CRISPR / Cas9 gene editing method of procypris rabaudi

Abstract

The invention discloses a CRISPR / Cas9 gene editing method of procypris rabaudi, and relates to the field of bioengineering.The CRISPR / Cas9 gene editing method comprises the following steps that S1, sgRNA corresponding to a target gene is obtained through transcription according to target gene design; s2, sgRNA and Cas9 protein are mixed and then injected into fertilized eggs of procypris rabaudi through microinjection; and S3, culturing the fertilized ova injected with the sgRNA and Cas9 protein to complete target gene editing. Gene editing is used in allotetraploid fishes for the first time, a procypris rabaudi CRISPR / Cas9 gene editing whole-process technical platform from gene sequence screening, sgRNA / Cas9 microinjection to phenotype verification is established, a material is also provided for deep research of the new species of procypris rabaudi, and the procypris rabaudi CRISPR / Cas9 gene editing whole-process technical platform has a wide application prospect. The situation that only basic surface genetics research can be carried out on the procypris rabaudi, and genetic function verification is difficult to deepen is broken through.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to a CRISPR / Cas9 gene editing method for rock carp. Background Art

[0002] Rock carp, distributed in the upper reaches of the Yangtze River and its tributaries, is a bottom fish that lives in the cracks of the bottom rocks in the Yangtze River Basin. It is mostly found in the Jialing River, Minjiang River and Jinsha River. It is now one of the wild precious economic fish in Sichuan, Chongqing and other places. Rock carp has high economic and nutritional value, but it has not been well promoted in the market due to its long initial sexual maturity, immature artificial breeding, slow growth and low editing efficiency due to its allotetraploidy. At present, there are few studies on rock carp, which are almost limited to the research on feed nutrition in Chinese literature, which greatly hinders the development of its genetic germplasm resources and the need to explore its economic traits. Therefore, it is of great significance to develop gene editing methods on rock carp to create new varieties and shorten the breeding cycle. Rock carp is a new research object and has important nutritional and economic value, but it cannot be well promoted due to its own traits. CRISPR / Cas9 gene editing provides a means and method. As an allotetraploid, the use of gene editing to carry out precision breeding and create new varieties is a breakthrough and innovation. Therefore, this technology can be used not only to study the functions of rock carp genes, but also to accurately modify and edit endogenous target genes of rock carp, cultivate new genetically improved rock carp breeding strains, and provide reference value for research on other allotetraploid fish. Summary of the invention

[0003] In view of the above-mentioned deficiencies in the prior art, the present invention provides a CRISPR / Cas9 gene editing method for rock carp, which can edit important genes related to growth, sex, etc. of rock carp, thereby creating excellent varieties with fast growth, rich meat or few intramuscular spines, and can also be used to study the gene functions of rock carp.

[0004] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0005] A CRISPR / Cas9 gene editing method for rock carp is provided, comprising the following steps:

[0006] S1: Design and transcribe the sgRNA corresponding to the target gene;

[0007] S2: sgRNA and Cas9 protein were mixed and microinjected into fertilized eggs of rock carp;

[0008] S3: Cultivate the fertilized eggs injected with sgRNA and Cas9 protein to complete the target gene editing.

[0009] Furthermore, the design requirements for the sgRNA target site in step S1 are specifically as follows:

[0010] The sgRNA target site was selected within the exon sequence of the ATG design target site, with a length of 20 bp; and a GC content of 70%-85%.

[0011] Furthermore, the method for obtaining the fertilized eggs of the rock carp is specifically as follows:

[0012] A1: Select healthy and sexually mature male and female rock carp during the breeding season from April to May;

[0013] A2: Both male and female rock carp are injected with oxytocin;

[0014] A3: After the injection is completed, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25°C, and then the semen and eggs are squeezed out respectively, and a small amount of water is added to mix and stir;

[0015] A4: After continuous stirring for 2 minutes, wash away the excess semen to obtain the fertilized eggs and store them for later use.

[0016] Furthermore, oxytocin is a mixed hormone including HCG hormone, DOM hormone and LRH-A2 hormone.

[0017] Furthermore, the specific method of step A2 is: after injecting oxytocin once under the ventral fin of the rock carp, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25°C, the oxytocin is injected again, and step A3 is performed.

[0018] Furthermore, in step A4, when the fertilized egg is stored, the fertilized egg is stored in a balanced solution, which includes 0.7-0.9% sodium chloride, 0.01-0.05% potassium chloride and 0.01-0.04% calcium chloride.

[0019] Furthermore, in step S2, when the fertilized eggs were injected, the concentration of sgRNA was 500 ng / ul, the concentration of Cas9 protein was 450 ng / ul, and after the sgRNA and Cas9 protein were mixed in a volume ratio of 1:1, 3 nl of the mixture was injected into each fertilized egg.

[0020] Furthermore, when injecting sgRNA and Cas9 protein, the fertilized eggs were placed in a culture dish lined with gauze, and the gauze was 40 mesh.

[0021] Furthermore, after the fertilized eggs are injected with sgRNA and Cas9 protein, the gauze is lifted and placed in a mesh cage. After the fertilized eggs slowly spread out, the mesh is taken out and the fertilized eggs are gently scattered in the mesh cage with feathers, and the environment in the mesh cage is maintained at 25 degrees with oxygen and running water for cultivation.

[0022] The beneficial effects of the present invention are:

[0023] 1. This invention uses gene editing in allotetraploid fish for the first time, and establishes a full-process technology platform for CRISPR / Cas9 gene editing of rock carp from gene sequence screening, sgRNA / Cas9 microinjection to phenotypic verification. This also provides materials for in-depth research on this new species of rock carp, breaking the situation where only basic surface genetic research can be carried out on rock carp and it is difficult to conduct in-depth genetic function verification.

[0024] 2. A mold suitable for microinjection of sticky eggs was made, and the optimal sgRNA concentration was used to improve the survival rate of edited embryos. Attention was paid to the phenomenon that fertilized eggs would absorb water and become difficult to inject. The problem was solved by using a balancing fluid, which further improved the survival rate.

[0025] 3. Microinjection can be completed in a standardized and controllable manner before the embryo divides into the 2-cell stage; after artificial insemination, fertilization can begin at a determined time to avoid super-mature eggs and semen loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram for sgRNA target site design;

[0027] Figure 2 Diagram of the mold and fertilized egg during injection;

[0028] Figure 3 Electrophoresis diagram for detecting the efficiency of mstna gene editing;

[0029] Figure 4 This is the sequencing peak diagram of the sample with double bands in Example 2. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0031] Example 1 Editing of CRISPR / Cas9 genes in rock carp

[0032] In this embodiment, the mstna gene of rock carp is edited, which specifically includes the following steps:

[0033] S1: Download the protein sequence of zebrafish mstna from NCBI (https: / / www.ncbi.nlm.nih.gov / ), use blastp to align the sequence with the obtained rock carp genome, obtain the full-length sequence of the rock carp mstna gene, and annotate the exons, introns and other structures of the gene through the sequence alignment results for subsequent sgRNA target site design;

[0034] Benchling was used to design sgRNA target sites online. The sgRNA target site was selected within the exon sequence of the ATG design target site, with a length of 20bp and a GC content of 70%-85%. In actual selection, the on-target / off-target score was selected while meeting the above requirements; since the rock carp is an allotetraploid, mstna has copies on chromosomes A and B respectively, so the target site needs to be designed on chromosomes A and B. Three sgRNAs were designed on chromosomes A and B, such as Figure 1 As shown in Table 1, Figure 1 The middle sequence only shows the third and second target site sequences on chromosomes A and B. The designed target sites were sent to Sangon Biotech Co., Ltd. for synthesis according to the bridging PCR sequence.

[0035] Table 1

[0036] Target site name sgRNA sequence (5'-3') mstna-sgRNA1-A GTGACGCCAGGAGACGACAA mstna-sgRNA2-A TTGGAGCCTGTTCTAGACAC mstna-sgRNA3-A TTGGTTCCTCTGCTGGTCGG mstna-sgRNA1-B TCGGAGCTTGTTCTAGACGC mstna-sgRNA2-B TGAACGCCCAGACAAACTCC mstna-sgRNA3-B CACTGGCAAGAGGTCCAGAC

[0037] Among them, mstna-sgRNA2-A is a reverse sequence.

[0038] The specific steps for in vitro transcription synthesis of sgRNA are as follows:

[0039] S101: Use bridge PCR to synthesize sgRNA template. The 100ul PCR reaction system is shown in Table 2.

[0040] Table 2

[0041] sgRNA-F 2ul sgRNA-R 2ul 1×Taq buffer 10ul dNTP Mixture 8ul DNA polymerase 2ul ddH2O 76ul Total 100ul

[0042] PCR reaction conditions were: 95°C, 2 min; 95°C, 15 s; 60°C, 30 s; 72°C, 30 s; 35 cycles followed by 72°C, 5 min; stored at 4°C;

[0043] S202: Purifying the PCR product obtained in S101, including the following specific steps:

[0044] S2021: Transfer 100ul of PCR product to a 1.5ml enzyme-free centrifuge tube.

[0045] S2022: Add 500ul of PBbuffer to the enzyme-free centrifuge tube at a ratio of PBbuffer:PCR product = 5:1 and mix well.

[0046] S2023: Transfer the mixed sample to an adsorption column and centrifuge at 13,000 rpm for 2 minutes at room temperature.

[0047] S2024: Discard the waste liquid from centrifugation, centrifuge the empty tube at 13000rpm for 2min, and place the adsorption column in a new 1.5ml enzyme-free centrifuge tube.

[0048] S2025: Add 30ul of PBbuffer preheated at 37°C to the adsorption column membrane and centrifuge at 13000rpm for 2min at room temperature.

[0049] S2026: Collect the liquid in the lower tube, aspirate it onto the adsorption column membrane again, repeat centrifugation and elution once, discard the adsorption column, and save the liquid in the lower tube, which is the purified sgRNA; use NanoDrop to determine the concentration and store the purified sgRNA template at -20℃ for later use.

[0050] S203: Perform in vitro transcription, the specific steps are:

[0051] S2031: Add the reaction system shown in Table 3 below on ice, wherein Enzymemix is ​​T7 polymerase; mix all components evenly and incubate in a water bath at 37°C for 2-3 hours.

[0052] Table 3

[0053] sgRNA template 3ul Transcriptionbuffer 2ul UTP 1ul ATP 1ul GTP 1ul CTP 1ul Enzymemix 1ul Total 10ul

[0054] S2032: Add 1 μl of DNase I and continue the reaction at 37°C for 15 min to remove the sgRNA template;

[0055] S2033: Add 1ul of 3M sodium acetate and 25ul of anhydrous ethanol, and place at -20℃ for precipitation overnight.

[0056] S2034: Centrifuge at 13,000 rpm for 15 min at 4°C, discard the supernatant and retain the precipitate.

[0057] S2035: Add 500ul of 70% ethanol to the precipitate, centrifuge at 13000rpm at 4°C for 15min, and discard the supernatant.

[0058] S2036: Place on a clean bench to evaporate any residual liquid, add 20-50ul of DEPC water to dissolve the precipitate according to the amount of precipitate; measure the concentration using a spectrophotometer, and store at -80°C after aliquoting.

[0059] S2: sgRNA and Cas9 protein were mixed and microinjected into fertilized eggs of rock carp;

[0060] The specific method for obtaining the fertilized eggs of the rock carp is as follows:

[0061] A1: Select healthy and sexually mature male and female rock carp during the breeding season from April to May;

[0062] A2: After injecting oxytocin once under the ventral fin of the rock carp, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25°C, and then the oxytocin is injected again, and step A3 is performed. Oxytocin is a mixed hormone containing HCG hormone, DOM hormone and LRH-A2 hormone.

[0063] A3: After the injection is completed, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25°C, and then the semen and eggs are squeezed out respectively, and a small amount of water is added to mix and stir;

[0064] A4: After continuous stirring for 2 minutes, wash away the excess semen to obtain the fertilized eggs, and store the fertilized eggs in a balancing solution. In this embodiment, the balancing solution is prepared by dissolving sodium chloride, potassium chloride and calcium chloride in deionized water. The concentration of sodium chloride in the balancing solution is 0.75%, the concentration of potassium chloride is 0.02%, and the concentration of calcium chloride is 0.02%. In other embodiments of the present invention, the concentration of sodium chloride can also be 0.7%, 0.8% or 0.9%; the concentration of potassium chloride can also be 0.01%, 0.03% or 0.05%; the concentration of calcium chloride can also be 0.01%, 0.03% or 0.04%. In specific implementation, artificial insemination can be started 10 hours after the second injection of oxytocin, and during this period, the male and female fish can be observed at any time to see whether they have ejaculated or ovulated. Squeeze the abdomen of the female fish by hand, and put the squeezed eggs into a clean, liquid-free bowl. At this time, squeeze the squeezed semen into the bowl, add a small amount of water and stir continuously for 2 minutes, then wash away the excess semen with water to obtain the fertilized eggs for microinjection. The fertilized eggs of rock carp are sticky eggs. You can use clean water to wash the fertilized eggs several times to reduce the viscosity of the fertilized eggs and avoid damage to the fertilized eggs during transfer and injection of the sgRNA and Cas9 protein mixture into the fertilized eggs. After washing, put them in the balancing solution.

[0065] The fertilized eggs obtained in the above steps A1-A4 were injected with the sgRNA obtained in step S2036, and the volume was adjusted to 500ng / ul. The Cas9 protein concentration was prepared to 450ng / ul. After the sgRNA and Cas9 protein were mixed at a volume ratio of 1:1, 3nl of the sgRNA and Cas9 protein mixture was drawn into the microinjection capillary needle using a pipette. The culture dish containing the fertilized eggs was placed under a stereo microscope, and the mixture was injected into the animal pole of the fertilized eggs using a microinjection capillary needle.

[0066] Since the eggs of rock carp are sticky, they will stick to the culture dish over time, which makes it difficult to transfer them to the cage for culture after injection. If the embryos stuck to the culture dish are directly placed in the cage, a large number of embryos will gather together, which will easily cause mold and affect the survival rate of the fertilized eggs. Therefore, when injecting sgRNA and Cas9 protein, the fertilized eggs are placed in a culture dish with gauze, and the gauze is 40 mesh. In specific implementation, Figure 2 As shown, place gauze on a glass culture dish, cut it into circles of the same size along the round bottom of the glass culture dish, place the gauze cut into circles directly in the culture dish, and finally add a small amount of water to the culture dish to make the gauze fit better with the bottom of the culture dish.

[0067] S3: After the fertilized eggs are injected with sgRNA and Cas9 protein, lift the gauze and put it into the net cage. After the fertilized eggs slowly spread out, take out the gauze and gently scatter the fertilized eggs in the net cage with feathers. Keep the net cage at 25 degrees, oxygenated and flowing water for cultivation.

[0068] Example 2 Editing efficiency detection

[0069] After the gene-edited fertilized eggs prepared in Example 1 were cultured for 6-7 days, the efficiency of gene editing was tested, specifically:

[0070] Design of detection primers: For the target site of gene editing, about 50-100 bp upstream and downstream, upstream and downstream primers were designed using PrimerPremier 5 software as shown in Table 4, and sent to Sangon Biotech Co., Ltd. for synthesis.

[0071] Table 4

[0072] Primer name Primer sequences mstna-FA-1-2 TTTTGGAGTGTGTTGGGGTC mstna-ra-1-2 CAGTGGAGGTGCTTTGGGTA mstna-FA-3 TATGTTCTCACTGAGCCCAA mstna-RA-3 TCACAGCCAGATCATTTCCA mstna-FB-1 ATGTTTATCCTTCTTTATCT mstna-RB-1 GCCTTGTTCCTCATCCTCAC mstna-fb-2 GAGGAGCCAACCACAGTCTT mstna-RB-2 CGTTTCCATTTGCATCAAAG mstna-FB-3 TGGTAAGGTTTGTTTGGGGT mstna-RB-3 GCAACGTGTCTCGGTGGAAT

[0073] Sampling: When the embryos develop to the stage of emergence, the injected embryos and wild-type control embryos are taken to extract the genome. DNA is extracted by alkaline lysis method: 200ul sodium hydroxide solution is added to the eight tubes containing fry tissues, and the tubes are dried in a 95℃ oven for 30min. Every 15min, the tubes are taken out and shaken slightly, and finally 20ul of 8M Tris-HCl is added to neutralize and mix.

[0074] The edited embryos (Editing) and wild-type control embryos (WT) obtained by sampling were subjected to PCR detection, and the PCR reaction system is shown in Table 5.

[0075] Table 5

[0076] DNA template 2ul mstna-F 0.5ul mstna-R 0.5ul 2×MIX 12.5ul <![CDATA[ddH20]]> 9.5ul Total 25ul

[0077] The reaction program was: 95°C, 2 min; 94°C, 30 s, 57°C, 30 s, 72°C, 15 s, 35 cycles in total, followed by 72°C, 10 min; and finally stored at 4°C.

[0078] The PCR reaction products were detected by electrophoresis using 2% agarose gel. Figure 3 As shown, channel 1 is the wild-type band detected by primers at target sites 1 and 2 on chromosome A; channel 2 is the wild-type band detected by primers at target site 3 on chromosome A; channel 3 is the wild-type band detected by primers at target site 1 on chromosome B; channel 4 is the wild-type band detected by primers at target site 2 on chromosome B; channel 5 is the wild-type band detected by primers at target site 3 on chromosome B; channel 6 is the Mstna edited band detected by primers at target sites 1 and 2 on chromosome A; channel 7 is the Mstna edited band detected by primers at target site 3 on chromosome A; channel 8 is the Mstna edited band detected by primers at target site 1 on chromosome B; channel 9 is the Mstna edited band detected by primers at target site 2 on chromosome B; channel 10 is the Mstna edited band detected by primers at target site 3 on chromosome B; Figure 3 It can be seen that sample 13 has obvious double bands around 250bp. The PCR products of the samples with double bands were sent to Sangon Biotech Co., Ltd. for Sanger sequencing. The sequencing peaks are shown in Figure 4 As shown, Figure 4 a is the target site peak diagram of sgRNA1 and sgRNA2 shared primer sequencing on chromosome A. Figure 4 b is the target site peak diagram of sgRNA3 forward sequencing on chromosome A. Figure 4 c is the target site peak diagram of sgRNA2 forward sequencing on chromosome B, Figure 4 d is the target site peak diagram of sgRNA3 forward sequencing on chromosome B; Figure 4 It can be seen that there are obvious double peaks near the target site.

Claims

1. A CRISPR / Cas9 gene editing method for rock carp, characterized in that: The steps include: S1: Design and transcribe the sgRNA corresponding to the target gene; S2: sgRNA and Cas9 protein were mixed and microinjected into fertilized eggs of rock carp; S3: Cultivate the fertilized eggs injected with sgRNA and Cas9 protein to complete the target gene editing.

2. The CRISPR / Cas9 gene editing method for rock carp according to claim 1, characterized in that: The design requirements for the sgRNA target site in step S1 are specifically as follows: The sgRNA target site was selected within the exon sequence of the ATG design target site, with a length of 20 bp; and a GC content of 70%-85%.

3. The CRISPR / Cas9 gene editing method for rock carp according to claim 1, characterized in that: The method for obtaining the fertilized eggs of the rock carp is specifically as follows: A1: Select healthy and sexually mature male and female rock carp during the breeding season from April to May; A2: Both male and female rock carp are injected with oxytocin; A3: After the injection is completed, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25°C, and then the semen and eggs are squeezed out separately, and a small amount of water is added to mix and stir; A4: After continuous stirring for 2 minutes, wash away the excess semen to obtain the fertilized eggs and store them for later use.

4. The CRISPR / Cas9 gene editing method for rock carp according to claim 2, characterized in that: The oxytocin is a mixed hormone, comprising HCG hormone, DOM hormone and LRH-A2 hormone.

5. The CRISPR / Cas9 gene editing method for rock carp according to claim 2, characterized in that: The specific method of step A2 is: after injecting oxytocin once under the ventral fin of rock carp, the male and female rock carp are cultured separately for 10 hours at a water temperature of 25° C., the oxytocin is injected again, and step A3 is performed.

6. The CRISPR / Cas9 gene editing method for rock carp according to claim 2, characterized in that: In the step A4, when the fertilized egg is stored, the fertilized egg is stored in a balanced solution, and the balanced solution includes 0.7-0.9% sodium chloride, 0.01-0.05% potassium chloride and 0.01-0.04% calcium chloride.

7. The CRISPR / Cas9 gene editing method for rock carp according to claim 1, characterized in that: In step S2, when injecting the fertilized egg, the concentration of sgRNA is 500 ng / ul, the concentration of Cas9 protein is 450 ng / ul, and after mixing sgRNA and Cas9 protein in a volume ratio of 1:1, 3 nl of the mixture is injected into each fertilized egg.

8. The CRISPR / Cas9 gene editing method for rock carp according to claim 1, characterized in that: When injecting sgRNA and Cas9 protein, the fertilized eggs were placed in a culture dish lined with gauze, and the gauze was 40 mesh.

9. The CRISPR / Cas9 gene editing method for rock carp according to claim 8, characterized in that: After the fertilized eggs are injected with sgRNA and Cas9 protein, lift the gauze and put it into the net cage. After the fertilized eggs slowly spread out, take out the gauze and gently scatter the fertilized eggs in the net cage with feathers. Keep the net cage at 25 degrees, oxygenated and flowing water for cultivation.

Images