UORF element at upstream of OsGIF1 or DEP1 gene of rice and application of uORF element

Abstract

The invention provides an upstream uORF element of a rice OsGIF1 or DEP1 gene and application of the uORF element. The nucleotide sequence of the uORF element for regulating and controlling the expression of the rice OsGIF1 or DEP1 gene is shown as any one of SEQ ID NO.1-4, OsGIF1-uORF1 and OsGIF1-uORF2 can be used as expression regulation and control elements of the OsGIF1 gene, and the nucleotide sequences are shown as SEQ ID NO.1 and SEQ ID NO.2; the DEP1-uORF1 and the DEP1-uORF2 can be used as expression regulation and control elements of the DEP1 gene, and nucleotide sequences of the DEP1-uORF1 and the DEP1-uORF2 are shown as SEQ ID NO.3 and SEQ ID NO.4. The uORF regulatory element can be respectively used for regulating the protein expression level of the rice OsGIF1 or DEP1 gene, the growth and development of plants are improved, and the uORF regulatory element has important breeding value when being applied to genetic improvement of rice varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a uORF element upstream of a rice OsGIF1 or DEP1 gene and a use thereof. Background Art

[0002] Rice is the staple food for more than half of the world's population. However, as arable land decreases, increasing crop yields to feed a growing population becomes more challenging. Rice plant architecture includes the morphology of tillers, stems, panicles, and leaves, which are important agronomic traits closely related to rice yield.

[0003] DEP1 encodes an atypical Gγ subunit and is a major QTL for panicle architecture, grain shape, and nitrogen use efficiency. Transgenic rice overexpressing DEP1 showed an increase in grain length of 6.85–9.58% under normal plant conditions. Leaf curling and leaf size are considered key agronomic traits in plant morphological architecture that can compensate for yield parameters. The GRF interacting factor (GIF) gene controls cell proliferation during leaf development and is a positive regulator of leaf proliferation, thereby improving panicle and grain traits.

[0004] At present, crop breeding research focuses on changes in coding region sequences and gene transcription levels. However, the untranslated region (UTR) of the plant genome has factors that affect the gene translation efficiency or stability of mRNA. The upstream open reading frame (uORF) is the main regulatory element of the 5′ untranslated region (5′UTR), which regulates gene expression at the post-transcriptional or translational level, possibly interfering with the translation of the downstream primary ORF (pORF). Studies have shown that uORF-based gene expression regulation plays an important role in plant metabolism, disease resistance, development and nutrient absorption. However, there are few studies on finely upregulating endogenous gene expression in rice at the translation level based on uORF elements, thereby using gene editing to achieve non-transgenic improved plant traits.

[0005] Therefore, the discovery of uORF elements of important agronomic trait genes in rice is of great significance for analyzing the characteristics and molecular mechanisms of uORF in rice and its application in breeding. Summary of the invention

[0006] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a uORF element for regulating the expression of rice OsGIF1 or DEP1 gene, which solves the problem of improving rice traits by up-regulating gene expression without any trace of transgenic genes.

[0007] The present invention also provides the use of uORF elements upstream of rice OsGIF1 or DEP1 gene.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the nucleotide sequence of the uORF element for regulating the expression of rice OsGIF1 or DEP1 gene according to the present invention is shown in any one of SEQ ID NO.1-4.

[0009] Furthermore, the nucleotide sequence of the uORF element regulating the expression of the rice OsGIF1 gene is shown in SEQ ID NOs. 1 and 2, and the nucleotide sequence of the uORF element regulating the expression of the rice DEP1 gene is shown in SEQ ID NOs. 3 and 4.

[0010]

[0011] The invention discloses a recombinant expression vector of a uORF element for regulating the expression of rice OsGIF1 or DEP1 gene.

[0012] Furthermore, the method for constructing the recombinant expression vector is as follows: a target site for editing is designed near the uORF element, the target site is designed to be connected to the reverse complementary primer and the intermediate vector SK-gRNA, the enzyme cleavage product after connection is connected to the final vector pC1300-Cas9, and the recombinant expression vector is obtained by Agrobacterium transformation.

[0013] The invention discloses an application of the uORF element for regulating the expression of rice OsGIF1 or DEP1 gene in regulating agronomic traits of rice.

[0014] Furthermore, the protein expression level of the rice OsGIF1 or DEP1 gene is regulated by gene editing the uORF element, thereby improving plant growth and development.

[0015] Furthermore, the gene editing includes adding, substituting, inserting or deleting one or more nucleotides to generate mutants, alleles or derivatives.

[0016] Furthermore, by gene editing uORF elements, base mutations were caused to increase the expression of rice OsGIF1 or DEP1 genes, promoting plant growth and development.

[0017] The method for regulating the growth and development of rice plants of the present invention edits the uORF element sequence to change the expression of OsGIF1 or DEP1 gene.

[0018] The invention discloses an application of a uORF element for regulating the expression of rice OsGIF1 or DEP1 gene in cultivating high-yield rice germplasm.

[0019] Furthermore, the application method is: editing the uORF element of the rice OsGIF1 or DEP1 gene so that the expression level of the OsGIF1 or DEP1 gene in the target rice variety is changed.

[0020] Furthermore, the gene editing includes but is not limited to: adding, replacing, inserting or deleting one or more nucleotides to generate mutants, alleles or derivatives, so as to change the expression level of OsGIF1 or DEP1 gene in the target rice variety, thereby obtaining rice plants with different developmental morphologies.

[0021] Gene editing technology represented by CRISPR / Cas9 is a popular genome site-specific editing technology. It has been proven to be efficient and convenient for site-specific editing of target sites in rice. More importantly, the target site and T-DNA insertion site of this technology are generally on different chromosomes. Therefore, in transgenic rice plants transformed by Agrobacterium-mediated transformation, traces of transgenic genes can be removed by progeny screening, thus providing the possibility for its application in production practice.

[0022] OsGIF1 positively regulates the morphology or size of rice grains, leaves and stems, and upregulating its expression has a beneficial effect on increasing yield. Different allele variants of the DEP1 gene have different effects. Upregulating its expression can increase grain length and has the potential to increase yield per plant. Conventional overexpression transgenic technology can achieve upregulation of gene expression, but due to the presence of transgenic traces, it is currently difficult to use in production practice. Therefore, using CRISPR / Cas9 gene editing technology to edit uORF elements and upregulate the expression of important agronomic trait genes such as OsGIF1 and DEP1 is an important method for rice variety improvement.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0024] The present invention first discovered that uORF elements can regulate the expression of OsGIF1 and DEP1 genes, improve important agronomic traits of rice, and increase the expression of rice OsGIF1 or DEP1 genes by gene editing uORF elements to increase base mutations, thereby promoting plant growth and development. The present invention broadens the application scope of OsGIF1 and DEP1 genes, provides useful gene resources for rice variety improvement, and reflects good breeding application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The wild-type sequence and mutant sequence of the uORF element upstream of the OsGIF1 gene in Example 1 of the present invention;

[0026] Figure 2 The effect of the uorf element mutation upstream of the OsGIF1 gene on the gene expression in Example 1 of the present invention;

[0027] Figure 3The effect of the uorf element mutation upstream of the OsGIF1 gene on the agronomic traits of rice in Example 1 of the present invention;

[0028] Figure 4 are the wild-type sequence and mutant sequence of the uORF element upstream of the DEP1 gene in Example 2 of the present invention;

[0029] Figure 5 is the effect of the mutation of the uorf element upstream of the DEP1 gene on the gene expression in Example 2 of the present invention;

[0030] Figure 6 This is the effect of the uorf element mutation upstream of the DEP1 gene in Example 2 of the present invention on the agronomic traits of rice. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0032] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0033] The young panicles and grains during the period of high expression of OsGIF1 gene and DEP1 gene were preserved and provided by Yangzhou University.

[0034] Example 1

[0035] Mining, identification and effect analysis of uORF elements upstream of OsGIF1 gene in rice

[0036] 1. uORF element mining and identification

[0037] Nipponbare is a japonica rice variety that has completed whole genome sequencing. It is an important variety in rice breeding research. It was introduced to China by the Chinese Academy of Agricultural Sciences in 1967 and is a fully publicly available variety. The Nipponbare rice that has been stored in our laboratory for a long time was used as the test material. The young panicles (5 cm and 10 cm in length) during the period of high expression of the OsGIF1 gene (He et al., 2017, OsGIF1 positively regulates the sizes of stems, leaves, and grains in rice, Frontier in Plant Science), the grains during the critical period of grain development (10 days, 15 days and 20 days after flowering) and the control leaves were taken as the test materials. Ribosome imprinting sequencing (Ribo-seq) and transcriptome sequencing (RNA-seq) were analyzed. Combined with bioinformatics methods, the main uORF elements of the OsGIF1 gene (LOC Os03g52320) were mined. The results showed that there were two uORF elements in the upstream untranslated region of the OsGIF1 gene. The nucleotide sequences of the uORF elements are shown in SEQ ID NO.1 and 2, respectively ( Figure 1 , OsGIF1-uORF1, OsGIF1-uORF2).

[0038] 2. Creation and identification of rice materials containing mutant uorf elements

[0039] According to the existing CRISPR / Cas9 related experimental methods, two sequences containing NGG as PAM sites were selected as knockout target sites on the uORF element of the OsGIF1 gene, one of which was 5'-GGTCCTCAGTTTGAGATGAT-3', and the other was 5'-TATATTCATGCATATGTCAT-3'. The target sites were designed as reverse complementary primers and then connected to the intermediate vector SK-gRNA digested by Aar I; the intermediate vector connected to the target site was digested with Kpn I and Bgl II, and the gRNA fragment containing the target site was recovered and connected to the final vector pC1300-Cas9 digested by Kpn I and BamHI to obtain a recombinant vector, and the recombinant vector after sequencing was transformed into an Agrobacterium strain. Using Nipponbare as the transformation receptor, the recombinant vector was transferred into rice by Agrobacterium-mediated genetic transformation, and positive transgenic seedlings were obtained through tissue culture. Finally, after detection and identification, they were transplanted to the field to obtain T0 generation rice plants, that is, plants containing mutant uorf elements (including plants containing mutant uorf1 or uorf2 elements, respectively).

[0040] The wild-type Nipponbare, a control variety containing uORF elements, and the plants containing mutant uorf elements prepared by the present invention only have sequence differences near the uORF elements. After quickly extracting genomic DNA from rice leaves in the tillering stage using the CTAB method, a pair of PCR sequencing primers were designed upstream and downstream of the uORF element editing target site sequence (detection primers: OsGIF1-uORF-F: TTCCACCTTCCCATTGTT; OsGIF1-uORF-R: GGTCTGCTTGGCCTA TTC) to detect sequence variations near the target site. After PCR amplification and sequencing analysis based on the sequence of the target site, the sequence of the mutant uorf element was obtained. Compared with the wild-type uORF element, the mutant uorf element has multiple base deletions, indicating that the characteristics of the uORF element have been completely destroyed ( Figure 1 GIF1-uORF1 and / or 2).

[0041] 3. Effect of uorf mutation upstream of OsGIF1 gene on gene expression in rice

[0042] The wild type Nipponbare (ear length of about 5 cm) of the control variety containing uORF elements and the young ears (length of about 5 cm) of the plant containing the mutant uorf element prepared by the present invention were taken, the samples were placed in liquid nitrogen for grinding, the cells were broken and total RNA was extracted, cDNA was obtained using a reverse transcription kit, and then the mRNA expression amount of the OsGIF1 gene in the control variety Nipponbare and the plant containing the mutant uorf element was detected according to the SYBR Green fluorescence quantitative PCR method (detection primers: qRT-OsGIF1-F: TATGCTTCCCCTACCACCGTC, qRT-OsGIF1-R: TCTTCCACCTTCCCATTGTTCTG). In addition, the dual luciferase in vitro transient expression system was used to detect the effect of uORF on regulating the expression of downstream target gene proteins in tobacco leaves. The unmutated uORF elements (wild type, including uORF1 and uORF2, SEQ ID NO.1 and 2), sequences containing mutant uorf1 elements (artificially synthesized to mutate the start codon ATG of the wild-type uORF 1 to AAA), and sequences containing mutant uorf2 elements (artificially synthesized to mutate the start codon ATG of the wild-type uORF 2 to AAA) were respectively connected to the expression vector pGreenII0800-LUC containing the dual luciferase reporter gene. The connected uORF or uorf element was located upstream of the firefly luciferase reporter gene (reference method: Xing et al., 2020, Fine-tuning sugar content in strawberry. Genome Biology) to obtain recombinant vectors, and the recombinant vectors after sequencing were transformed into Agrobacterium strains. Then, the Agrobacterium containing the recombinant vector was infected with Nicotiana benthamiana leaves and cultured for 48 hours. The luciferase activity of the tobacco leaves at the infected site was detected (reference method: Xiong et al., 2022, Brassinosteroids regulate rice seed germination through the BZR1-RAmy3D transcriptional module. Plant Physiology). The results showed that Figure 2 As shown, there was no difference in the mRNA expression level of the OsGIF1 gene in the plants containing the mutant uorf element, but the fluorescence signal of the downstream reporter gene in the plants containing the mutant uorf element was enhanced (LUC / REN activity), that is, the protein expression level was increased, which is consistent with the characteristic that the typical uORF element can regulate the protein expression of its downstream target gene without affecting the mRNA expression.

[0043] 4. Determination of agronomic traits of rice containing mutant uorf elements

[0044] In order to clarify the biological function of uORF elements, the field agronomic traits of plants containing mutated uorf elements were investigated. Plants were planted in the field under conventional cultivation and management conditions. When the rice matured, the rice yield was significantly higher than that of the control variety Nipponbare. Figure 3 As shown, the grain length, grain width and grain weight of plants containing mutant uorf1 or uorf2 elements changed. At the same time, the growth and development of plants containing mutant uorf1 and uorf2 elements changed, as shown in seedling growth potential, plant height, panicle length, effective tiller number, apparent amylose content, etc. The overall change trend is similar to the effect of sequence variation in the coding region of the OsGIF1 gene on grain shape reported (He et al., 2017, OsGIF1 positively regulates the sizes of stems, leaves, and grains in rice, Frontier in Plant Science). Therefore, the uORF in the present invention, as a regulatory element, can slightly upregulate the expression of endogenous genes at the translation level, and is used to finely improve rice traits. It shows that the uORF element excavated by the present invention does affect plant growth, especially promote plant growth, by regulating the expression of the OsGIF1 gene.

[0045] Example 2

[0046] Mining, identification and effect analysis of uORF elements of DEP1 gene in rice

[0047] 1. uORF element mining and identification

[0048] The Nipponbare rice that has been stored in our laboratory for a long time was used as the test material. The young panicles (spike length 5 cm and 10 cm) during the period of high expression of the DEP1 gene (Huang et al., 2009, Natural variation at the DEP1 locus enhances grain yield in rice, Nature Genetics), the grains during the critical period of grain development (10 days, 15 days and 20 days after flowering) and the control leaves were taken as test materials. Ribosome imprinting sequencing (Ribo-seq) and transcriptome sequencing (RNA-seq) were analyzed. Combined with bioinformatics methods, the main uORF elements of the DEP1 gene (LOC_Os09g26999) were mined. It was found that there were also two uORF elements in the upstream untranslated region of the DEP1 gene. The nucleotide sequences of the uORF elements are shown in SEQ ID NO.3 and 4 ( Figure 4 , DEP1-uORF1, DEP1-uORF2)

[0049] 2. Creation and identification of rice materials containing mutant uorf elements

[0050] According to the existing CRISPR / Cas9 related experimental methods, two sequences containing NGG as PAM sites were selected as knockout target sites on the uORF of the DEP1 gene. The first specific target site sequence was 5'-TCACGCTCGCTGCTATATGG-3', and the other specific target site sequence was 5'-CCCTCGCCGCCTTCACTCAT-3'. The target site was designed as a reverse complementary primer and then connected to the intermediate vector SK-gRNA digested by Aar I; the intermediate vector was digested with Kpn I and Bgl II, and the gRNA fragment containing the target site was recovered and connected to the final vector pC1300-Cas9 digested by Kpn I and BamHI to obtain a recombinant vector, which was transformed into an Agrobacterium strain after sequencing. With Nipponbare as the transformation receptor, the recombinant vector was transferred into rice using the Agrobacterium-mediated genetic transformation method, and positive transgenic seedlings were obtained by tissue culture. Finally, after detection and identification, it was transplanted to the field to obtain T0 generation rice plants, that is, plants containing mutant uorf elements.

[0051] The control variety Nipponbare containing the wild-type uORF element and the plants containing the mutant uorf element only had sequence differences near the uORF element. After quickly extracting genomic DNA from rice leaves at the tillering stage using the CTAB method, a pair of PCR sequencing primers were designed upstream and downstream of the uORF element editing target site sequence (detection primers: DEP1-uORF-F: GAACAAAGCCCACAGACACAA, DEP1-uORF-R: ACTTGCTTCGTCTTCCTTTGAC) to detect sequence variations near the target site. After PCR amplification and sequencing analysis based on the target site sequence, the sequence of the mutant uorf element was obtained. Compared with the wild-type uORF, the mutant uorf has multiple base deletions, and the characteristics of the uORF element have been completely destroyed ( Figure 4 DEP1-uORF1 and / or 2).

[0052] 3. Effect of uorf mutation upstream of DEP1 gene on gene expression in rice

[0053] The young panicles (about 5 cm in length) of the control variety Nipponbare containing the wild-type uORF element and the plants containing the mutant uorf element were taken, and the samples were ground in liquid nitrogen, the cells were broken and the total RNA was extracted, and the cDNA was obtained using a reverse transcription kit. Then, the mRNA expression level of the DEP1 gene in the control variety Nipponbare and the plants containing the mutant uorf element was detected according to the SYBR Green fluorescence quantitative PCR method (detection primers: qRT-DEP1-F: CTCAGCCGTTTCTCGTTCT, qRT-DEP1-R: AGCACGAGCAGTCAGTCGGTTTG). Similarly, the above young panicle samples were ground in liquid nitrogen, the cells were broken and the total protein was extracted, and then the protein expression level of the OsGIF1 gene in the control variety Nipponbare and the plants containing the mutant uorf element was detected according to the Western blotting method. The results showed that, Figure 5 As shown, there was no difference in the mRNA expression of the DEP1 gene in plants containing mutant uorf elements, but the protein expression level of the DEP1 gene in plants containing mutant uorf2 elements was increased, which is consistent with the characteristic that typical uORF elements can regulate the protein expression of their downstream target genes without affecting mRNA expression.

[0054] 4. Determination of agronomic traits of rice containing mutant uorf elements

[0055] In order to clarify the biological function of uORF elements, the field agronomic traits of plants containing mutated uorf elements were investigated. Plants were planted in the field under conventional cultivation and management conditions. When the rice matured, the rice yield was significantly higher than that of the control variety Nipponbare. Figure 6As shown, the grain width, panicle length, effective tiller number, grains per panicle, seed setting rate, etc. of plants containing mutant uorf1 or uorf2 elements did not change. Only the grain length and grain weight of plants containing mutant uorf1 elements increased significantly. The trend of mutant uorf1 or uorf2 elements affecting plant trait changes is consistent with the trend of regulating DEP1 gene expression. The changes in plant traits caused by mutant DEP1-uorf1 are similar to the effects of sequence variation in the coding region of the DEP1 gene on grain shape (Huang et al., 2009, Natural variation at the DEP1 locus enhances grain yield in rice, Nature Genetics). Therefore, the uORF in the present invention, as a regulatory element, can slightly upregulate the expression of endogenous genes at the translation level and is used to finely improve rice traits. It shows that the uORF element excavated by the present invention does affect grain shape by regulating DEP1 gene expression.

Claims

1. A uORF element for regulating the expression of rice OsGIF1 or DEP1 gene, characterized in that: The nucleotide sequence of the uORF element regulating the expression of rice OsGIF1 or DEP1 gene is shown in any one of SEQ ID NOs. 1-4.

2. The uORF element for regulating the expression of rice OsGIF1 or DEP1 gene according to claim 1, characterized in that: The nucleotide sequence of the uORF element for regulating the expression of the rice OsGIF1 gene is shown in SEQ ID NOs. 1 and 2, and the nucleotide sequence of the uORF element for regulating the expression of the rice DEP1 gene is shown in SEQ ID NOs. 3 and 4.

3. A recombinant expression vector based on the uORF element for regulating the expression of rice OsGIF1 or DEP1 gene according to claim 1.

4. The recombinant expression vector according to claim 3, characterized in that: The method for constructing the recombinant expression vector is as follows: designing a target site, then designing the target site into a reverse complementary primer connected to the intermediate vector SK-gRNA, connecting the enzyme digestion product after connection to the final vector pC1300-Cas9, and obtaining the recombinant expression vector through Agrobacterium transformation.

5. Use of the uORF element for regulating the expression of rice OsGIF1 or DEP1 gene according to any one of claims 1 to 2 in regulating agronomic traits of rice.

6. The use according to claim 5, characterized in that: The uORF element is edited by genes to regulate the protein expression level of rice OsGIF1 or DEP1 gene, thereby improving plant growth and development.

7. The use according to claim 6, characterized in that: The gene editing includes mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides.

8. The use according to claim 6, characterized in that: By gene editing uORF elements, base mutations were caused, thereby upregulating the expression of rice OsGIF1 or DEP1 genes, promoting plant growth and development.

9. A method for regulating the growth and development of rice plants, characterized in that: The uORF element sequence of claim 1 is edited to change the expression of the OsGIF1 or DEP1 gene.

10. Application of a uORF element for regulating the expression of rice OsGIF1 or DEP1 gene in cultivating high-yield rice germplasm.

Images