATG 3'.

9. A kit comprising the primers according to claim 8.

10. Use of the method according to claim 1, the primers according to claim 8 or the kit according to claim 9 in identifying large-leafed cloverleaf and small-leafed wisteria clover, preferably in identifying tuberous roots of cloverleaf.

Images