Lentivirus or cell for displaying HLA (human leukocyte antigen) polypeptide with native conformation as well as preparation method and application of lentivirus or cell

Abstract

The invention discloses a lentivirus or cell for displaying HLA polypeptide of native conformation, and a preparation method and application thereof, and relates to the field of cell biology. According to the method, a specific HLA presentation system is constructed, so that the new antigen can be accurately recognized and presented, and the recognition efficiency of the new antigen is improved. In addition, the invention further provides a preparation method of the lentivirus or cell with the marker and used for displaying the HLA polypeptide of the native conformation, after plasmid with the marker gene transfects the cell, the cell with a tracing function or a screening function can be obtained, rapid marking and activation of a targeted T cell are facilitated, and the marking efficiency of the T cell is improved. The T cells with neoantigen specificity can more effectively recognize and kill cancer cells, and the immunotherapy effect can be improved.

Description

Technical Field

[0001] The present invention relates to the field of cell biology, and more specifically, the technology relates to methods and compositions for discovering and identifying ligand and receptor specificity and gene and protein delivery. Specifically, it relates to a lentivirus or cell for displaying HLA polypeptides in natural conformation, and a preparation method and application thereof. Background Art

[0002] T cells are a type of immune cell that plays a key role in immune responses. T cells have a specific receptor on their surface, called the T cell receptor (TCR), which is used to recognize antigens.

[0003] MHC is called major histocompatibility complex (MHC) in mice and human leukocyte antigen (HLA) in humans. MHC / HLA is a protein complex on the cell surface that is used to present antigenic peptides (short protein fragments). Cancer cells produce abnormal proteins during their metabolism, which are broken down into peptide fragments. After these peptide fragments are processed by proteases inside the cell, they are loaded onto MHC / HLA molecules through intracellular processing mechanisms and transported to the cell surface. When T cells patrol the body, TCR scans MHC / HLA molecules on the cell surface. If the TCR recognizes and binds tightly to a specific antigenic peptide presented by MHC / HLA, this usually means that the cell shows abnormal or non-self markers, such as cancer cell markers. This binding triggers T cell activation. Activated T cells can release cytokines, multiply, and differentiate into effector T cells (such as cytotoxic T cells). These effector T cells have the ability to directly attack and kill cells presenting cancer antigens. Therefore, T cell-related immune responses can trigger antigen-directed cytotoxicity and play a key role in the anti-cancer process.

[0004] Based on this principle, scientists have developed some immunotherapies. For example: CAR-T cell therapy: The patient's T cells are extracted from the body and modified in the laboratory to express a specific chimeric antigen receptor (CAR), which can recognize specific antigens on the surface of cancer cells. The modified T cells are amplified and then infused back into the patient to enhance their ability to recognize and kill cancer cells.

[0005] TCR-T cell therapy: Similar to CAR-T, but T cells are modified to express specific TCRs that can recognize specific antigens associated with cancer - MHC / HLA complexes. After these modified T cells are infused back into the patient's body, they can effectively recognize and attack cancer cells, reduce tumor burden and prolong patient survival.

[0006] Cells conduct signals through ligand-receptor interactions. Rich intercellular communication shapes the molecular programs of mammalian cells to guide specific behaviors and cell fate decisions. For example, TCRs on the surface of T cells can recognize and interact with major histocompatibility complex (MHC)-antigen complexes on the surface of antigen-presenting cells. TCR and antibody genes undergo somatic recombination to reach a large and diverse repertoire (about 10 in humans). 16 TCR alpha and beta sequences), antigen-specific T cell and B cell expansion and differentiation are highly dependent on the specificity of TCR and BCR. Analyzing TCR-antigen interactions, especially mapping specific antigens to specific TCR sequences and T cell states, is crucial to understanding how antigen recognition drives T cell fate decisions.

[0007] Various approaches have been developed to decipher the antigen specificity of TCRs, including: (1) cell reporter assays that use artificial APCs to screen for T cell-specific MHC-antigens, such as T-scan, SABR, T cell phagocytosis, and cytokine capture assays (Joglekar et al., 2019; Kula et al., 2019; Lee and Meyerson, 2021; Li et al., 2019); (2) yeast display platforms for screening MHC-antigens for recombinant TCRs (Birnbaum et al., 2012); (3) T cell-based assays, such as cytokine production after antigen peptide stimulation (ELISpot) (McCutcheon et al., 1997); and (4) single-cell sequencing to capture antigen specificity and TCR sequence using DNA-barcoded MHC-peptide multimers (TetTCR-seq; Zhang et al., 2018). Although each technology has its own unique advantages, it remains challenging to rapidly screen naive T cells for immunogenicity against MHC-antigens and simultaneously capture the antigen-corresponding TCR repertoire and T cell gene expression signatures. Many existing methods require re-expression of receptors or ligands on heterogeneous cells and therefore cannot be directly applied to human clinical samples. Similar challenges apply to studying B cell receptor-antigen interactions, which face the additional challenge of resolving known intracellular antigen epitopes recognized by antibodies.

[0008] Despite tremendous progress in characterizing the cellular states of antigen-specific T and B cells, it remains challenging to selectively reconstruct their cellular states and behaviors without interfering with other bystander T or B cells. A recent approach using nanoparticles presenting pMHC has achieved mRNA delivery in antigen-specific T cells, providing many possibilities for transient regulation of specific T cells (Su et al., 2022). Another recent study used pseudotyped viruses presenting pMHC to allow genetic modification of antigen-specific T cells (Guo and Elledge, 2022). However, there is still a lack of a technology that can selectively manipulate specific B cells rather than just specific T cells.

[0009] Currently, potential new antigenic peptides can be predicted by NGS and MHC-peptide binding prediction algorithms, but the efficiency of these methods is still controversial and has the problem of low efficiency. Mass spectrometry can be used to identify new antigens presented by tumor cells, but its clinical application is limited due to high background and limited tumor tissue quantity.

[0010] In addition, the existing technology requires that all HLA encoding genes and antigenic peptides be connected through a linker to construct a lentiviral vector, and after transfection, HLA molecule-peptide complexes expressed on the cell surface are obtained; since the HLA-peptide complex is expressed by fusion connection, it cannot effectively reflect the presentation of the natural conformation HLA-peptide complex in vivo. In addition, the strategy of HLA fusion expression ligands further limits the gene loading length of the lentivirus. These deficiencies further limit the application in accurately and efficiently marking or identifying specific T cells.

[0011] In view of this, the present invention is proposed. Summary of the invention

[0012] The object of the present invention is to provide a lentivirus or cell for displaying HLA polypeptides in natural conformation, and a preparation method and application thereof to solve the above technical problems.

[0013] The present invention is achieved in that:

[0014] In a first aspect, the present invention provides a method for preparing a lentivirus or cell for displaying a native conformation of an HLA polypeptide, comprising the following steps:

[0015] S1: Construction of a single HLA gene cell line:

[0016] Using cells with complete HLA knockout and no TAP1 expression as chassis cells, lentivirus carrying a single HLA encoding gene was used to infect the chassis cells to obtain a cell line containing a single HLA gene but without expressing HLA molecules on the cell surface;

[0017] S2: Construct a lentiviral vector including a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, then infect a cell line with a single HLA gene with the lentivirus including the ligand encoding gene and the signal peptide sequence targeting the endoplasmic reticulum, culture, and obtain cells with HLA-positive cell surface through cell sorting. Cells with HLA-positive cell surface display HLA-specific polypeptide complexes in natural conformation.

[0018] In a second aspect, the present invention also provides a method for preparing a lentivirus or cell with a marker for displaying a natural conformation of an HLA polypeptide. The lentivirus or cell for displaying a natural conformation of an HLA polypeptide is prepared by the above method and co-transfected with a plasmid with a marker gene, a packaging plasmid, and a helper plasmid.

[0019] In a third aspect, the present invention also provides a lentivirus or cell prepared by the above method for displaying HLA polypeptides in natural conformation, or a lentivirus or cell prepared by the above method for displaying HLA polypeptides in natural conformation and carrying a label.

[0020] In a fourth aspect, the present invention also provides the use of lentivirus or cells in T cell labeling, T cell activation, recognition or identification of B cell receptor antigens, identification of B cell receptors or antibodies, recognition or identification of T cell receptors and paired pMHC, identification of immunogenic epitopes, identification of nucleic acids or proteins in target cells, identification of ligand receptor pairs, or preparation of anti-tumor products.

[0021] The present invention has the following beneficial effects:

[0022] The present invention provides a method for preparing a lentivirus or cell that can display a natural conformation of an HLA polypeptide. The method utilizes lentivirus technology, uses cells that do not express HLA and TAP1 as chassis cells, and first obtains a cell line containing a single HLA gene but not expressing HLA molecules on the cell surface, thereby avoiding the addition of cells that express HLA genes on the cell surface, and failing to accurately label T cells. In the absence of an antigenic polypeptide, the transferred HLA encoding gene is transcribed and translated to form an HLA molecule, which is localized on the endoplasmic reticulum through endoplasmic reticulum chaperone proteins such as calreticulin, ERp57 (also known as PDIA3), protein disulfide isomerase (PDI), and Tapasin molecules, and cannot leave the endoplasmic reticulum and be displayed on the cell surface. After further transfecting cells with a lentivirus containing a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, the peptide produced by translation interacts with the transporter through Tapasin, thereby coupling the polypeptide transport into the endoplasmic reticulum to meet the HLA molecules. The peptide is deeply inserted into the HLA class peptide binding groove. When the peptide binds to the HLA molecule, the chaperone protein is completely released and the assembled peptide-HLA class complex leaves the endoplasmic reticulum and is displayed on the cell surface.

[0023] This method can accurately identify and present new antigens by constructing a specific HLA presentation system, thereby improving the recognition efficiency of new antigens.

[0024] In addition, the present invention also provides a method for preparing a lentivirus or cell with a marker for displaying a natural conformation of an HLA polypeptide. After transfecting the cell with a virus carrying a marker gene, cells with a tracing function or a screening function can be obtained, which helps to quickly mark and activate targeted T cells and improve the marking efficiency of T cells.

[0025] Neoantigen-specific T cells can more effectively identify and kill cancer cells, helping to improve the effectiveness of immunotherapy.

[0026] The present invention can systematically analyze interaction pairs including TCR-pMHC, antibody-antigen, co-stimulatory ligand-receptor and B cell antigen-BCR through engineered ligand-receptor interaction-mediated lentiviral cell entry. In certain embodiments, the method can allow gene delivery in the form of specific receptors, thereby achieving selective manipulation of antigen-specific T cells and B cells. This method can accurately measure antigen specificity, TCR library, gene expression and surface protein characteristics in single human primary T cells by combining it with droplet-based single-cell sequencing analysis. The method provided by the present invention is not only highly sensitive and specific for screening and identifying TCR sequences of specific MHC-peptides, but also easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0028] Figure 1 A flowchart of a method for preparing a lentivirus or cell with a labeled HLA polypeptide displaying a native conformation;

[0029] Figure 2 The results of flow cytometric analysis of HLA class I levels on the surface of wild-type HEK293T cells, HLA-A, B, C gene knockout cells, and KO cells transfected with HLA-A0201;

[0030] Figure 3 The results of protein expression detection of TAP1, TAP2, ERAP1, ERAP2 and HM13 in cells with TAP1 / TAP2 / ERAP1 / ERAP2 / HM13 gene knocked out based on HLA KO cell line;

[0031] Figure 4 Figure 2 is the result of flow cytometric analysis of HLA class I levels in multiple knockout cells transfected with HLA-A0201;

[0032] Figure 5 Flow cytometric analysis showing that T cells containing specific TCRs can be labeled by lentivirus generated from monoallelic HLA HEK293T cells;

[0033] Figure 6 NY-ESO-1-TCR T target cells were labeled with CellTrace violet dye and mixed with unlabeled non-target KRAS-G12V-TCR T cells at the indicated ratios. 157-165 -GFP virus (WO2023107886A1) and HLA-A2:NY-ESO-1 containing native conformation 157-165 -GFP virus incubation, flow cytometry analysis results (A, B) and sensitivity (C) and specificity (D) analysis results. DETAILED DESCRIPTION

[0034] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0035] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0036] In a first aspect, the present invention provides a method for preparing a lentivirus or cell for displaying a native conformation of an HLA polypeptide, comprising the following steps:

[0037] S1: Construction of a single HLA gene cell line:

[0038] Using cells with complete HLA knockout and no TAP1 expression as chassis cells, infecting chassis cells with a lentivirus carrying a single HLA encoding gene to obtain a cell line containing a single HLA gene but not expressing HLA molecules on the cell surface; S2: constructing a lentiviral vector including a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, and then infecting a cell line with a single HLA gene with a lentivirus including a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, culturing, and obtaining cells with HLA positive on the cell surface through cell sorting. The cell surface with HLA positive displays a natural conformation of HLA specific polypeptide complexes, and the cell line can be used for subsequent fluorescent lentiviral packaging.

[0039] The inventor accidentally discovered that simply not expressing TAP1 in cells can prevent HLA molecules from being displayed on the cell surface. Based on this, TAP1 knockout chassis cells were constructed based on HLA knockout for subsequent lentiviral transfection.

[0040] The method provided by the present invention utilizes lentiviral technology, and uses cells that do not express HLA genes and TAP1 as chassis cells to first obtain a cell line containing a single HLA gene but not expressing HLA molecules on the cell surface (anchored on the endoplasmic reticulum). In the absence of antigenic polypeptides, the transferred HLA encoding gene is transcribed and translated to form HLA molecules, which are positioned on the endoplasmic reticulum through endoplasmic reticulum chaperone proteins such as calreticulin, ERp57 (also known as PDIA3), protein disulfide isomerase (PDI) and Tapasin molecules, and cannot leave the endoplasmic reticulum and be displayed on the cell surface. After further transfecting cells with lentivirus containing ligand encoding genes and signal peptide sequences targeting the endoplasmic reticulum (ER), the peptides produced by translation interact with the transporter through Tapasin, thereby coupling the polypeptide transport into the endoplasmic reticulum and meeting the HLA molecules. The polypeptide is deeply inserted into the HLA peptide binding groove. When the peptide binds to the HLA molecule, the chaperone protein is completely released, and the assembled peptide-HLA complex leaves the endoplasmic reticulum and is displayed on the cell surface.

[0041] This method can accurately identify and present new antigens by constructing a specific HLA presentation system, thereby improving the recognition efficiency of new antigens.

[0042] In a preferred embodiment of the present invention, the ligand is an epitope or a protein.

[0043] In general, the term "epitope" refers to a region or site of an antigen or ligand that specifically binds to an antibody or receptor, such as a region or site that contains contact residues that interact with an antibody, such as a region or site that specifically binds to a receptor, such as a T cell determinant, a B cell determinant, etc.

[0044] Therefore, the term "epitope" refers to the part of a molecule that can be recognized and bound by an antibody on one or more antibody antigen binding regions, or the part of a molecule that is recognized and bound by a receptor on a receptor ligand binding region. Typically, epitopes are defined in the context of molecular interactions between an antibody or its antigen binding fragment and its corresponding antigen. Epitopes are typically composed of surface groupings of molecules such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics and specific charge characteristics. T cell determinants are small peptide molecules that are processed by antigen presenting cells.

[0045] In a preferred embodiment of the present invention, the ligand is an MHC peptide, an antibody, an antigen, a secretory protein, a cell surface protein or other antigenic forms expressed by cells.

[0046] The terms "polypeptide", "oligopeptide", "peptide" and "protein" are used interchangeably herein to refer to a chain of amino acids of any length. The chain may be straight or branched, may contain modified amino acids, and / or may be interspersed with non-amino acids. The term also encompasses amino acid chains that have been modified naturally or by insertion; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, non-natural amino acids, etc.), as well as other modifications known in the art. It should be understood that a polypeptide may exist as a single chain or in an associated chain.

[0047] "Antibodies" are immunoglobulin molecules that can specifically bind to target analytes such as carbohydrates, polynucleotides, lipids, polypeptides, etc. through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, unless otherwise specified, the term includes not only complete polyclonal or monoclonal antibodies, but also any antigen binding portion thereof that competes with the complete antibody for specific binding, fusion proteins comprising antigen binding portions, and any other modified configurations of immunoglobulin molecules comprising antigen recognition sites. Antigen binding portions include, for example, Fab, Fab', F(ab')2, Fd, Fv, domain antibodies (dAbs, such as shark and camelid antibodies), fragments comprising complementary determining regions (CDRs), single-chain variable fragment antibodies (scFv), maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs, and double-scFvs, as well as polypeptides containing at least a portion of an immunoglobulin sufficient to confer antigen-specific binding to the polypeptide. Antibodies include antibodies or antigen-binding fragments thereof of any kind, such as IgG, IgA or IgM (or its subclass), and antibodies need not be of any particular kind. Depending on the antibody amino acid sequence of the heavy chain constant region of the immunoglobulin, the immunoglobulin can be classified into different kinds. There are five main types of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these immunoglobulins can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. The heavy chain constant regions corresponding to different kinds of immunoglobulins are referred to as α, δ, ε, γ and μ, respectively. The subunit structure and three-dimensional configuration of different kinds of immunoglobulins are well known.

[0048] In a preferred embodiment of the present invention, the antigen is an intracellular antigen.

[0049] In a preferred embodiment of the present invention, the ligand is a tumor cell surface protein.

[0050] In a preferred embodiment of the present invention, the tumor cell surface protein is selected from cancer-testis antigen NY-ESO-1, KRAS, HRAS, NRAS, CD19, BCMA, CD20, CD22, CD38, CD123, HER2, CD52, EGFR, PDL1, ADGRE2, carbonic anhydrase IX (CAIX), CCR1, CCR4, carcinoembryonic antigen (CEA), CD3, CD5, CD7, CD8, CD10, CD30, CD33, CD34, CD41, CD44, CD44V6, CD49f, CD56, CD70, CD74, CD99, CD133, CD138, CDS, CLEC12A, antigens of cytomegalovirus (CMV) infected cells, epithelial glycoprotein 2 (EGP-2), epithelial glycoprotein 40 (EGP-40), epithelial cell adhesion molecule (EpCAM), EGFRvIII, receptor tyrosine-protein kinase erb-B2,3,4, EGFIR, EGFR-VIII, ERBB folate binding protein (FBP), fetal acetylcholine receptor (AChR), folate receptor alpha, ganglioside G2 (GD2), ganglioside G3 (GD3), human epidermal growth factor receptor 2 (HER2), human telomerase reverse transcriptase (hTERT), ICAM-1, integrin B7, interleukin-13 receptor subunit alpha-2 (IL-13Rα2), kappa-light chain, kinase insert domain receptor (KDR), Lewis A (CA19.9), Lewis Y (LeY), L1 cell adhesion molecule (L1-CAM), LILRB2, melanoma antigen family A1 (MA GE-A1), MICA / B, mucin 1 (Muc-1), mucin 16 (Muc-16), mesothelin (MSLN), NKCSI, NKG2D ligand, c-Met, carcinoembryonic antigen (h5T4), PRAME, prostate stem cell antigen (PSCA), PRAME prostate-specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), TIM-3, TRBCI, TRBC2, vascular endothelial growth factor R2 (VEGF-R2), or Wilms tumor protein (WT-1).

[0051] In a preferred embodiment of the present invention, in step S1, cells that do not express HLA and TAP1 and at least one of the following proteins are used as chassis cells:

[0052] TAP2, ERAP1, HM13 and ERAP2. For example, HLA, TAP1, TAP2 are not expressed, or TAP1, HLA, TAP2, ERAP1 and ERAP2 are not expressed.

[0053] In a preferred embodiment of the present invention, LEAPER technology, CRISPR / Cas gene editing technology, artificial nuclease-mediated zinc finger nuclease technology (zinc-finger nucleases, ZFN), transcription activator-like effector nuclease technology (transceription activator-like effector nucleases, TALEN) and / or CBE technology are used to prevent the expression of HLA and TAP1 proteins in cells.

[0054] LEAPER technology is a technology that relies on introducing a segment of RNA (arRNA) that is complementary to the sequence of the target site into the cell to recruit ADAR protein to edit the RNA target site. The RNA used in this technology that is complementary to the sequence of the target site can stimulate more efficient RNA editing at the target site without any modification.

[0055] In a preferred embodiment of the present invention, the editing tool used in the CRISPR / Cas gene editing technology is selected from any one of CRISPR / Cas9, CRISPR / Cas13 technology, CRISPR / Cas12 and CRISPR / Cas14.

[0056] In a preferred embodiment of the present invention, CRISPR-Cas9 and / or CBE technology is used to prevent the expression of TAP1 protein in cells.

[0057] In a preferred embodiment of the present invention, CBE technology is used to prevent the expression of TAP1 protein in cells; CBE is mainly used for base conversion, and can perform accurate base replacement without introducing double-strand breaks, with high accuracy. Since no double-strand breaks are caused, CBE reduces the risk of accidental insertions or deletions in the genome.

[0058] In a preferred embodiment of the present invention, the HLA encoding gene in step S1 is an HLA-I class antigen encoding gene, an HLA-II class antigen encoding gene or an HLA-III class antigen encoding gene.

[0059] HLA-I class antigens include HLA-A, HLA-B, and HLA-C; HLA-II class antigens include HLA-DP, HLA-DQ, and HLA-DR.

[0060] When the lentivirus carrying a single HLA encoding gene infects the chassis cells in step S1, the lentivirus carrying a single HLA encoding gene is also packaged, which includes: first co-transfecting the lentivirus vector carrying a single HLA encoding gene, a helper plasmid, and a packaging plasmid with the host cells.

[0061] The packaging plasmid includes: gag and pol genes, the gag gene encodes structural proteins: matrix (MA), capsid (CA), nucleocapsid (NC) and trans-frame polypeptide (TF). The pol gene encodes protease (PR), reverse transcriptase (RT) and integrase (IN). The packaging plasmid is selected from psPAX2, for example.

[0062] The helper plasmid includes: env (encoding envelope protein) or viral VSV-G protein from vesicular stomatitis virus envelope glycoprotein G and other helper regulatory elements.

[0063] In a preferred embodiment of the present invention, the packaging plasmid in step S1 includes gag and pol elements;

[0064] In a preferred embodiment of the present invention, the auxiliary plasmid in step S1 includes an envelope protein; in a preferred embodiment of the present invention, the auxiliary plasmid is pMD2.G.

[0065] In a preferred embodiment of the present invention, in step S2, the ligand encoding gene in the constructed lentiviral vector includes a tumor mutation site encoding gene.

[0066] Step S2 includes firstly packaging a lentiviral vector including a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, wherein the lentiviral packaging includes: co-transfecting a lentiviral vector, a helper plasmid, and a packaging plasmid with a host cell;

[0067] The types of tumors in genes encoding tumor mutation sites include but are not limited to solid tumors and hematological tumors.

[0068] In an alternative embodiment, the blood tumor is selected from acute myeloid leukemia (AML), multiple myeloma (MM), myelodysplastic syndrome (MDS) or acute lymphoblastic leukemia (ALL).

[0069] In an optional embodiment, the tumor is one or more of a digestive system tumor, a respiratory system tumor, a reproductive system tumor, a musculoskeletal system tumor, a nervous system tumor, an endocrine system tumor, a circulatory system tumor, a urinary system tumor, and a reproductive system tumor.

[0070] In an alternative embodiment, the tumor is a digestive system tumor.

[0071] In a further optional embodiment, the digestive system tumor is one or more of an esophageal tumor, a gastric tumor, a cardia tumor, an intestinal tumor, a liver tumor, and a gallbladder tumor.

[0072] In an optional embodiment, the tumor is colon cancer, rectal cancer, colorectal cancer, and the colorectal tumor includes one or more of polypoid type, stricture type and ulcerative type.

[0073] In a preferred embodiment of the present invention, the above-mentioned tumor is an epithelial tumor, including but not limited to papilloma, gastrointestinal cancer, uterine cancer, ovarian cancer, cervical cancer, lung cancer, adenocarcinoma, breast cancer, adenoma or squamous cell carcinoma.

[0074] The gastrointestinal cancer is selected from the group consisting of esophageal cancer, gallbladder cancer, stomach cancer, liver cancer, pancreatic cancer, bile duct cancer, small intestine cancer, colorectal cancer and anal cancer.

[0075] In an alternative embodiment, the adenocarcinoma includes but is not limited to lung adenocarcinoma, thyroid cancer, salivary gland cancer, or pancreatic cancer.

[0076] In an alternative embodiment, the adenoma includes but is not limited to a cystadenoma, a fibroadenoma, a pleomorphic adenoma or a polypoid adenoma.

[0077] In an alternative embodiment, breast cancer includes but is not limited to breast epithelial cancer;

[0078] Preferably, the breast cancer is ductal carcinoma or lobular carcinoma.

[0079] Breast cancer, preferably stage II to IV and / or poorly differentiated invasive ductal carcinoma, comedo carcinoma, and medullary carcinoma (preferably grade 2).

[0080] Ovarian cancer, serous and mucinous carcinomas (preferably stages Ic to IIIb), granulosa cell tumors, surface epithelial-stromal tumors (adenocarcinomas), cystadenocarcinomas, and endometrioid tumors.

[0081] Uterine cancer, preferably including endometrioid adenocarcinoma (preferably stage I to IIIc).

[0082] Bladder cancer, preferably including transitional cell carcinoma (preferably stage II to IV).

[0083] Lung cancer, preferably includes small cell lung cancer (preferably stage I to IIIb), non-small cell lung cancer (preferably poorly to moderately differentiated squamous and adenocarcinoma) and large cell lung cancer.

[0084] The squamous cell carcinoma is one or more of oral squamous cell carcinoma, pharyngeal squamous cell carcinoma, laryngeal cancer, esophageal squamous cell carcinoma (eg esophageal squamous cell carcinoma), lip squamous cell carcinoma, uterine squamous cell carcinoma, vaginal squamous cell carcinoma and skin squamous cell carcinoma.

[0085] Oral squamous cell carcinoma (OSCC) is also called oral squamous cell carcinoma. Examples of oral squamous cell carcinoma include but are not limited to tongue squamous cell carcinoma.

[0086] In other embodiments, the squamous cell carcinoma may also be squamous cell carcinoma formed by squamous metaplasia in the bronchus, bladder, renal pelvis and other parts.

[0087] In a preferred embodiment of the present invention, the cell is a mammalian cell;

[0088] In a preferred embodiment of the present invention, the mammalian cells are human cells, mouse cells, and rat cells;

[0089] In a preferred embodiment of the present invention, the mammalian cell is selected from any one of 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, mouse L cells, LNCaP cells, 633 cells, Vero, BHK cells, CV1 cells, Hela cells, MDCK cells, Hep-2 cells and Per6 cells;

[0090] In a preferred embodiment of the present invention, the human cells are primary human blood cells (PBMC);

[0091] In a preferred embodiment of the present invention, the cell is an immune cell;

[0092] In a preferred embodiment of the present invention, the immune cells are T cells or B cells.

[0093] In a second aspect, the present invention also provides a method for preparing a lentivirus or cell with a marker for displaying a natural conformation of an HLA polypeptide, wherein the lentivirus or cell for displaying a natural conformation of an HLA polypeptide is prepared by the above method, and co-transfected with a plasmid with a marker gene, a packaging plasmid, and a helper plasmid;

[0094] In a preferred embodiment of the present invention, the marker in the labeled plasmid is a coding sequence containing a selection marker and / or a fluorescent protein coding sequence;

[0095] In a preferred embodiment of the present invention, the selection marker is puromycin, neomycin, hygromycin B, blasticidin, glutamine synthetase, or dihydrofolate reductase;

[0096] In a preferred embodiment of the present invention, the fluorescent protein includes but is not limited to any one of GFP, mNeon, CFP, BFP, RFP, EGFP, ECFP, EBFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape1, mRaspberry, mGrape2 and mPlum.

[0097] In a preferred embodiment of the present invention, the auxiliary plasmid also has a modified VSV-G viral envelope protein encoding gene; after the VSV-G viral envelope protein mutates, the interaction between the original lentiviral gag protein and the cell membrane is destroyed, and only the lentivirus containing the HLA-peptide complex can bind to the specific cells containing the corresponding receptor, thereby obtaining a lentivirus with a screening marker and / or a fluorescent protein. The lentivirus with a screening marker and / or a fluorescent protein can be used to mark T cells expressing a specific TCR by ligand (HLA-NY-ESO-1)-receptor binding.

[0098] The modified VSV-G viral envelope protein has at least one amino acid substitution at at least one of the following positions on the VSV-G polypeptide: K47 and R354;

[0099] The modified VSV-G viral envelope protein comprises a K47Q substitution and a R354A substitution in the VSV-G polypeptide.

[0100] In a third aspect, the present invention also provides a lentivirus or cell prepared by the above method for displaying HLA polypeptides in natural conformation, or a lentivirus or cell prepared by the above method for displaying HLA polypeptides in natural conformation and carrying a label.

[0101] In a fourth aspect, the present invention also provides the use of lentivirus or cells in T cell labeling, T cell activation, recognition or identification of B cell receptor antigens, identification of B cell receptors or antibodies, recognition or identification of T cell receptors and paired pMHC, identification of immunogenic epitopes, identification of nucleic acids or proteins in target cells, identification of ligand receptor pairs, or preparation of anti-tumor products;

[0102] In a preferred embodiment of the present invention, the application of T cell markers includes: targeting T cells that recognize specific TCR sequences after lentiviral transfection and activation, and analyzing the T cells;

[0103] In a preferred embodiment of the present invention, the application method of T cell activation includes: transfecting activated T cells with lentivirus;

[0104] In a preferred embodiment of the present invention, the application method of recognizing or identifying the antigen of the B cell receptor includes: mixing the lentivirus with the B cell population; and classifying the cell population according to the marker gene to identify the B cell antigen;

[0105] In a preferred embodiment of the present invention, the application method of identifying B cell receptors or antibodies includes: mixing lentivirus with B cell population; classifying the cell population according to the marker gene to identify the B cell receptors or antibodies;

[0106] In a preferred embodiment of the present invention, the viral RNA is sequenced to identify antigens and matching B cell receptor sequences.

[0107] In a preferred embodiment of the present invention, the application method of identifying or identifying T cell receptors and paired pMHC includes: pMHC is displayed on the surface of a lentivirus, a host cell includes a T cell receptor for pMHC, a reporter protein connected to a structural protein of the lentivirus, and an RNA with a linker sequence, and the reporter protein is encoded by a marker gene; the lentivirus is mixed with a cell population; the cell population is classified according to the presence of the reporter protein, thereby identifying the T cell receptor; the structural protein is a nucleocapsid protein.

[0108] The adapter sequence is selected from at least one of a primer sequence, an anchor sequence, a universal sequence, a spacer, and an index tag sequence (such as a barcode sequence);

[0109] In an alternative embodiment, the universal sequence is selected from a transposase recognition sequence.

[0110] In an alternative embodiment, the transposase recognition sequence is selected from at least one of IE, OE and ME sequences. The transposase is selected from Tn5, MuA, IS5, IS91 or Vibrio harveyi transposase, or an active mutant thereof; In an alternative embodiment, the transposase is selected from Tn5 transposase or an active mutant thereof.

[0111] In a preferred embodiment of the present invention, the cell population comprises primary human T cells;

[0112] In a preferred embodiment of the application of the present invention, the application further comprises: sequencing the receptor sequence of the cell to identify the MHC peptide segment and the T cell receptor sequence.

[0113] In a preferred embodiment of the present invention, the application of identifying immunogenic epitopes includes:

[0114] The host cell includes an endogenous antigen for a receptor, a marker gene linked to a structural protein of the lentivirus, and an RNA with a linker sequence, wherein the RNA encodes the antigen information; the lentivirus is mixed with a cell population; and the cell population is classified according to the presence of a reporter protein encoded by the marker gene.

[0115] In a preferred embodiment of the present invention, viral RNA is sequenced to identify the antigen sequence;

[0116] In a preferred embodiment of the present invention, the receptor RNA of the cell is sequenced;

[0117] In a preferred embodiment of the present invention, the application of identifying nucleic acids or proteins in target cells includes: contacting a lentivirus with a cell mixture containing target cells, and delivering only the nucleic acid or protein of the lentivirus to the target cells, wherein the target cells express receptors that can recognize ligands on the surface of the lentivirus. After the VSV-G viral envelope protein mutates, the interaction between the original lentivirus gag protein and the cell membrane is destroyed, and only the lentivirus containing the HLA-peptide complex can bind to specific cells containing the corresponding receptors.

[0118] In a preferred embodiment of the present invention, the target nucleic acid to be identified is packaged in a lentiviral particle;

[0119] In a preferred embodiment of the present invention, the protein expressed by the target nucleic acid to be identified is linked to the structural protein gag protein of the lentivirus. The gag protein is a key component of the viral structure and plays an important role in the assembly and release of the virus. In addition, the gag protein plays a central role in the formation of viral particles, helping to aggregate viral RNA and other proteins into new viral particles. The gag protein interacts with the host cell membrane to promote the budding and release of viral particles.

[0120] In a preferred embodiment of the present invention, the application of identifying a ligand receptor pair includes: mixing a lentivirus with a cell population; classifying the cell population according to the presence of a marker gene, thereby identifying a ligand receptor pair;

[0121] In an alternative embodiment, a cocktail of (engineered) lentiviruses displaying different ligands is provided.

[0122] In an alternative embodiment, the method comprises combining the lentivirus with cells and incubating the virus / cell mixture at 4°C.

[0123] In an alternative embodiment, the method comprises combining the lentivirus with cells and incubating the virus / cell mixture at room temperature.

[0124] In an alternative embodiment, the method comprises combining the lentivirus with cells and incubating the virus / cell mixture at about 37°C.

[0125] In an alternative embodiment, the method comprises incubating the virus / cell mixture for about 30 minutes, or about 1 hour, or about 2 hours, or any time period between 0.5 hours and 2.5 hours.

[0126] In a preferred embodiment of the present invention, the viral RNA is sequenced to identify the ligand sequence;

[0127] In a preferred embodiment of the present invention, single-cell sequencing is performed on cells to identify receptor sequences.

[0128] The above-mentioned anti-tumor products include but are not limited to: drugs, reagents or kits.

[0129] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0130] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0131] Specifically, certain disclosed embodiments relate to modular viral display and delivery platforms to decode ligand-receptor interactions, deliver payloads in target cells, and link ligand-receptor interactions to cell states. In certain embodiments, lentiviruses can be engineered at multiple levels, including (1) displaying customized ligand proteins on the viral surface; (2) engineering viral surface ligands to enable specific receptor cell entry; (3) carrying fluorescent proteins to track viral trajectories; and (4) delivering payloads upon paired ligand-receptor recognition.

[0132] This technology can systematically analyze interaction pairs including TCR-pMHC, antibody-antigen, co-stimulatory ligand-receptor, and B cell antigen-BCR through engineered ligand-receptor interaction-mediated lentiviral cell entry. In certain embodiments, the method allows gene delivery in a specific receptor manner, thereby achieving selective manipulation of antigen-specific T cells and B cells. This method can accurately measure antigen specificity, TCR repertoire, gene expression, and surface protein characteristics in single human primary T cells by combining it with droplet-based single-cell sequencing analysis. The method of the present invention is not only highly sensitive and specific for screening and identifying TCR sequences of specific MHC-peptides, but also easy to operate.

[0133] Example 1

[0134] This example provides a method for preparing a cell line for displaying HLA polypeptides in natural conformation. For a specific flow chart, refer to Figure 1 shown.

[0135] (1) Preparation of fully HLA class I-depleted HEK293T cells

[0136] Plasmids with full HLA targeting sgRNA and Cas9 were constructed and transfected into HEK293T cells. After selecting positive clones, genomic DNA sequencing and flow cytometry analysis were performed to confirm that HLA protein was no longer expressed. The expression of HLA-A0201 was verified by flow cytometry, and the results of cell surface HLA class I levels were referred to Figure 2 As shown in (HLA Class I KO), the test results show that there is no HLA Class I molecule expression on the surface of HLA Class I KO cells. Multi-knockout 293T cells (chassis cells) were transfected with lentivirus to generate a monoallelic HLA Class I stable cell line, here using HLA-A0201 as an example, which can restore the level of HLA surface.

[0137] Table 1: sgRNA sequences for CRISPR-Cas9 HLA-I knockout

[0138] sgRNA Sequence sgPan-MHC-I 1 CGGCTACTACAACCAGAGCG(SEQ ID NO:1) sgPan-MHC-I 2 GAGATCACACTGACCTGGCAG(SEQ ID NO:2)

[0139] (2) TAP1, TAP2, ERAP1, ERAP2, and HM13 were eliminated in the HEK293T cell line by CBE.

[0140] sgRNA plasmids targeting TAP1, TAP2, ERAP1, ERAP2, and HM13 were designed and transfected into HLA I-deficient 293T cells. Monoclonal clones were seeded into 96-well microplates by flow cytometry.

[0141] Table 2: sgRNA sequences used for CBE

[0142]

[0143]

[0144] After 14 days of culture, the selected monoclonal clones were transferred to T25 culture flasks, and the knockout effect was verified by whole genome sequencing. The cell line with full knockout of TAP1 / TAP2 / ERAP1 / ERAP2 / HM13 was selected for subsequent Western Blot verification. 5×10^6 cells were collected, washed with PBS, and the cells were lysed to extract proteins. The knockout effect was verified according to the conventional SDS-PAGE and Western Blot experimental steps. The results refer to Figure 3 As shown, compared with wild-type HEK293T cells, the expression of the corresponding proteins was not detected in cells with TAP1 / TAP2 / ERAP1 / ERAP2 / HM13 gene knockout.

[0145] (3) Multi-knockout 293T cells (chassis cells) were transfected with lentivirus to generate a monoallelic HLA class I stable cell line, using HLA-A0201 as an example.

[0146] pLenti-CMV-HLA-A0201, psPAX2 and pMD2.G were co-transfected with 293T cells to package lentivirus containing the HLA-A0201 gene. Lentivirus was collected 48 hours after transfection and infected with multiple knockout HEK293T cells (chassis cells). Multiple knockout HEK293T cells were treated with 5 μg / mL of puromycin and monoclonal clones were planted into 96-well microplates by dilution. The expression of HLA-A0201 was verified and positive clones were selected for subsequent lentiviral packaging.

[0147] (4) Insert the peptide encoding the new antigen (here taking NY-ESO-1 peptide SLLMWITQC as an example) and the endoplasmic reticulum signal sequence from Ad2E3gp19K protein into the pLVX plasmid, and transform 293T cells together with psPAX2 and pMD2.G plasmids. The resulting lentivirus infects the monoallelic HLA class I stable cell line HEK293T cells in step (3). The resulting cells are used for T cell labeling lentiviral packaging.

[0148] (5) Take the cells from step (4) and perform cell sorting to obtain cells with HLA positive cell surface. The results of flow cytometry analysis refer to Figure 4 As shown, HLA-A0201 knockout cells were transfected with NY-ESO-1 157-165 HLA class I levels were restored after co-transfection.

[0149] Example 2

[0150] In this example, T cells carrying NY-ESO-1-TCR (1G4) were constructed by lentiviral transfection.

[0151] HEK293T cells were co-transfected with pLenti-EF1α-1G4 TCR-IRES-mCherry (refer to US 8143376B2 for complete gene synthesis), psPAX2 and pMD2.G. Lentivirus was collected 72 hours after transfection and centrifuged to 10 7 -10 8 TU / mL titer. T cells were activated with CD3 / CD28 microbeads for 48 hours and transfected with 1G4 TCR lentivirus to generate targeted TCR-T cells. mCherry was detected by flow cytometry to analyze the TCR positive rate.

[0152] Preparation of GFP-tagged lentivirus for displaying native conformation of HLA polypeptides: The specific neoantigen peptide (NY-ESO-1 peptide SLLMWITQC is used as an example here) prepared in step (4) of Example 1 and the monoallelic HLA class I stable cell line HEK293T cells were co-transfected with pLenti-GFP-puro (fluorescent reporter gene), psPAX2 and pVSV-G (K37Q, R354Q). The lentivirus was collected 72 hours after transfection and concentrated 100 times (~10 7 -10 8 TU / mL titer). The virus can be used to label T cells expressing a specific TCR.

[0153] 50 μL of HLA-A0201 presenting SLLMWITQC lentivirus was added to 1 million 1G4 TCR or control T cells in 1 mL X-vivo15 medium. Polybrene was added at a final concentration of 6 μg / mL. Cells were centrifuged at 1000 g for 60 minutes and the medium was changed 24 hours after transfection. T cells were analyzed by flow cytometry 48 hours after transfection.

[0154] mCherry, as shown by flow cytometry analysis ( Figure 5 A), the positive rate of TCR-T cells is about 70%. Flow cytometry analysis shows ( Figure 5 In B), T cells with specific TCRs can be labeled with lentivirus expressing NY-ESO-1 antigen.

[0155] Example 3

[0156] NY-ESO-1-TCR T target cells were labeled with CellTrace violet dye and mixed with unlabeled non-target KRAS-G12V-TCR T cells at 1:1, 1:5, 1:100, and 1:1000, respectively. 157-165 -GFP virus (WO2023107886A1) and HLA-A2:NY-ESO-1 containing native conformation 157-165 -GFP virus incubation, flow cytometry analysis was performed 48 hours later, and sensitivity and specificity were calculated.

[0157] The results are as follows Figure 6 As shown, when the target cell ratio is low (1:1000 or 1:100), the lentivirus containing the peptide-MHC complex in the native conformation has better sensitivity.

[0158] Sensitivity = GFP+ positive target cells / total target cells%;

[0159] Specificity = GFP+ positive non-target cells / total non-target cells%;

[0160] Signal-to-noise ratio = (GFP+ positive target cells / total target cells%) / (GFP+ positive non-target cells / total non-target cells%).

[0161] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for preparing a lentivirus or cell for displaying a native conformation of an HLA polypeptide, characterized in that: It includes the following steps: S1: Construction of a single HLA gene cell line: Using cells with complete HLA knockout and no TAP1 expression as chassis cells, infecting the chassis cells with a lentivirus carrying a single HLA encoding gene to obtain a cell line containing a single HLA gene but without expressing HLA molecules on the cell surface; S2: constructing a lentiviral vector comprising a ligand encoding gene and a signal peptide sequence targeting the endoplasmic reticulum, and then infecting the cell line of the single HLA gene with the lentivirus comprising the ligand encoding gene and the signal peptide sequence targeting the endoplasmic reticulum, culturing, and obtaining cells with HLA-positive cell surface through cell sorting, wherein the cells with HLA-positive cell surface display HLA-specific polypeptide complexes in natural conformation.

2. The preparation method according to claim 1, characterized in that: The ligand is an epitope or a protein; Preferably, the ligand is an MHC peptide, antibody, antigen, secretory protein, cell surface protein or other antigenic form expressed by a cell; Preferably, the antigen is an intracellular antigen; Preferably, the ligand is a tumor cell surface protein; Preferably, the tumor cell surface protein is selected from the group consisting of cancer-testis antigen NY-ESO-1, KRAS, HRAS, NRAS, CD19, BCMA, CD20, CD22, CD38, CD123, HER2, CD52, EGFR, PDL1, ADGRE2, carbonic anhydrase IX (CAIX), CCR1, CCR4, carcinoembryonic antigen (CEA), CD3, CD5, CD7, CD8, CD10, CD30, CD33, CD34, CD41, CD44, CD44V6, CD49f, CD56, CD70, CD74, CD99, CD133, CD138, CDS, CLEC12A, antigens of cytomegalovirus (CMV) infected cells, epithelial glycoprotein 2 (EGP-2), epithelial glycoprotein-40 (EGP-40), epithelial cell adhesion molecule (EpCAM), EGFRvIII, receptor tyrosine-protein kinase erb-B2,3,4, EGFIR, EGFR-VIII, ERBB folate binding protein (FBP), fetal acetylcholine receptor (ACh R), folate receptor alpha, ganglioside G2 (GD2), ganglioside G3 (GD3), human epidermal growth factor receptor 2 (HER2), human telomerase reverse transcriptase (hTERT), ICAM-1, integrin B7, interleukin-13 receptor subunit alpha-2 (IL-13Rα2), kappa-light chain, kinase insert domain receptor (KDR), Lewis A (CA19.9), Lewis Y (LeY), L1 cell adhesion molecule (L1-CAM), LILRB2, melanoma antigen family A1 (MAGE -A1), MICA / B, mucin 1 (Muc-1), mucin 16 (Muc-16), mesothelin (MSLN), NKCSI, NKG2D ligand, c-Met, carcinoembryonic antigen (h5T4), PRAME, prostate stem cell antigen (PSCA), PRAME prostate-specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), TIM-3, TRBCI, TRBC2, vascular endothelial growth factor R2 (VEGF-R2), or Wilms tumor protein (WT-1).

3. The preparation method according to claim 1, characterized in that: In step S1, cells that do not express TAP1, HLA, and at least one of the following proteins are used as chassis cells: TAP2, ERAP1, HM13, and ERAP2; Preferably, LEAPER technology, CRISPR / Cas gene editing technology, artificial nuclease-mediated zinc finger nuclease technology (ZFN), transcription activator-like effector nuclease technology (TALEN) and / or CBE technology are used to prevent the expression of HLA and TAP1 proteins in the cell; Preferably, the CBE technology is used to prevent the TAP1 protein from being expressed in the cell; Preferably, the HLA encoding gene in step S1 is an HLA-I class antigen encoding gene, an HLA-II class antigen encoding gene or an HLA-III class antigen encoding gene; Preferably, when the lentivirus carrying a single HLA encoding gene infects the chassis cells in step S1, the step further includes packaging the lentivirus carrying a single HLA encoding gene, which includes: first co-transfecting the lentivirus vector carrying the single HLA encoding gene, the helper plasmid, and the packaging plasmid with the host cells; Preferably, the packaging plasmid comprises gag and pol elements; Preferably, the helper plasmid in step S1 comprises an envelope protein; preferably, the helper plasmid is pMD2.G.

4. The preparation method according to claim 1, characterized in that: In step S2, the ligand encoding gene in the constructed lentiviral vector includes a tumor mutation site encoding gene.

5. The preparation method according to claim 4, characterized in that: The step S2 includes firstly packaging the lentiviral vector including the ligand encoding gene and the signal peptide sequence targeting the endoplasmic reticulum, and the lentiviral packaging includes: co-transfecting the lentiviral vector, the helper plasmid, the packaging plasmid and the host cell.

6. The preparation method according to claim 1, characterized in that: The cell is a mammalian cell; Preferably, the mammalian cell is a human cell, a mouse cell, or a rat cell; Preferably, the mammalian cell is selected from any one of 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, mouse L cells, LNCaP cells, 633 cells, Vero, BHK cells, CV1 cells, Hela cells, MDCK cells, Hep-2 cells and Per6 cells; Preferably, the human cells are primary human blood cells (PBMC); Preferably, the cell is an immune cell; Preferably, the immune cell is a T cell or a B cell.

7. A method for preparing a lentivirus or cell with a label for displaying HLA polypeptides in natural conformation, characterized in that: A lentivirus or cell for displaying HLA polypeptides in natural conformation is prepared by the method of any one of claims 1 to 6, and co-transfected with a plasmid carrying a marker gene, a packaging plasmid, and a helper plasmid; Preferably, the marker in the labeled plasmid is a coding sequence containing a selection marker and / or a fluorescent protein coding sequence; Preferably, the selection marker is puromycin, neomycin, hygromycin B, blasticidin, glutamine synthetase, or dihydrofolate reductase; Preferably, the fluorescent protein is any one of GFP, mNeon, CFP, BFP, RFP, EGFP, ECFP, EBFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape1, mRaspberry, mGrape2 and mPlum; Preferably, the auxiliary plasmid also has a modified VSV-G viral envelope protein encoding gene; Preferably, the modified VSV-G viral envelope protein has at least one amino acid substitution at at least one of the following positions on the VSV-G polypeptide: K47 and R354; Preferably, the modified VSV-G viral envelope protein comprises a K47Q substitution and a R354A substitution in the VSV-G polypeptide.

8. A lentivirus or cell for displaying a native conformation of an HLA polypeptide prepared by the method of any one of claims 1 to 6, or a lentivirus or cell for displaying a native conformation of an HLA polypeptide prepared by the method of claim 7 and carrying a label.

9. Use of the lentivirus or cell according to claim 8 in T cell labeling, T cell activation, recognition or identification of B cell receptor antigens, identification of B cell receptors or antibodies, recognition or identification of T cell receptors and paired pMHC, identification of immunogenic epitopes, identification of nucleic acids or proteins in target cells, identification of ligand receptor pairs, or preparation of anti-tumor products; Preferably, the application of the T cell marker includes: Targeting the activated T cells after lentiviral transfection to T cells that recognize specific TCR sequences, and analyzing the T cells; Preferably, the application method of the T cell activation comprises: transfecting the activated T cells with the lentivirus; Preferably, the application method of recognizing or identifying the antigen of the B cell receptor comprises: mixing the lentivirus with a B cell population; and classifying the cell population according to the marker gene to identify the B cell antigen; Preferably, the application method for identifying B cell receptors or antibodies comprises: mixing lentivirus with B cell population; classifying the cell population according to marker genes to identify B cell receptors or antibodies; Preferably, the viral RNA is sequenced to identify antigens and matching B cell receptor sequences.

10. The use according to claim 9, characterized in that: The application method of identifying or identifying T cell receptors and paired pMHCs includes: pMHC is displayed on the surface of a lentivirus, a host cell includes a T cell receptor for pMHC, a reporter protein connected to a structural protein of the lentivirus, and an RNA with a linker sequence, wherein the reporter protein is encoded by the marker gene; the lentivirus is mixed with a cell population; the cell population is classified according to the presence of the reporter protein, thereby identifying the T cell receptor; the structural protein is a nucleocapsid protein; Preferably, the cell population comprises human primary T cells; Preferably, the application further comprises: sequencing the receptor sequence of the cell to identify the MHC peptide segment and the T cell receptor sequence; Preferably, the application of identifying immunogenic epitopes comprises: The host cell includes an antigen native to the receptor, a marker gene linked to a structural protein of the lentivirus, and an RNA with a linker sequence, wherein the RNA encodes the antigen information; mixing the lentivirus with the cell population; and sorting the cell population according to the presence of a reporter protein encoded by the marker gene; Preferably, the viral RNA is sequenced to identify the antigenic sequence; Preferably, the receptor RNA of the cell is sequenced; Preferably, the application of identifying nucleic acids or proteins in target cells comprises: contacting the lentivirus with a cell mixture containing target cells, and delivering only the nucleic acid or protein of the lentivirus to the target cells, wherein the target cells express receptors that can recognize ligands on the surface of the lentivirus; Preferably, the target nucleic acid to be identified is packaged in the viral particles of the lentivirus; Preferably, the protein expressed by the target nucleic acid to be identified is functionally linked to the structural protein gag protein of the lentivirus; Preferably, the application of identifying a ligand receptor pair comprises: mixing the lentivirus with a cell population; classifying the cell population according to the presence of a marker gene, thereby identifying a ligand receptor pair; Preferably, the viral RNA is sequenced to identify the ligand sequence; Preferably, the cells are subjected to single cell sequencing to identify the receptor sequence.

Images