Primer group and kit for detecting occurrence or existence of PTHS

Abstract

The invention relates to the technical field of biology, in particular to a primer group and a kit for detecting whether PTHS occurs or exists. The invention discloses a primer group for detecting whether PTHS occurs or exists, and the primer group is characterized in that the primer group is an allele specific primer, and the primer is used for specifically amplifying a product at the 300th position in a base sequence as shown in SEQ ID NO.1 so as to judge whether the locus Chr18: g.52895455 of a TCF4 gene has variation or not; the primer group comprises a primer F1 and a primer R1, the base sequence of the primer F1 is as shown in SEQ ID NO.2, and the base sequence of the primer R1 is as shown in SEQ ID NO.3. The correlation between TCF4 gene variation and PTHS is clarified for the first time, the method can be used for prevention, auxiliary diagnosis and treatment of PTHS based on the scheme of the invention, an important basis is provided for accurate typing of PTHS patients, and the method can also be used for research and development of new drugs. The application of the technical scheme of the invention is expected to improve the recognition precision of PTHS, relieve the family pressure of the patient, improve the life quality of the patient, and show wide application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer set and a kit for detecting whether PTHS occurs or exists. The present invention relates to the application of whole genome sequencing technology in revealing the gene mutation mechanism of Pitt-Hopkins syndrome (PTHS). More specifically, the present invention relates to a detection method for mutations in the 3' non-coding region of the TCF4 gene and its application in the precise typing of PTHS. In addition, the present invention also relates to the role of transcription factors in the neuronal differentiation process based on the study of TCF4 gene mutations, and the correlation between the mutation and diseases such as PTHS and schizophrenia. The scheme of the present invention covers the in-depth analysis of the patient's gene mutations, as well as its application potential in the preparation of diagnostic kits, construction of biological models, screening of potential therapeutic drugs, etc. Background Art

[0002] PTHS (Pitt-Hopkins syndrome) is a rare neurodevelopmental disorder caused by mutations in the transcription factor 4 gene (TCFR4). TCF4 is a member of the helix-loop-helix (HLH) protein family and is widely expressed throughout the body and during neurodevelopment (JoséRTeixeira, Ryan A Szeto, Vinicius MA Carvalho, et al. Transcription factor 4 and its association with psychiatric disorders. Transl Psychiatry. 2021Jan 5; 11(1): 19.). To date, the various pathogenic variants found in hundreds of PTHS patients include frameshift mutations (~30% of cases), nonsense mutations (~15%), missense mutations (~15% of cases), and splice site mutations (~10%), as well as translocations and large deletions involving part or all of TCF4 (~30%) (Zollino M, Zweier C, Van Balkom ID, et al. Diagnosis and management in Pitt-Hopkins syndrome: First international consensus statement. Clin Genet. 2019 Apr; 95(4): 462-478.).In addition, genome-wide association studies (GWAS) have shown that polymorphisms in TCF4 are associated with schizophrenia and other psychiatric and neurological diseases (José R Teixeira, Ryan A Szeto, Vinicius MA Carvalho, et al. Transcription factor 4 and its association with psychiatric disorders. Transl Psychiatry. 2021 Jan 5; 11(1): 19.; Hreinn Stefansson, Roel A Ophoff, Stacy Steinberg, et al. Common variants conferring risk of schizophrenia. Nature. 2009 Aug 6; 460(7256): 744-7.; Mingfeng Li, Gabriel Santpere, Yuka Imamura Kawasawa, et al. Integrative functional genomic analysis of human brain development and neuropsychiatric risks. Science. 2018 Dec 14; 362(6420): eaat7615.; Joel Gelernter, Ning Sun, Renato Polimanti, et al. Genome-wide association study of post-traumatic stressdisorder reexperiencing symptoms in >165,000 US veterans. Nat Neurosci. 2019 Sep; 22(9):1394-1401.).

[0003] Characteristics of PTHS include distinctive facial features, delayed motor and cognitive development, possible breathing problems or recurrent seizures, gastrointestinal problems, and lack of speech (Christiane Zweier, Maarit M Peippo, Juliane Hoyer, et a. Haploinsufficiency of TCF4 causes syndromal mental retardation with intermittent hyperventilation (Pitt-Hopkins syndrome) Am J Hum Genet. 2007 May; 80(5): 994-1001.; Jeanne Amiel, Marlene Rio, Loic de Pontual, et al. Mutations in TCF4, encoding a class I basic helix-loop-helix transcription factor, are responsible for Pitt-Hopkins syndrome, a severe epilepticencephalopathy associated with autonomic dysfunction. Am J Hum Genet. 2007 May; 80(5): 988-93.; Tingting Zhao, Shengnan Wu, Yiping Shen, et al. al. Clinical and genetic characterization of 47Chinese pediatric patients with Pitt-Hopkins syndrome: a retrospective study. Orphanet J Rare Dis. 2024 Feb8; 19(1):51.).However, in recent years, an increasing number of cases have reported mild to moderate intellectual disability (Alexander Tan, Kimberly Goodspeed, Veronica Bordes Edgar. Pitt-Hopkins Syndrome: A Unique Case Study. J Int Neuropsychol Soc. 2018 Oct; 24(9): 995-1002.; Tingting Zhao, Georgi Z Genchev, Shengnan Wu, et al. Pitt-Hopkins syndrome: phenotypic and genotypic description of four unrelated patients and structural analysis of corresponding missense mutations. Neurogenetics. 2021 Jul; 22(3): 161-169.; Julie Masson, Linda Pons, Tiffany Busa, et al. Disruption and deletion of the proximal part of TCF4 areassociated with mild intellectual disability: About three new patients. Eur J Med Genet. 2022 Apr; 65(4): 104458.).

[0004] Therefore, PTHS remains an underestimated syndrome due to its rarity and heterogeneity.

[0005] However, existing technologies are insufficient in the diagnosis and treatment of PTHS, especially in the lack of effective methods for mutation detection and precise typing in the 3' non-coding region of the TCF4 gene. Summary of the invention

[0006] Based on the current situation that the existing technology lacks effective means for the diagnosis and treatment of PTHS, the present invention provides a primer set and a kit for detecting whether PTHS occurs or exists, and also provides an efficient and accurate whole genome sequencing method for revealing the gene mutation mechanism of PTHS patients, especially for the 3' non-coding region of the TCF4 gene.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] The present invention first provides an isolated nucleic acid having a base sequence shown in SEQ ID NO.1. The isolated nucleic acid sequence is a partial sequence of the TCF4 gene and contains a variation site of the TCF4 gene. The variation site of the TCF4 gene is Chr18:g.52895455. The variation site is the 300th position in the base sequence shown in SEQ ID NO.1, wherein the normal base is T and the variation base is C.

[0009] The base sequence shown in SEQ ID NO.1 is the 3' non-coding region of the TCF4 gene. This region (especially the variant site Chr18:g.52895455 of the TCF4 gene) can affect the splicing process of mRNA, thereby causing symptoms such as global developmental delay in patients. Figure 1 This is a schematic diagram of the structure of the TCF4 gene containing the mutation site Chr18:g.52895455 and its mutation site. Figure 1 Exons 17 to 20 of TCF4 are shown in the figure, and the mutation site is Chr18:g.52895455T>C, and the site is marked at the corresponding position of the 19th exon region in the TCF4 gene.

[0010] The present invention further provides a primer set for detecting whether PTHS occurs or exists, wherein the primer set is an allele-specific primer, and the primer is used to specifically amplify the product at the 300th position in the base sequence shown in SEQ ID NO.1, thereby determining whether there is a variation in the site Chr18:g.52895455 of the TCF4 gene;

[0011] The primer set includes primer F1 and primer R1. The base sequence of primer F1 is shown in SEQ ID NO.2, and the base sequence of primer R1 is shown in SEQ ID NO.3.

[0012] The present invention further provides a specific primer set for extending TCF4 mRNA, including primer F2 and primer R2, wherein the base sequence of primer F2 is shown in SEQ ID NO.5, and the base sequence of primer R2 is shown in SEQ ID NO.6.

[0013] The present invention further provides a kit for detecting whether PTHS occurs or exists, the kit is a kit for detecting whether the 3' non-coding region Chr18:g.52895455 of the TCF4 gene has a pathogenic mutation, and includes PCR primers, the primer set includes primer F1 and primer R1, the base sequence of primer F1 is shown in SEQ ID NO.2, and the base sequence of primer R1 is shown in SEQ ID NO.3. The primer set is used to specifically amplify the TCF4 gene mutation site Chr18:g.52895455.

[0014] In one embodiment of the present invention, the kit also includes reagents, buffers, etc. for PCR amplification detection. Those skilled in the art are familiar with these conventional components and detection methods.

[0015] In one embodiment of the present invention, the kit comprises the following components:

[0016] 30 μL 10×PCR buffer (Pharmacia),

[0017] 5 μL 10 mM dNTP mixture (Pharmacia),

[0018] 5 μL Taq DNA polymerase (2U / μL) (Takara),

[0019] 2.5 μL primer F1 (base sequence as shown in SEQ ID NO.2) (10 pM / μL),

[0020] 2.5 μL primer R1 (base sequence as shown in SEQ ID NO.3) (10 pM / μL),

[0021] 235 μL pure water.

[0022] In one embodiment of the present invention, the samples targeted by the kit are body fluids (blood, ascites, urine, etc.), tissue cells (such as liver tissue), etc.

[0023] The kit provided by the present invention is a kit for detection of 10 persons.

[0024] In one embodiment of the present invention, the kit contains instructions for use thereof, and the instructions for use are as follows:

[0025] 1) PCR amplification: A partial fragment of the TCF4 gene was amplified by PCR, and a mixed solution was prepared: 3 μL of 10× PCR reaction buffer, 0.5 μL of 10 mM / L dNTP, 0.5 μL of TaqDNA polymerase, 0.5 μL of 10 pM / L upstream primer F1, 0.5 μL of 10 pM / L downstream primer R1, 2 μL of genomic DNA, and pure water was added to 30 μL;

[0026] 2) PCR reaction conditions were 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 25 s, a total of 35 cycles, and 72°C total extension for 2 min. Before PCR, 20 μL of paraffin oil was added to each system to prevent liquid evaporation;

[0027] 3) Genotype determination: The PCR product was directly sequenced and the genotype was determined based on the difference in fluorescence signals, that is, whether there was a Chr18:g.52895455T>C mutation in the 19th exon region of the TCF4 gene.

[0028] The present invention further provides use of the isolated nucleic acid, the primer set, and the kit in preparing reagents or drugs for diagnosing or treating PTHS.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] Based on the technical solution of the present invention, genomic DNA derived from humans can be measured, and the sample source is unlimited, such as: body fluids (blood, ascites and urine, etc.), tissue cells (such as liver tissue), etc. Genomic DNA can be prepared by extracting and purifying these samples. The concentration of genomic DNA is adjusted to make it as consistent as possible. Using genomic DNA as a template, nucleic acid fragments containing TCF4 gene mutation sites can be amplified to obtain a large number of samples for measurement. This sample obtained by amplifying DNA fragments containing TCF4 gene mutation sites is particularly suitable for use as a measurement material.

[0031] When performing gene-assisted diagnosis, the present invention is preferably applied to the auxiliary diagnostic reagents for determining the presence of mutation types of the TCF4 gene, and the auxiliary diagnostic reagents include specific reagents as essential components, which correspond to the method for determining the mutation type of the TCF4 gene. Appropriate specific reagents are selected according to the determination method adopted, such as DNA fragments and / or primers for the PCR amplification step.

[0032] The present invention has discovered the gene mutation mechanism of Pitt-Hopkins syndrome (PTHS). The mutation is specifically located in the 3' non-coding region of the TCF4 gene and affects the splicing process of mRNA, thereby causing symptoms such as global developmental delay in patients.

[0033] Specifically, the present application discovered mutations in the 3'UTR region of the TCF4 gene, including but not limited to c.*1A>G. This mutation is a de novo mutation and has not been found in the human population databases ExAC and gnomAD. It was confirmed that the c.*1A>G mutation caused abnormal mRNA splicing, forming a new transcript, which lacked part of the sequence and the stop codon was changed, resulting in the insertion of 35 amino acids at the C-terminus of the TCF4 protein.

[0034] The transcription factor encoded by the TCF4 gene plays a key role in the differentiation of neurons in the embryonic stage. Its mutation is not only related to PTHS, but may also be related to the occurrence of diseases such as schizophrenia.

[0035] The currently known TCF4 gene mutations are mostly concentrated in the coding region, while there are relatively few reports of mutations in the non-coding region. The present invention, through an in-depth analysis of the patient's gene mutation, clarifies for the first time the correlation between TCF4 gene variation and PTHS, and provides a method for predicting PTHS, which can be used for the prevention, auxiliary diagnosis and treatment of PTHS, provides an important basis for the accurate typing of PTHS patients, and can also be used for new drug research and development. The application of the technical solution of the present invention is expected to improve the recognition accuracy of PTHS, reduce the pressure on the patient's family, and improve the patient's quality of life, showing broad application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 :Schematic diagram of TCF4 gene structure and Chr18:g.52895455T>C site;

[0037] Figure 2 :Sequencing map of TCF4 gene mutation sites;

[0038] Figure 3 : TCF4 mRNA splicing results. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with the accompanying drawings and specific implementation methods so that the public can have a deeper understanding of the content of the invention. This is not a limitation of the present invention. Any equivalent substitutions in the art made according to the disclosed content of the present invention shall fall within the protection scope of the present invention.

[0040] The English abbreviations used to represent reagents in the following examples are as follows:

[0041] 10×PCR buffer: 10 mM Tris-HCl (pH=8.3), 500 mM potassium chloride (KCl), 10 mM magnesium chloride (MgCl2), 0.01% (W / V) gelatin

[0042] dNTP: deoxynucleoside triphosphate

[0043] EDTA: Disodium Ethylenediaminetetraacetate

[0044] TE: 10mM Tris-HCl (pH=7.5), 1mM EDTA (pH=8.0)

[0045] Example 1: Blood sample collection and genomic DNA extraction:

[0046] 1. Case selection:

[0047] Pitt-Hopkins syndrome (PTHS) is a neurodevelopmental disorder characterized by intellectual disability, specific facial features, and significant autonomic nervous system dysfunction, particularly disturbances in respiratory regulation and intestinal motility, caused by variants in the transcription factor TCF4.

[0048] Cases were selected according to the diagnostic criteria for PTHS. All subjects signed written informed consent. This study was approved by the Ethics Review Committee of Shanghai Children's Hospital and complied with the World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research on Human Subjects.

[0049] 2. Prepare human genomic DNA according to the following method.

[0050] 1. Take 400 μL EDTA anticoagulated human peripheral blood in a 1.5 ml EP tube, add 1000 μL red blood cell lysis buffer, then add 400 μL EDTA anticoagulated blood (invert and mix 3-5 times before adding anticoagulated blood), invert and mix, and let stand at room temperature for 10 minutes;

[0051] 2. Centrifuge at 13000 rpm for 30 seconds and remove the supernatant;

[0052] 3. Add 480 μL of nuclear lysis solution to the obtained precipitate, tap the tube wall, mix thoroughly, add 20 μL of proteinase K (dilute proteinase K 20 times with nuclear lysis solution), invert to mix, and incubate at 65°C for 10 minutes (mix up and down from time to time during this period to ensure that there are no clots);

[0053] 4. Cool down to room temperature, add 300 μL protein precipitation solution, mix thoroughly by inversion, let stand for 10 minutes, and centrifuge at 13000 rpm for 2 minutes;

[0054] 5. Transfer the supernatant to a new EP tube, add 670 μL of pre-cooled isopropanol, mix thoroughly by inversion (more than 10 times), and the linear DNA gradually forms small clumps. Centrifuge at 13,000 rpm for 2 minutes;

[0055] 6. Discard the supernatant and ensure that the precipitate remains in the EP tube, add 670 μL 70% ethanol, mix by inversion, and centrifuge at 13000 rpm for 2 minutes;

[0056] 7. Discard the supernatant to allow the ethanol in the tube to evaporate completely;

[0057] 8. Add TE solution (400 μL) to fully dissolve, analyze the concentration and purity of the extracted genomic DNA, aspirate part of the DNA solution as the working solution, adjust the concentration to 20 ng / μL, place it at 4°C for use, and store the remaining genomic DNA in a -20°C refrigerator.

[0058] Example 2 Identification of variant sites

[0059] In this example, PCR-sequencing analysis was used to detect the genotype of the TCF4 gene Chr18:g.52895455T>C site. Figure 2 This is the sequencing map of the TCF4 gene mutation site.

[0060] The specific method is as follows:

[0061] 1. Determination of PCR-sequencing primers

[0062] The DNA base sequence near Chr18:g.52895455T>C (shown in SEQ ID NO.1) was retrieved from Genebank, and the primer design was completed under Oligo7.0 software. The target fragment was located in the TCF4 locus, with a total length of 431 bp. The sense strand F1 (+93 bp-+112 bp) and the antisense strand R1 (+504p-+523 bp) were determined. The specific primer sequences are as follows:

[0063] F1: 5'-GTGGCAACTTGGACCTGAGA-3' (shown in SEQ ID NO. 2)

[0064] R1: 5'-GTGGCAACTTGGACCTGAGA-3' (shown in SEQ ID NO. 3)

[0065] 2. PCR-sequencing reaction system and conditions

[0066] The partial fragment of TCF4 gene was amplified by PCR, and the PCR reaction system was:

[0067] 10×PCR reaction buffer 3μL, 10mM / L dNTP 0.5μL, TaqDNA polymerase 0.5μL, 10pM / L upstream primer (F1) 0.5μL, 10pM / L downstream primer (R1) 0.5μL, genomic DNA 1μL, deionized water to 30μL. 20μL paraffin oil was added to each system during PCR to prevent liquid evaporation. PCR reaction conditions were 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 65℃ annealing for 30s, 72℃ extension for 25s, a total of 35 cycles, and 72℃ total extension for 2min.

[0068] 3. Sequencing to determine genotype

[0069] The PCR products were detected by 2% agarose gel electrophoresis and sent to Shanghai Saiheng Biotechnology Co., Ltd. for sequencing verification after the gel imaging system was qualified. Figure 2 .

[0070] Example 3 Correlation between TCF4 gene variation and PTHS

[0071] 1. Prepare human peripheral blood RNA according to the following method

[0072] 1. Take 5 ml of blood and add it to an EP tube. Centrifuge at 4°C for 2 min. Remove the supernatant and pipette 400 μL into the EP tube.

[0073] 2. Add 1 ml of Trizol to the above EP tube and shake for 15 seconds. Add 0.2 ml of chloroform, cover the EP tube, shake vigorously in your hand for 15 seconds, leave at room temperature for 2 minutes, and centrifuge at 12000g (4°C) for 15 minutes;

[0074] 3. Remove the upper aqueous phase and place it in a new EP tube. Add 0.5 ml of isopropanol to every 1 ml of Trizol. After standing at room temperature for 10 minutes, centrifuge at 12000g (4°C) for 10 minutes.

[0075] 4. Discard the supernatant, wash with 1 ml of 75% ethanol per 1 ml of Trizol, vortex to mix, centrifuge at 7500 g (4°C) for 5 minutes, and discard the supernatant;

[0076] 5. Allow the precipitated RNA to dry naturally at room temperature;

[0077] 6. Dissolve the RNA precipitate with DEPC-treated water and store it in a -80°C refrigerator.

[0078] 2. Synthesize the first strand of cDNA according to the following method (TaKaRA PrimeScriptTM 1st Strand cDNA Synthesis Kit is used as an example, and other kits with equivalent functions can be used for specific implementation)

[0079] 1. Prepare the reaction solution according to the table below:

[0080] Oligo dT Primer (50μM) 1μL dNTP Mixture (10mM each) 1μL Total RNA (obtained from the above steps) 5μg RNase-free water Add to a total volume of 10 μL

[0081] 2. Keep warm at 65℃ for 5 minutes and then cool quickly on ice.

[0082] 3. Prepare 20 μL of reaction solution according to the table below and mix slowly.

[0083]

[0084]

[0085] 4. Carry out reverse transcription reaction according to the following conditions and store the final product in a -80℃ refrigerator.

[0086] 30℃ 10 minutes 42℃ 30-60 minutes 95℃ 5 minutes

[0087] 3. Detection of the effect of variant sites on normal splicing of TCF4 mRNA

[0088] 1. Determination of PCR-sequencing primers

[0089] The RNA base sequence near Chr18:g.52895455T>C (shown in SEQ ID NO.4) was retrieved from NCBI, and the primer design was completed under Oligo7.0 software. The target fragment was located in the TCF4 mRNA sequence, with a total length of 552bp. The sense strand F2 (+192bp-+223bp) and the antisense strand R2 (+723bp-+748bp) were determined. The specific primer sequences are as follows:

[0090] F2: 5'-CTGCGGGTCCGTGACATCAACGAGGCT-3' (shown in SEQ ID NO.5)

[0091] R2: 5'-GCCTGTACATACTGCTTTGCACATTC-3' (shown in SEQ ID NO.6)

[0092] 2. PCR-sequencing reaction system and conditions

[0093] The partial fragment of TCF4 gene was amplified by PCR. The PCR reaction system was: 3 μL of 10×PCR reaction buffer, 0.5 μL of 10 mM / L dNTP, 0.5 μL of TaqDNA polymerase, 0.5 μL of 10 pM / L upstream primer (F2), 0.5 μL of 10 pM / L downstream primer (R2), 1 μL of genomic DNA, and deionized water to 30 μL. 20 μL of paraffin oil was added to each system during PCR to prevent liquid evaporation. The PCR reaction conditions were 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 25 s, a total of 35 cycles, and 72°C total extension for 2 min.

[0094] 3. Sequencing to determine the effect of mutations on TCF4 mRNA splicing

[0095] The PCR products were detected by 2% agarose gel electrophoresis and sent to Shanghai Saiheng Biotechnology Co., Ltd. for sequencing after the gel imaging system was qualified. Figure 3 .

[0096] According to the sequencing results, the mutation will cause TCF to produce new mRNA. The new mRNA lacks the "AAAAGGGT" sequence, and the stop codon "TAA" loses two nucleotides "AA". Therefore, the mRNA will continue to translate and cause the peptide SKLPHCFIKTRDHFLNSCIILNPHKHFSLTPIFVI to be inserted into the C-terminus of the TCF4 protein.

[0097] Example 4 Detection Kit

[0098] A kit for detecting PTHS-related mutations is prepared, comprising a primer pair that can amplify the TCF4 gene Chr18:g.52895455T>C site, and other corresponding reagents. The kit of the present invention is used for detection of 10 people and is stored at -20°C in the dark. Its components, contents and sources include:

[0099] 30 μL 10× PCR buffer (Takara),

[0100] 5 μL 10 mM dNTP mixture (Takara),

[0101] 5 μL Taq DNA polymerase (2U / μL) (Takara),

[0102] 2.5 μL F1 (shown in SEQ ID NO. 2) (10 pM / μL),

[0103] 2.5 μL R1 (shown in SEQ ID NO.3) (10 pM / μL),

[0104] 235 μL pure water.

[0105] After PCR-sequencing, the TCF4 gene Chr18:g.52895455T>C site variation can be easily detected.

[0106] The TCF4 gene variation detection method of the present invention can be used to analyze the C allele of the rare variation site on the TCF4 gene of human chromosome 18, that is, the G allele on its DNA complementary chain, and is applied to the auxiliary diagnosis of PTHS to facilitate the early intervention and treatment of PTHS.

[0107] The present invention describes the base variation of the TCF4 gene Chr18:g.52895455T>C site, which can be used as one of the biomarkers for screening molecular targets for drug design to help find active molecules that regulate TCF4 expression and promote the development of new PTHS drugs.

[0108] The nucleic acid sequence for detecting TCF4 gene variation and PTHS-related sites established by the present invention can be applied to a kit for auxiliary diagnosis of PTHS gene with high sensitivity and specificity.

[0109] As described above, it is concluded that the variation of the TCF4 gene Chr18:g.52895455T>C site is significantly correlated with PTHS. Therefore, the determination of this variation according to the present invention can be used for gene-assisted diagnosis of PTHS.

[0110] The present invention describes a new mutation site associated with PTHS in the TCF4 gene and provides a method for determining TCF4 gene variation. Moreover, according to the present invention, only a small amount of DNA sample is required to determine the variation of the TCF4 gene.

[0111] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0112] The sequence involved in the present invention is as follows:

[0113] Seq ID No.1

[0114] tattacaaaaatgggggttaaggagaagtgtttatgtgggtttaagataatacagctgttaaggaagtggtctcttgttttaatgaagcaatgtggcaacttggacctgagaaaggaaaaaagagagaaaaaattcattaatatatttgt aacagaaaaagtatgctttttttaaaaaaaattctttttccatgaaagaaaatatctgtcaatttgggtgaaattcacttttatggctgatacactgatgagagttttgaatgatcgatctcagaaatggctgaaaacaaacttgccctY ttacatctgtcccatgtgattcgatgcgtctcccattccagggtgtgggccggccaaggagagagggggaggctctgaggacaccttctcttcctcccttcttttcagacacgcagctttcggattcagattcctttctgtggaggatta aagcacagaacctttgtttaatgctgaggcttctggcagagggcagcaatgcactcttcttgcgtgtctgacctttttctcagtgtttatattacagaacaaaaggaacagttactaagtactgtggcaatccatttggtcagtcactag

[0115] Seq ID No.2

[0116] F1:5'-GTGGCAACTTGGACCTGAGA-3'

[0117] Seq ID No.3

[0118] R1:5'-GGTCAGACACGCAAGAAGAG-3'

[0119] Seq ID No.4

[0120] caaatccgatgacgagggtgatgagaacctgcaagacacgaaatcttcggaggacaagaaattagatgacgacaagaaggatatcaaatcaattactaggtcaagatctagcaataatgacgatgaggacctgacaccagagcagaaggcagagcgtgagaaggagcggaggatggccaacaatgcccgagagcgtctgcgggtccgtgacatcaacgaggctttcaaagagctcggccgcatggtgcagctccacctcaagagtgacaagccccagaccaagctcctgatcctccaccaggcggtggccgtcatcctcagtctggagcagcaagtccgagaaaggaatctgaatccgaaagctgcgtgtctgaaaagaagggaggaagagaaggtgtcctcagagcctccccctctctccttggccggcccacaccctggaatgggagacgcatcgaatcacatgggacagatgtaaaagggtccaagttgccacattgcttcattaaaacaagagaccacttccttaacagctgtattatcttaaacccacataaacacttctccttaacccccatttttgtaatataagacaagtctgagtagttatgaatcgcagacgcaagaggtttcagcattcccaattatcaaaaaacagaaaaacaaaaaaaagaaagaaaaaagtgcaacttgagggacgactttctttaacatatcattcagaatgtgcaaagcagtatgtacaggctgagacacagcccagagactgaacggcaatctttccacactgtggaacaatgcatttgtgcctaaacttcttttgg

[0121] Seq ID No.5

[0122] F2:5’-CTGCGGGTCCGTGACATCAACGAGGCT-3’

[0123] Seq ID No.6

[0124] R2:5’-GCCTGTACATACTGCTTTGCACATTC-3’。

Claims

1. A method for separating nucleic acid, characterized in that: It has the base sequence shown in SEQ ID NO.

1. The isolated nucleic acid sequence is a partial sequence of the TCF4 gene and contains a variation site of the TCF4 gene. The variation site of the TCF4 gene is Chr18:g.52895455. The variation site is the 300th position in the base sequence shown in SEQ ID NO.1, and its normal base is T and the variation base is C.

2. A primer set for detecting whether PTHS occurs or exists, characterized in that: The primer set is an allele-specific primer, and the primer is used to specifically amplify the product at the 300th position in the base sequence shown in SEQ ID NO.1, and then determine whether there is a mutation in the site Chr18:g.52895455 of the TCF4 gene; The primer set includes primer F1 and primer R1. The base sequence of primer F1 is shown in SEQ ID NO.2, and the base sequence of primer R1 is shown in SEQ ID NO.

3.

3. A specific primer set for extension in TCF4 mRNA, characterized in that, It comprises primer F2 and primer R2, the base sequence of primer F2 is shown as SEQ ID NO.5, and the base sequence of primer R2 is shown as SEQ ID NO.

6.

4. A kit for detecting whether PTHS occurs or exists, characterized in that: The kit is a kit for detecting whether Chr18:g.52895455 in the 3' non-coding region of the TCF4 gene is a pathogenic mutation, comprising PCR primers, the primer set comprising primer F1 and primer R1, the base sequence of primer F1 is shown in SEQ ID NO.2, the base sequence of primer R1 is shown in SEQ ID NO.3, and the primer set is used to specifically amplify the TCF4 gene mutation site Chr18:g.52895455.

5. A kit for detecting whether PTHS occurs or exists according to claim 4, characterized in that: The kit also includes reagents and buffer for PCR amplification detection.

6. A kit for detecting whether PTHS occurs or exists according to claim 4, characterized in that: The kit comprises the following components: 30 μL 10× PCR buffer, 5μL 10mM dNTP mixture, 5 μL Taq DNA polymerase 2U / μL, 2.5 μL primer F1, the base sequence is shown in SEQ ID NO.2, 2.5 μL primer R1, the base sequence is shown in SEQ ID NO.3, 235 μL pure water.

7. A kit for detecting whether PTHS occurs or exists according to claim 4, characterized in that: The samples targeted by the kit are body fluids or tissue cells, and the body fluids include blood, ascites and urine.

8. A kit for detecting whether PTHS occurs or exists according to claim 6, characterized in that: The test kit is a test kit for 10 people.

9. A kit for detecting whether PTHS occurs or exists according to claim 4, characterized in that: The kit contains instructions for use, and the instructions describe the method of use as follows: 1) PCR amplification: amplify a partial fragment of the TCF4 gene by PCR, prepare a mixed solution: 3 μL of 10× PCR reaction buffer, 0.5 μL of 10 mM / L dNTP, 0.5 μL of Taq DNA polymerase, 0.5 μL of 10 pM / L upstream primer F1, 0.5 μL of 10 pM / L downstream primer R1, 2 μL of genomic DNA, and add pure water to 30 μL; 2) PCR reaction conditions were 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 25 s, a total of 35 cycles, and 72°C total extension for 2 min. Before PCR, 20 μL of paraffin oil was added to each system to prevent liquid evaporation; 3) Genotype determination: The PCR product was directly sequenced and the genotype was determined based on the difference in fluorescence signals, that is, whether there was a Chr18:g.52895455T>C mutation in the 19th exon region of the TCF4 gene.

10. Use of the isolated nucleic acid according to claim 1, the primer set according to claim 2 or the kit according to claim 4 in the preparation of a reagent or drug for diagnosing or treating PTHS.

Images