CircRNA (Ribonucleic Acid) marker for diagnosing breast cancer complicated with depression and application of circRNA marker

Abstract

The invention provides a circRNA (Ribonucleic Acid) marker for diagnosing breast cancer complicated with depression and application of the circRNA marker. The circRNA marker is hsacirc0014220 or hsacirc0002387, the nucleotide sequence of the hsacirc0014220 is as shown in SEQ ID NO. 1, and the primer sequences of the hsacirc0014220 are as shown in SEQ ID NO. 2 and SEQ ID NO. 3; the nucleotide sequence of the hsacirc0002387 is as shown in SEQ ID NO. 4, and the primer sequences of the hsacirc0002387 are as shown in SEQ ID NO. 5 and SEQ ID NO. 6. The circRNA marker provided by the invention can accurately distinguish patients with breast cancer combined with depression from patients without depression caused by breast cancer, has stronger specificity compared with other depression-related circRNA markers, and has important significance in diagnosis, treatment and prevention of breast cancer combined with depression.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a circRNA marker for diagnosing breast cancer combined with depression and an application thereof. Background Art

[0002] In recent years, the incidence of breast cancer has increased year by year, and it tends to be younger. In some areas, it has jumped to the top of female malignant tumors. Due to the impact of breast cancer surgery and chemotherapy on patients, some patients have experienced varying degrees of depression. Domestic and foreign studies have shown that the prevalence of depression in breast cancer patients ranges from 10% to 63.5% due to different survey methods and survey populations, but it is significantly higher than the prevalence of depression in healthy people. Cancer-related depression greatly reduces the quality of life of patients. Therefore, it is very necessary to diagnose whether breast cancer patients also suffer from depression and intervene early.

[0003] At present, the main diagnostic tools for depression include the Diagnostic and Statistical Manual of Mental Disorders, 5th edition (DSM-5) (International Classification of Disease, ICD), depression scales, etc. However, the application of the above tools has the following defects: (1) Limitations: They diagnose the disease by identifying the key symptoms of depression, including fatigue, tiredness, decreased appetite, insomnia, decreased attention and psychomotor agitation, but some symptoms also appear in other mental or physical diseases; (2) Lack of objectivity: The above diagnosis is mainly based on the patient's subjective description of the symptoms and the doctor's mental state test of the patient, which will be affected by subjective factors; (3) Lack of accuracy: When some patients fill in the depression measurement scale, they may fail to make the diagnosis due to their low cultural level and poor comprehension.

[0004] With the development of technology, people have begun to use molecular biological methods to diagnose depression. circRNA is a closed circular non-coding RNA that is involved in the occurrence and development of many diseases, including depression, cancer, cardiovascular disease, and neurological diseases. Through transcriptome analysis and other technologies, researchers have found multiple circRNAs that are abnormally expressed in the peripheral blood of humans and animal models of depression. At the same time, the role of circRNA as a new therapeutic target for improving depression-like symptoms has been confirmed in various animal models. For example, Cui et al. found that hsa_circRNA_103636 was significantly downregulated in the blood of patients with depression; Zhou et al. used the same technology to find that 340 circRNAs had abnormal expression levels in the peripheral blood of patients with depression; Zhang et al. found that circDYM expression was significantly reduced in blood samples of patients with depression. Chinese patent CN105861716A also provides a combination of circRNA markers for the diagnosis of depression.

[0005] However, depression itself is a disease with unclear etiology and pathological mechanism, and complex and diverse symptoms. Due to the influence of tumors, the pathogenesis of depression in breast cancer patients is different from that of depression in the general population. The above circRNA can only be used as a biomarker for diagnosing depression in the general population, and cannot be used to diagnose breast cancer combined with depression. Summary of the invention

[0006] The object of the present invention is to provide a circRNA marker for diagnosing breast cancer combined with depression and its application. The circRNA marker provided by the present invention has high sensitivity, specificity and accuracy, and the circRNA marker has expression differences in the whole blood of patients with breast cancer combined with depression, and can effectively distinguish patients with breast cancer combined with depression from patients with breast cancer without depression. Therefore, it can be used as a new biomarker for diagnosing breast cancer combined with depression.

[0007] In order to achieve the above object, the present invention adopts the following technical solution: A circRNA marker for diagnosing breast cancer complicated with depression, wherein the marker is hsa_circ_0014220 or hsa_circ_000238.

[0008] The hsa_circ_0014220 is formed by reverse splicing of exons 2 and 3 of S100A9 (NM_002965, chr1:153330744-153333503), and the nucleotide sequence is shown in SEQ ID NO. 1.

[0009] The hsa_circ_0002387 is formed by reverse splicing of exons 5, 6, and 7 of TNIK (NM_015028, chr3:170906490-170912424), and the nucleotide sequence is shown in SEQ ID NO. 4.

[0010] The above-mentioned circRNA marker is a whole blood marker of the patient, and its verification method includes the following steps: (1) Collect whole blood from breast cancer patients and extract RNA; (2) Detect the expression level of related circRNA using qRT-PCR; (3) Use ROC curve and correlation analysis to determine the diagnostic value of related circRNA for breast cancer combined with depression.

[0011] The real-time quantitative PCR validation experiment in Example 2 showed that the circRNA markers hsa_circ_0014220 and hsa_circ_0002387 in the whole blood of breast cancer patients with depression were significantly increased compared with those of breast cancer patients without depression.

[0012] The primer combinations for specific amplification of the above circRNA markers are as follows: The nucleotide sequence of the forward primer for specifically amplifying the hsa_circ_0014220 is shown in SEQ ID NO.2: TCAAACTGTCTTGGCTGTGG; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3: TTGGTGGAAGGTGTTGATGA; The nucleotide sequence of the forward primer for specifically amplifying the hsa_circ_0002387 is shown in SEQ ID NO.5: GCCACATATGATTTCAAGTTGGTGA; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6: CAGATGTATGCAATCCACTCCTCT.

[0013] The present invention also provides the use of the above circRNA marker in preparing a diagnostic product for breast cancer combined with depression.

[0014] As a preferred embodiment of the application of the present invention, the present invention provides a diagnostic kit for breast cancer combined with depression.

[0015] As a preferred embodiment of the application of the present invention, the above-mentioned kit includes primers for specifically amplifying any one of hsa_circ_0014220 and hsa_circ_0002387.

[0016] As a preferred embodiment of the application of the present invention, the primer sequences of the above-mentioned hsa_circ_0014220 are shown as SEQ ID NO.2 and SEQ ID NO.3; the primer sequences of the above-mentioned hsa_circ_0002387 are shown as SEQ ID NO.5 and SEQ ID NO.6.

[0017] As a preferred embodiment of the application of the present invention, the above-mentioned kit also includes an internal reference gene GAPDH, a reverse transcription PCR reagent and a real-time quantitative PCR detection reagent.

[0018] As a preferred embodiment of the application of the present invention, the forward primer and reverse primer of the internal reference gene GAPDH are as follows: Forward primer: ACAACTTTGGTATCGTGGAAGG (SEQ ID NO.7) Reverse primer: GCCATCACGCCACAGTTTC (SEQ ID NO. 8).

[0019] As a preferred embodiment of the application of the present invention, the reagents for detecting circRNA markers of breast cancer combined with depression by reverse transcription PCR at least include Anchored Oligo (dT) Primer, 2×TS Reaction Mix, TransScript RT / RI Enzyme Mix, gDNA Remover and RNase free ddH 2 O.

[0020] As a preferred embodiment of the application of the present invention, the reagents for detecting the circRNA markers for diagnosing breast cancer combined with depression by real-time quantitative PCR at least include 2×Mixnchored Oligo(dT) Primer, RNA, and gDNA Remover.

[0021] The kit of the present invention is simple and rapid to operate, has high detection sensitivity and specificity, can achieve quantitative and semi-quantitative detection of selected clinical samples, does not require other special instruments, has a long shelf life of clinical samples, and can be completed in general hospital laboratories or pathology rooms.

[0022] As a preferred embodiment of the application of the present invention, the preparation method of the above-mentioned kit comprises the following steps: (1) extracting total RNA from whole blood; (2) quantitative RNA reverse transcription; (3) real-time fluorescence quantitative PCR; (4) standardizing the expression level of circRNAs using the internal reference gene GAPDH.

[0023] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses circRNA as a biomarker for breast cancer combined with depression for the first time, and reveals the markers hsa_circ_001422 and hsa_circ_0002387 for diagnosing breast cancer combined with depression, providing an objective and reliable diagnostic biomarker for breast cancer combined with depression, avoiding the subjectivity and bias generated in previous diagnostic methods.

[0024] The circRNA markers for diagnosing breast cancer combined with depression provided by the present invention have high sensitivity and accuracy. In particular, compared with other depression-related circRNA markers, the circRNA markers of the present invention are specific for diagnosing depression in breast cancer patients, so that doctors can more clearly distinguish patients with breast cancer combined with depression from patients with breast cancer without depression, and then make early intervention according to the patient's condition, which is of great significance in the diagnosis, treatment and prevention of breast cancer combined with depression. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 2 shows the differential expression of the markers hsa_circ_001422 (Figure A) and hsa_circ_0002387 (Figure B) in whole blood of breast cancer patients with depression and breast cancer patients without depression. Indicates p<0.01.

[0026] Figure 2 Figure 3 is the correlation diagram between the expression levels of markers hsa_circ_001422 (Figure A) and hsa_circ_0002387 (Figure B) and the PHQ-9 scores of breast cancer patients.

[0027] Figure 3 Figure 2 shows the ROC curves of marker hsa_circ_001422 (Figure A) and marker hsa_circ_0002387 (Figure B). DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The illustrative embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0029] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is apparent to one of ordinary skill in the art that these specific details need not be employed to practice the present invention. In other embodiments, in order to avoid obscuring the present invention, well-known materials or methods are not specifically described.

[0030] Example 1 Screening of candidate circRNAs The applicant searched for circRNAs related to depression that have been documented in the past 10 years, using PubMed, Web of Science, ScienceDirect, and China National Knowledge Infrastructure. The search strategy was: (depression) AND (circRNAs); (mentalsickness) AND (circRNAs); (depression) AND (RNAs). A total of 32 circRNAs were collected: mmu_circRNA010860, mmu_circRNA002294, mmu_circRNA004239, mmu_circRNA002292, hsa_circRNA_103636, hsa_circRNA_002143, hsa_circRNA_1006 79. hsa_circRNA_104953, hsa_circRNA_103964, hsa_circRNA_104121, hsa_circRNA_100018, hsa_circRNA_103257, hsa_circRNA_104600, hsa_circRNA_102802, hsa_ci rcRNA_003251, hsa_circRNA_015115, hsa_circRNA_100918, hsa_circRNA_005019, circHIPK2, mmu_circ_0001223, rno_circRNA_014900, rno_circRNA_005442, circDY M. hsa_circ_0002387, hsa_circ_0014220, hsa_circ_0007334, hsa_circ_0025413, hsa_circ_0026463, hsa_circ_0069475, hsa_circ_0071253, hsa_circ_0008847, circ STGA1.

[0031] After excluding studies with no human samples or with less than 5 samples, 10 candidate circRNAs were obtained, namely circ DYM, hsa_circ_0002387, hsa_circ_0014220, hsa_circ_0007334, hsa_circ_0025413, hsa_circ_0026463, hsa_circ_0069475, hsa_circ_0071253, hsa_circ_0008847 and circ STGA1. All of the above candidate molecules are circRNAs differentially expressed in human peripheral blood.

[0032] Example 2 Verification of candidate circRNA 1. Sampling The circRNA sequencing data and corresponding clinical information used in the present invention come from the cubital venous blood of 164 breast cancer patients collected from the Breast Center of the Fourth Hospital of Hebei Medical University from March 2021 to September 2022. Written informed consent was obtained from all participants.

[0033] Patient Health Questionnaire-9 (PHQ-9) depression scale was used to evaluate breast cancer patients. PHQ-9 is a nine-item self-test tool compiled by Columbia University in the 1990s based on the nine symptom criteria of DSM-IV depression. PHQ-9 has been widely used in clinical practice in recent years due to its advantages such as being easy to understand, easy to operate, and easy to master. It is one of the internationally used depression detection scales and is also the designated depression screening scale in the "Work Plan for Exploring Characteristic Services for Depression Prevention and Treatment" released on the official website of the National Health Commission.

[0034] PHQ-9 consists of 9 items, each of which consists of 4 options, namely not at all, several days, more than 1 week, and almost every day, with corresponding scores of 0, 1, 2, and 3, respectively. The total score is 27 points. The higher the score, the greater the possibility of depression. Among them, 0-4 points are no depressive symptoms; 5-9 mild depression; 10-14 moderate depression; 15-19 moderate to severe depression; 20-27 severe depression.

[0035] After evaluation, it was found that among the 164 breast cancer patients mentioned above, 18 had breast cancer and depression, and 146 had breast cancer without depression.

[0036] 2. Total RNA extraction from samples TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) was used to extract RNA from samples. The experimental operation was carried out according to the product instructions. The specific operation is as follows: (1) Take 250 uL of whole blood sample, add 750 uL of TRIzol, vortex to mix, and let stand at room temperature for 10 min; (2) Add 200 μL of chloroform, vortex to mix, and let stand at room temperature for 10-15 min; (3) After centrifugation at 4°C and 12,000 rpm for 15 min, aspirate 300-500 μL of supernatant and transfer it to a new nuclease-free centrifuge tube; add 500 μL of isopropanol, gently invert to mix, and let stand at room temperature for 10 min; (4) After centrifugation at 4°C and 12,000 rpm for 10 min, discard the supernatant, add 1,000 μL 75% anhydrous ethanol to wash the precipitate, and slowly invert to mix; centrifuge at 4°C and 8,000 rpm for 5 min; (5) Discard the ethanol liquid and keep the precipitate; air dry at room temperature / vacuum dry for 2-5 min; add 25-50 μL DEPC water / nuclease-free water to dissolve the precipitate and let it stand at room temperature for 2-5 min; (6) Use NanoDropOne spectrophotometer to measure the concentration of the extracted RNA sample and freeze it at -80°C. Sample requirements for RNA-seq sequencing: OD260 / OD280 is 1.8-2.0.

[0037] 3. cDNA Synthesis (1) RNA reverse transcription The extracted total RNA, 5X gDNA removal buffer, gDNA removal agent, RNaseFree H 2 O to obtain a mixed solution; the obtained mixed solution is placed in a PCR instrument to remove gDNA; and reverse transcription is performed.

[0038] The reverse transcription system is as follows: For first-strand cDNA synthesis and gDNA removal, add the following reagents:

[0039] (2) After mixing the above mixture, use Bio-Rad T-100 gradient PCR instrument to carry out the reaction. The reaction conditions are as follows:

[0040] 4. Real-Time PCR detection of candidate circRNA expression levels (1) Instruments and analytical methods The Bio-Rad CFX96 fluorescence quantitative PCR instrument was used to analyze the ROC curve and correlation analysis to determine the diagnostic value of candidate circRNA for breast cancer combined with depression.

[0041] (2) Primer design Online primer design software was used, the gene sequence was referenced to the sequence provided by CircBase, GAPDH was selected as the internal reference, and the primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0042] The nucleotide sequence of hsa_circ_0014220 is shown in SEQ ID NO. 1, the nucleotide sequence of the forward primer is: TCAAACTGTCTTGGCTGTGG (SEQ ID NO. 2); the nucleotide sequence of the reverse primer is: TTGGTGGAAGGTGTTGATGA (SEQ ID NO. 3).

[0043] The nucleotide sequence of hsa_circ_0002387 is shown in SEQ ID NO. 4, the nucleotide sequence of the forward primer is GCCACATATGATTTCAAGTTGGTGA (SEQ ID NO. 5); the nucleotide sequence of the reverse primer is CAGATGTATGCAATCCACTCCTCT (SEQ ID NO. 6).

[0044] The primer sequences for the internal reference GAPDH are as follows: Forward primer: ACAACTTTGGTATCGTGGAAGG (SEQ ID NO. 7) Reverse primer: GCCATCACGCCACAGTTTC (SEQ ID NO. 8) (3) PCR amplification to detect the expression level of the target gene cDNA, premix, RNase Free H 2 O, the upstream primer and the downstream primer are mixed to obtain a mixed solution, and the mixed solution is placed in a fluorescence quantitative PCR instrument for fluorescence quantification.

[0045] The real-time PCR reaction system is configured as follows:

[0046] TransStart® Top Green qPCR SuperMix (Beijing Quanshijin, Cat. No. AQ131) was used to amplify the target gene primers and the internal reference gene primers. The experimental operation was carried out according to the product instructions. The amplification program was: 95℃5min, (94℃ 30sec, 94℃ 5sec, 60℃ 30sec)×39 cycles. At the same time, melting curve analysis was performed at 60-95℃ (95℃ 15s, 60℃ 1min, 95℃ 15s, 60℃ 15s).

[0047] (4) The expression of circRNA was normalized using the internal reference GAPDH, and the relative expression level of circRNAs was calculated using 2 -△△Ct Method calculation.

[0048] 5. Test data analysis Statistical analysis was performed using GraphPad Prism 9 software. The rank sum test was used to analyze the differences between the two groups. Receiver operating characteristic (ROC) curve analysis was used to determine the diagnostic value of circ RNA. Two-tailed P < 0.05 was considered statistically significant.

[0049] 6. Results (1) Differential expression of markers hsa_circ_0014220 and hsa_circ_0002387 Fluorescence quantitative PCR was used to verify the differential expression of candidate circRNAs in breast cancer patients with depression and breast cancer patients without depression. Figure 1 As shown, the expression of hsa_circ_0014220 (Figure A) and hsa_circ_0002387 (Figure B), as potential biomarkers, in breast cancer patients with depression was significantly higher than that in breast cancer patients without depression, and the expression was statistically significant (p<0.05).

[0050] (2) Diagnostic value of hsa_circ_0014220 and hsa_circ_0002387 ROC curve analysis was used to calculate the area under the receiver operating characteristic curve (AUC), sensitivity, and specificity to detect the diagnostic efficacy of differentially expressed circRNAs. The closer the AUC is to 1, the better the diagnostic value is considered. Generally, AUC>0.5 is considered to have diagnostic value. The point level corresponding to the maximum Youden index = (sensitivity + specificity - 1) was selected as the optimal cutoff value to determine specificity and sensitivity.

[0051] The results showed that either hsa_circ_0014220 or hsa_circ_0002387, as potential biomarkers, could distinguish breast cancer patients with depression from breast cancer patients without depression. The AUCs of hsa_circ_001422 and hsa_circ_0002387 were 0.93 and 0.93, respectively. Figure 2 ). The sensitivity and specificity of hsa_circ_001422 were 87% and 94%, p=0.0001313, and hsa_circ_0002387 were 94% and 88%, p=0.0001313.

[0052] (3) Relationship between the expression levels of hsa_circ_0014220 and hsa_circ_0002387 and the severity of depression The expression levels of markers hsa_circ_0014220 and hsa_circ_0002387 were correlated with the PHQ-9 scores of breast cancer patients ( Figure 3 ), it can be seen that the Pearson correlation between hsa_circ_0014220 and PHQ-9 expression levels (r) = 0.357, p < 0.0001; the Pearson correlation between hsa_circ_0002387 and PHQ-9 expression levels (r) = 0.27, p < 0.0001. This indicates that the expression levels of hsa_circ_0014220 and hsa_circ_0002387 are positively correlated with the PHQ-9 scores of patients with breast cancer and depression, that is, the higher the expression levels of hsa_circ_0014220 and hsa_circ_0002387, the higher the PHQ-9 depression scale score.

[0053] Example 3 Based on the primer sequences for RT-PCR listed in Example 2 above, a kit for diagnosing breast cancer combined with depression was assembled, the kit comprising any one of the forward primer solution and reverse primer solution of hsa_circ_0014220 and hsa_circ_0002387 above, and also comprising a forward primer and a reverse primer for the internal reference gene GAPDH, a reverse transcription PCR reagent and a timed quantitative PCR reagent.

[0054] The reagents for detecting circRNA markers of breast cancer combined with depression by reverse transcription PCR at least include AnchoredOligo(dT) Primer, 2×TS Reaction Mix, TransScript RT / RI Enzyme Mix, gDNA Remover and RNase free ddH 2 O.

[0055] The reagents for detecting circRNA markers of breast cancer combined with depression by timed quantitative PCR include 2×Mixnchored Oligo(dT) Primer, RNA, and gDNA Remover.

[0056] The preparation process of the kit is as follows: (1) extracting total RNA from whole blood; (2) quantitative RNA reverse transcription; (3) real-time fluorescence quantitative PCR; (4) standardizing the expression level of circRNAs using the internal reference gene GAPDH. For details, refer to Example 1.

[0057] The subjects are breast cancer patients who have not been diagnosed with depression. The test results can have good predictive and diagnostic capabilities for their depressive state, which is helpful for the clinical prediction and identification of breast cancer combined with depression, and provides theoretical, practical basis and auxiliary indicators for early warning intervention of mental health problems in special populations; it provides therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy.

[0058] Finally, it should be noted that although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A circRNA marker for diagnosing breast cancer combined with depression, characterized in that: The marker is hsa_circ_0014220 or hsa_circ_0002387; The nucleotide sequence of hsa_circ_0014220 is shown in SEQ ID NO. 1; The nucleotide sequence of hsa_circ_0002387 is shown in SEQ ID NO.

4.

2. The primer combination of the circRNA marker according to claim 1, characterized in that: The primer sequences for specifically amplifying the hsa_circ_0014220 are shown in SEQ ID NO. 2 and SEQ ID NO. 3; the primer sequences for specifically amplifying the hsa_circ_0002387 are shown in SEQ ID NO. 5 and SEQ ID NO.

6.

3. Use of the circRNA marker according to claim 1 in the preparation of a diagnostic product for breast cancer combined with depression.

4. A diagnostic kit for breast cancer combined with depression, characterized in that: Primers that specifically amplify either hsa_circ_0014220 or hsa_circ_0002387 are included.

5. The kit according to claim 4, characterized in that The primer sequences for specifically amplifying the hsa_circ_0014220 are shown in SEQ ID NO. 2 and SEQ ID NO.

3.

6. The kit according to claim 4, characterized in that The primer sequences for specifically amplifying the hsa_circ_0002387 are shown in SEQ ID NO. 5 and SEQ ID NO.

6.

7. The kit according to claim 4, characterized in that The internal reference gene GAPDH was also included.

8. The kit according to claim 7, characterized in that The primer sequences of the internal reference gene GAPDH are shown in SEQ ID NO. 7 and SEQ ID NO. 8.

Images