CRISPR / Cas9 recombinant plasmid entrapped PLGA (poly (lactic-co-glycolic acid)) nanoparticle as well as preparation and application thereof

Abstract

The invention provides PLGA (poly (lactic-co-glycolic acid)) nanoparticles entrapped with CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR The preparation method comprises the following steps: firstly designing sgRNA and constructing an SPP1-sgRNA / Cas9 recombinant plasmid, then forming a CaP / Cas9 compound by the recombinant plasmid and calcium phosphate through electrostatic interaction, and finally, wrapping the CaP / Cas9 compound in a polylactic acid-glycolic acid copolymer carrier to construct the nanoparticles capable of being aerosol inhaled. The nanoparticles have good biocompatibility, the transfection efficiency of a gene therapy plasmid cell strain is high, the expression effect is stable, the SPP1 gene can be accurately knocked out in pulmonary epithelial cells, and pulmonary fibrosis can be effectively relieved. The invention has clinical transformation application value in treatment of pulmonary fibrosis diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a PLGA nanoparticle encapsulating a CRISPR / Cas9 recombinant plasmid, a preparation method thereof, and an application thereof in preventing idiopathic pulmonary fibrosis. Background Art

[0002] Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal interstitial lung disease characterized by alveolar epithelial cell damage, overactivation of fibroblasts, excessive accumulation of lung extracellular matrix (ECM), and irreversible decline in lung function. Approximately 5 million people worldwide suffer from IPF, with an average median survival of 3 to 5 years after diagnosis. Environmental factors, drug side effects, aging and genetics are known to cause IPF, but the underlying mechanisms of disease pathology are still unclear. Currently, nintedanib and pirfenidone have been approved by the FDA for the treatment of IPF patients, which can slow the progression of the disease to a certain extent. However, in clinical practice, they have poor selectivity, obvious side effects, and cannot significantly prolong the survival rate of patients to meet clinical needs. According to the American Thoracic Society and the European Respiratory Society, there are currently no other proven treatments for IPF except oxygen therapy and lung transplantation. Therefore, it is necessary to develop new drug products to improve the clinical benefits of IPF patients.

[0003] The relationship between osteopontin (OPN, expressed by the SPP1 gene) and the mechanism of pulmonary fibrosis is one of the focuses of recent research. OPN is a highly phosphorylated sugar phosphoprotein that has multiple biological functions, including regulating cell adhesion, chemotaxis, and tissue repair processes. Under physiological conditions, the expression of OPN in adult lung tissue is mainly limited to macrophages, bronchioles, fibroblasts, and endothelial cells, and the expression level is low. In the inflammatory environment of the lung, cytokines such as monocyte colony stimulating factor (MCSF), IL-6, IL-1β, and IL-33 upregulate the expression of SPP1, further causing damage to alveolar epithelial cells, which is a key feature of the development of pulmonary fibrosis. In the process of pulmonary fibrosis formation, OPN plays a key role in the activation of cells such as lung epithelial cells and fibroblasts, leading to the abnormal accumulation of extracellular matrix (ECM) in lung tissue, which is crucial for the progression of pulmonary fibrosis. To prove the relationship between OPN and the development of IPF, the study found that SPP1 was the most significantly upregulated gene in IPF lungs, with SPP1 levels increased by more than 20 times. At the same time, the expression of OPN in lung tissue and bronchoalveolar lavage fluid (BALF) was also significantly increased, and this increase was associated with the severity of fibrosis. Studies have reported that the loss of SPP1 can improve bleomycin-induced dermal fibrosis and carbon nanotube-induced pulmonary fibrosis, and the loss of SPP1 reduces the upregulated expression of type 1 collagen and MMP2. Therefore, downregulating SPP1 to treat IPF may provide a new gene therapy strategy for IPF.

[0004] CRISPR / Cas9 gene editing technology can manipulate genes at the molecular level. It has the advantages of simple design, easy operation, good specificity and high efficiency. It has rapidly become a powerful strategy with great prospects in a wide range of biomedical applications. The CRISPR / Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein 9) is a powerful and prominent tool for manipulating genetic information in mammalian cells. It greatly simplifies the genome editing procedure by using single guide RNA (sgRNA) to recognize target DNA and using the nuclease activity of Cas9 to introduce site-specific double-strand breaks (DSBs) at the target gene site. However, in order to effectively achieve genome editing, it is crucial to deliver the CRISPR / Cas9 system to the target organ or cell. Viral vectors are the most commonly used delivery vectors for the CRISPR / Cas9 system, but viral vectors have limited loading capacity and may cause harmful immunogenicity and mutations in the host, limiting their application. Compared with viral vectors, non-viral vectors have the advantages of strong encapsulation capacity, low immunogenicity, and no endogenous viral recombination. Although the delivery efficiency is low, it is the most promising delivery method for in vivo administration. Therefore, many researchers have devoted themselves to designing and developing safe and efficient non-viral delivery systems.

[0005] Considering the particularity of lung tissue, delivering CRISPR / Cas9 therapeutic agents directly to the lungs through the pulmonary route is expected to treat a series of respiratory diseases, such as pulmonary fibrosis and lung injury. Aerosol inhalation is a promising delivery strategy that can improve the targeting efficiency and retention time interval of nanoparticles in lung tissue, thereby increasing the therapeutic index while reducing the effective dose. The present invention uses PLGA as a carrier to design a new type of aerosol inhalable CRISPR / Cas9 drug delivery system (CaP / Cas9 / PLGA) to deliver Cas9 plasmids, and found that SPP1 can be downregulated to alleviate pulmonary fibrosis, providing a new treatment idea for pulmonary fibrosis. Summary of the invention

[0006] The object of the present invention is to provide a PLGA nanoparticle encapsulating a CRISPR / Cas9 recombinant plasmid. The PLGA nanoparticle encapsulating the CRISPR / Cas9 recombinant plasmid (SEQ ID NO.1) has a particle size of 150 nm.

[0007] The second object of the present invention is to provide a method for preparing the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid, which is achieved by the following steps:

[0008] (1) Construction of a CRISPR-Cas9 recombinant plasmid (Cas9) capable of targeted knockout of the SPP1 gene: designing sgRNA according to the selected SPP1 gene, annealing the designed sgRNA, digesting the backbone plasmid (SEQ ID NO.2), and then connecting the sgRNA with the digested plasmid to construct an SPP1-sgRNA / Cas9 recombinant plasmid (Cas9);

[0009] (2) reacting calcium nitrate and diammonium hydrogen phosphate to produce a calcium phosphate solution (CaP), then mixing CaP and Cas9, stirring at low temperature for 5 minutes, and ultrafiltration to obtain a CaP / Cas9 complex (CaP / Cas9);

[0010] (3) dissolving the carrier material polylactic acid-glycolic acid copolymer (PLGA) in dichloromethane, adding the CaP / Cas9 solution to the carrier material solution, and ultrasonicating in an ice bath to prepare a water-in-oil colostrum solution;

[0011] (4) adding 2% polyvinyl alcohol (PVA) aqueous solution to the colostrum solution, and ultrasonicating in an ice bath to obtain a water-in-oil-in-water emulsion solution;

[0012] (5) The latex solution was poured into a 0.1% PVA aqueous solution and stirred at 250 rpm for 6 hours at room temperature to solidify the microspheres. Finally, the nanoparticles were collected by centrifugation at 4°C to obtain PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid.

[0013] The sgRNA sequence designed in step (1) is gcagaatctccttgcgccacagg; Synthesize the designed sgRNA and its complementary sequence, and add restriction sites at the beginning and end. The synthetic sequence is: SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO.3) SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO.4) In step (1), the sgRNA annealing temperature gradient was set as follows: 95°C, 10 min; 95°C-85°C, 2.5°C / s; 85°C-25°C, 0.25℃ / s; 25℃, 5min.

[0014] The enzyme digestion conditions of BpiI in step (1) are 37°C for 2h.

[0015] In step (1), the conditions for connecting the sgRNA and the digested plasmid are 16°C for 30 min.

[0016] Preferably, the mass ratio of calcium nitrate to hydrogen phosphate in step (2) is 1:1.

[0017] Preferably, the mass ratio of CaP and Cas9 in step (2) is 1:32.

[0018] The pore size of the ultrafiltration tube in step (2) is 100Kda.

[0019] Preferably, the molar ratio of the two monomers of polylactic acid and glycolic acid in the copolymer of step (3) is 50:50, that is, the polylactic acid glycolic acid segment is composed of 50% lactic acid and 50% glycolic acid (ie, PLGA50 / 50).

[0020] Preferably, the molecular weight of the polyethylene glycol in the copolymer in step (3) is 38000-54000 Da.

[0021] Preferably, the mass ratio of the Cas9 plasmid solution to the polyethylene glycol-polylactic acid-glycolic acid copolymer in step (3) is 1:20.

[0022] Preferably, the ultrasonic treatment conditions in step (4) are: using an ultrasonic cell disruptor at a power of 195 W for 3 minutes in an ice bath to form colostrum.

[0023] Preferably, the mass percentage of polyvinyl alcohol in the polyvinyl alcohol aqueous solution in step (4) is 2%, and the mass percentage of polyvinyl alcohol in the polyvinyl alcohol aqueous solution in step (5) is 0.1%. This concentration is the minimum effective emulsification concentration of polyvinyl alcohol. If the concentration is lower than this concentration, the emulsification effect is insufficient and it is easy to cause microspheres to stick together and form poorly. If the concentration is too high, it is easy to cause drug leakage and reduce drug loading.

[0024] The third object of the present invention is to provide the use of the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid in the preparation of a drug for preventing or treating idiopathic pulmonary fibrosis. The application is that the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid are delivered to the lesions of pulmonary fibrosis by atomization of the Cas9 plasmid, gene editing is performed, disease-related genes are knocked down, fibrosis is alleviated, and normal lung cell death is reduced. The nanoparticles of the present invention have uniform particle size distribution, good dispersibility, good ability to transfect lung epithelial cells, can be effectively delivered across the mucosa to the fibrotic lung, and after being internalized by lung cells, no cytotoxicity is induced. After escaping the endosome / lysosome chamber, Cas9 effectively triggers the editing of the SPP1 gene with an efficiency of more than 30%, resulting in a decrease in the expression of OPN. In addition, in a mouse model of bleomycin-induced pulmonary fibrosis, CaP / Cas9 / PLGA significantly reduced the development of fibrosis and improved lung function, alleviated bleomycin-induced pulmonary fibrosis, and had high safety and few side effects.

[0025] The fourth object of the present invention is to provide the use of the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid in the preparation of a drug for alleviating TGF-β1-induced pulmonary fibrosis.

[0026] The drug dosage form prepared by the present invention is a liquid preparation, preferably an atomizer, and the dosage is: atomization once every 3 days, with a dosage of 2 mg / kg.

[0027] Beneficial effects of the present invention: (1) The plasmid-based CRISPR / Cas9 system has higher stability and is the simplest and most efficient system than the system combining Cas9 mRNA and protein; the present invention successfully constructed a CRISPR / Cas9 plasmid (Cas9) that can target and knock out the spp1 gene. (2) In order to achieve aerosol inhalation, mucus penetration, improve the safety of gene editing, and reduce local inflammatory reactions, the FDA-approved biodegradable and non-immunogenic polylactic-co-glycolic acid (PLGA) material is used as a delivery carrier for Cas9 to achieve efficient and safe knockout of the target gene, while improving transfection efficiency and achieving non-toxicity. (3) In order to improve the encapsulation rate, stability and efficient intracellular lysosomal escape of Cas9, calcium phosphate (CaP) is used to concentrate Cas9 to form a Cas9 complex (CaP / Cas9) to control their physicochemical properties (surface charge), thereby facilitating smooth delivery and rapid lysosomal escape (proton sponge effect). (4) An in vivo mouse pulmonary fibrosis model was constructed and H&E staining, MASSON staining, immunofluorescence staining, TGF-β1 content determination, IL-1β content determination, hydroxyproline content determination, SPP1 protein expression level detection, and T7EI cleavage detection were used. Wound healing experiments, Transwell migration experiments, and protein immunoblotting experiments were used for in vitro verification. The in vitro and in vivo results showed that CRISPR / Cas9 has a good therapeutic effect on pulmonary fibrosis and has a wide range of application scenarios in the fields of biotechnology and medical technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The morphology and size distribution of PLGA nanoparticles (CaP / Cas9 / PLGA) encapsulating CRISPR / Cas9 recombinant plasmid before and after atomization.

[0029] Figure 2 It is the zeta potential analysis during the preparation process of CaP / Cas9 / PLGA.

[0030] Figure 3 It is the Cas9 encapsulation efficiency of PLGA nanoparticles prepared without CaP (Cas9 / PLGA) and CaP / Cas9 / PLGA nanoparticles before and after atomization.

[0031] Figure 4 It is an in vitro release behavior analysis of Cas9 / PLGA and CaP / Cas9 / PLGA under different pH conditions.

[0032] Figure 5 Agarose gel electrophoresis was used to examine resistance to nuclease degradation.

[0033] Figure 6 This is the cell viability analysis of different cells co-cultured with different concentrations of CaP / Cas9 / PLGA for 48 hours.

[0034] Figure 7 It is a study on the cellular uptake mechanism of CaP / Cas9 / PLGA.

[0035] Figure 8 It is the evaluation of the intracellular lysosomal escape performance of CaP / Cas9 / PLGA.

[0036] Fig. 9 This is the transfection fluorescence image of CaP / Cas9@PLGA.

[0037] Fig.10 is the protein expression level of SPP1.

[0038] Fig.11 is the cleavage rate of SPP1 gene by CaP / Cas9@PLGA in cells.

[0039] Fig.12 This is a cell scratch experiment of CaP / Cas9@PLGA on TGFβ1-induced MLE12 cells.

[0040] Fig.13 This is a cell migration experiment of CaP / Cas9@PLGA on TGFβ1-induced MLE12 cells.

[0041] Fig.14 is the expression level of ACTA2 and COL1A1 proteins.

[0042] Fig.15 The distribution of Did-labeled CaP / Cas9@PLGA nanoparticles in the mouse body, major organs, and lung lobes.

[0043] Fig.16 This is the co-localization immunofluorescence result of Did-labeled CaP / Cas9@PLGA nanoparticles (using cy5 wavelength) and SFTPC-labeled type II lung epithelial cells.

[0044] Fig.17 are the body weight changes and mouse survival rate during CaP / Cas9@PLGA treatment.

[0045] Fig.18These are optical images of the lungs of IPF mice after CaP / Cas9@PLGA acted on them, HE staining of lung sections, Masson staining, and immunohistochemical analysis of OPN protein.

[0046] Fig.19 It is the content of IL-1β, TGF-β1, and HYP after CaP / Cas9@PLGA acted on IPF mice.

[0047] Fig. 20 It is the T7EI cleavage of the heart, liver, spleen, lung and kidney of IPF mice after CaP / Cas9@PLGA acted on them, as well as the T7EI cleavage of the lung tissue in different dosing groups.

[0048] Fig.21 The protein expression levels of ACTA2, COL1A1, and SPP1 in lung tissues of IPF mice after CaP / Cas9@PLGA acted on them.

[0049] Fig. 22 The main organs of mice in each group were analyzed by H&E staining on the 21st day after CaP / Cas9 / PLGA treatment.

[0050] Fig.23 Figure 2. Serum and blood biochemical analysis of mice after CaP / Cas9 / PLGA treatment. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the protection content of the present invention is not limited to the following embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention, and the attached claims are the scope of protection. The process, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention does not specifically limit the content.

[0052] Example 1: Preparation and characterization of CaP / Cas9 / PLGA nanoparticles

[0053] Preparation method: Construction of SPP1-sgRNA / Cas9 recombinant plasmid: Construction of CRISPR-Cas9 plasmid (Cas9) that can target and knock out the SPP1 gene. The plasmid used in this article is CMV-Cas9-P2A-GFP-P2A-luciferase-pA-U6-gRNA. The targets of all candidate genes were designed through the online tool platform of Zhang Feng's laboratory (http: / / chopchop.cbu.uib.no / ). The designed sgRNA sequence is gcagaatctccttgcgccacagg; The designed sgRNA and its complementary sequence were synthesized, and restriction sites were added at the beginning and end. The synthetic sequences of the SPP1 gene targeting site and sgRNA oligonucleotide sequence are: SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO.3), SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO.4), The annealed oligonucleotides were cloned into the CMV-Cas9 plasmid via the BbsI restriction site. For annealing and cloning procedures, please refer to the Zhang Lab website (www.genomeengineering.org). The constructed plasmid was transfected into DH-5ɑ E. coli and inoculated into LB liquid medium with ampicillin added after autoclaving. The culture medium was incubated at 37°C and 200 r / min. -1 After culturing for 12 to 16 hours, a single colony was formed. A single colony was picked to expand the culture and the plasmid was extracted. Sequencing confirmed that the plasmid was successfully constructed and named SPP1-sgRNA / Cas9 recombinant plasmid (Cas9).

[0054] Preparation of CaP / Cas9 / PLGA nanoparticles: 105 μL (31.25 mM) calcium nitrate and 105 μL (18.7 mM) diammonium hydrogen phosphate were mixed in an EP tube, and the mixture was dropped into 10 μL (1000 ng / μL) Cas9 plasmid, vortexed, and cooled on ice for 5 min to obtain a CaP / Cas9 complex. 1 mL of 20 mg / mL PLGA in dichloromethane (DCM) was taken, and the above CaP / Cas9 complex was added and vortexed to mix. In order to form an emulsion, the organic phase was added to an aqueous solution (2% PVA) and ultrasonically treated at 195w for 3 minutes. The resulting emulsion was then added to a 0.1% PVA aqueous solution and stirred at 250 rpm for 6 hours at room temperature to solidify the microspheres. Finally, the nanoparticles were collected by centrifugation at 4°C. The amount of CaP / Cas9 and PLGA can be proportionally enlarged as needed.

[0055] Experimental results: CaP / Cas9 / PLGA nanoparticles were successfully prepared, and the morphology and size distribution of the obtained CaP / Cas9 / PLGA nanoparticles and the CaP / Cas9 / PLGA nanoparticles after atomization by a nebulizer needle were characterized by transmission electron microscopy (TEM) and dynamic light scattering (DLS), respectively. The encapsulation efficiency was calculated by measuring the absorbance at 260nm using a microplate reader (Thermo scientific, Multiskan GO1050). The release behavior of Cas9 was investigated under pH 5.0 and pH 7.4 conditions. Whether PLGA NPs have a protective effect on plasmids was verified.

[0056] like Figure 1 As shown in the figure, CaP / Cas9 / PLGA nanoparticles are spherical, compact, and have a particle size of about 150nm. The morphology of the nanoparticles remains unchanged before and after atomization, indicating that the severe shear force generated during atomization will not change the size and morphology of the nanoparticles. CaP / Cas9 / PLGA has good stability and suitable rigidity, which can meet the quality of the preparation for atomized inhalation. In addition, the DLS results show that the particle size is similar to the TEM results.

[0057] like Figure 2 As shown in the figure, Zeta potential analysis showed that there was no significant change in the potential of CaP / Cas9 / PLGA before and after atomization, and the stability was good. 2+ It can combine with negatively charged Cas9 in the form of electrostatic adsorption to form a CaP / Cas9 complex and condense Cas9. The encapsulation of CaP can reduce the negative charge of PLGA itself, which is conducive to the adsorption of plasmids on it.

[0058] like Figure 3 As shown in the figure, the encapsulation efficiency of PLGA for Cas9 [(44.20±8.44)%] was significantly higher than that of Cas9 / PLGA [(6.66±2.34)%] by introducing calcium phosphate, indicating that the drug loading capacity of PLGA can be increased by introducing CaP. There was no significant difference in the encapsulation efficiency of plasmids in NPs before and after atomization (44.2% vs 39.66%).

[0059] like Figure 4As shown in the figure, pH 5.0 and pH 7.4 media were selected to simulate the conditions in cells and blood to investigate the release of Cas9. The release results are shown in the figure. Under the two pH conditions, the release of Cas9 by Cas9 / PLGA was less than 10 ng / μL in 48 hours. The release of Cas9 by CaP / Cas9 / PLGA was less than 10 ng / μL in 48 hours under pH 7.4 conditions, while under pH 5.0 conditions, the release of Cas9 was significantly improved, reaching a release amount of nearly 50 ng / μL. The results show that CaP / Cas9 / PLGA has pH-responsive release characteristics, which is particularly helpful for drug delivery and controlled release in weakly acidic cells, and is beneficial to enhancing anti-fibrosis effects and reducing toxic side effects.

[0060] like Figure 5 As shown, Cap / Cas9 / PLGA (lane 4) and free Cas9 (lane 2) were incubated with DNase I and then subjected to agarose gel electrophoresis. At the same time, a plasmid group without DNase I was set up (lane 3). The results were ( Figure 5 ) found that PLGA was able to protect the plasmid from being degraded by DNase I (lane 4) and there was no significant difference between the control group (lane 3), while the plasmid without PLGA protection was completely degraded (lane 2).

[0061] Example 2: In vitro evaluation of CaP / Cas9 / PLGA nanoparticles

[0062] Cytotoxicity assay: 293T, A549, MLE12, and AML12 cells were cultured at 1×10 4 The cells were seeded in a 96-well plate at a density of 10 cells per well and incubated overnight. They were incubated with different doses of NPs for 48 h. Untreated cells were used as blank controls. Then, the culture medium was discarded, and serum-free culture medium containing 10 μL of CCK8 solution was added to each well, followed by incubation at 37 °C for 2 h. The absorbance (OD) value of each well was measured at 450 nm using a microplate reader to calculate relative cell viability.

[0063] Cell uptake mechanism test: 1×10 5MLE12 cells were inoculated in 24-well plates and cultured for 24 hours. The culture medium containing different endocytic pathway inhibitors was first added and incubated with the cells for 2 hours, including methyl-β-cyclodextrin (β-CD, 50μM), 5-(N-ethyl-N-isopropyl) amiloride (EIPA, 30nM), chlorpromazine (CPZ, 30μM), and bafilomycin (Baf1, 200nM). CPZ can inhibit clathrin-mediated endocytosis; β-CD can inhibit caveolae-mediated endocytosis; Baf1 inhibits proton pump-mediated cellular uptake; EIPA can inhibit cell endocytosis; there is also a 4℃ treatment group; the normal 37℃ transfection treatment group (without any inhibitor) was used as a positive control. Then, CaP / Cas9 / PLGA (Cas9 plasmid was labeled with YOYO-1) was added to the cells treated as above for transfection. After 1 h, 3 h or 6 h, the uptake of nanoparticles by cells was observed by fluorescence microscopy, and the fluorescence intensity was quantitatively analyzed using Image J software. The mean fluorescence intensity (MFI) of cells in each group was quantitatively analyzed by flow cytometry.

[0064] Endosomal escape: The uptake of CaP / Cas9 / PLGA in MLE12 cells was evaluated by confocal laser scanning microscopy (CLSM, LSM-810, Carl Zeiss, Germany). The Cas9 plasmid was labeled with the green fluorescent dye YOYO-1 to track the delivery in the cell in real time. Lysosomes in the cell were labeled with the red fluorescent dye Lysotracker, and the cell nucleus was labeled with the blue fluorescent dye Hoechst 33342. After CaP / Cas9 / PLGA NPs were transfected into cells for different times (1, 3, and 6 h), the process of cell uptake, nanoparticle lysosomal escape, and plasmid entry into the cell nucleus was observed and recorded under a laser confocal microscope. The excitation (Ex) and emission (Em) wavelengths of the fluorescent dyes are as follows: Hoechst 33342 (Ex: 350 nm, Em: 440 nm), YOYO-1 (Ex: 491 nm, Em: 509 nm) and Lysotracker (Ex: 577 nm, Em: 590 nm).

[0065] In vitro transfection experiment: MLE12 cells were cultured at 5×10 4The cells were seeded in a 48-well plate at a density of 10 cells / well and cultured overnight. The transfection experiment was performed after the cells adhered. During transfection, the positive control vector Lipofectamine 3000 was first mixed with an appropriate amount of Cas9 in nuclease-free deionized water at room temperature for 30 minutes. Then the positive control sample and CaP / Cas9 / PLGA NPs were mixed with culture medium without fetal bovine serum, respectively, and added to the cells for culture. After 6 hours of culture in the incubator, the old liquid was aspirated and replaced with full culture medium supplemented with 10% FBS. After incubation for 48 hours, the culture medium was removed, the cells were gently rinsed with PBS, and then the expression of EGFP in the cells was observed under a fluorescence microscope. The cells were collected and the proportion of EGFP-positive cells was detected by flow cytometry.

[0066] Western blotting (WB): Cells were lysed with RIPA buffer (Beyotime, Nanjing, China) and proteins were extracted from the cells. BCA protein assay kit (Beyotime) was used to quantify proteins. SDS-PAGE was used to separate proteins. Proteins were transferred to 0.45 μm PVDF membranes, blocked with 5% milk, and then incubated with primary antibodies diluted in TBST. SPP1, COL1A1, ACTA2, β-actin, and GAPDH antibodies were from Huaan Bio, abclonal, and Proteintech, respectively. Then, HRP-conjugated secondary antibodies (Proteintech, China) were incubated at room temperature for 1 h and the membranes were washed. Proteins were visualized using BeyoECL Plus (Ultrasensitive ECL Chemiluminescence Kit) and used for further analysis after imaging.

[0067] T7EI experiment: The destruction efficiency of the SPP1 gene locus was studied by T7EI experiment. According to the standard method provided by the reagent manufacturer, the transfected cells and tissues were harvested, and the genomic DNA in the cells and lung tissues was extracted using the universal genomic DNA extraction kit (Vazyme, China). The target genomic region was amplified by polymerase chain reaction (PCR) using primers (SEQ ID NO.5, SEQ ID NO.6), and then purified using the PCR / gel extraction and purification kit (Vazyme, China) according to the instructions. 200 ng of PCR product was used for T7E1 detection, and the kit (NEB, USA) was used for DNA denaturation annealing. After annealing, 0.5 μL of T7EI enzyme was added to the system for enzyme digestion reaction at 37°C for 30 min. The DNA products were analyzed by 2% agarose gel electrophoresis and imaged using a gel recording system (c150, AzureBiosystems, USA). The grayscale values ​​of the uncut and cut bands were calculated using ImageJ software to analyze the insertion and deletion rate. Indel (%) analysis was calculated using the following formula: Indel (%) = [1-(1-fraction cleaved) 1 / 2] × 100%, "fraction cleaved" refers to the intensity ratio of the grayscale of each cleaved band relative to the intensity of the cleaved band and the uncleaved band. To detect gene mutations in the lung, the tissue of the transfected lung area was first homogenized and further analyzed according to the above protocol.

[0068] Wound-healing assay: 1.0×10 5 MLE12 was seeded into 24-well plates at a density of 10 cells, induced with 10 ng / mL TGF-β1, and cultured to 90% confluence in DMEMF12 medium containing 10% FBS and 1% penicillin-streptomycin. The cells were cultured with CaP / Cas9 / PLGA NPs before and after nebulization and an equal volume of PBS for 4 h, and then cultured in complete medium at 37 ° C for another 24 h. The cell monolayer was directly scraped with a 200 μL sterile pipette and rinsed three times with PBS to remove cell debris and detached cells. After 24 h of culture in serum-free DMEMF12, migration images were collected to determine the percentage of callus.

[0069] Cell migration assay: The migration of myofibroblasts was evaluated by 24-well transwell chamber migration method. Equal numbers of MLE12 cells were seeded in culture dishes and then induced with TFG-β1 for 48 h. PLGANPs or / CaPCas9 / PLGA NPs were then added for 6 h. The cells were washed and then cultured in complete culture medium for another 20 h. Non-migrating cells on the upper part of the membrane were removed with a cotton swab, and the migrating cells were fixed in 4% paraformaldehyde and stained with crystal violet staining solution. Images were collected and the number of migrating cells in 3 non-overlapping fields of each membrane was counted under a ×20 magnifying glass.

[0070] Experimental results: in vitro evaluation of CaP / Cas9 / PLGA nanoparticles

[0071] like Figure 6 As shown, 293T, A549, MLE12 and AML12 cells were used, and the cytotoxicity of CaP / Cas9 / PLGA was tested by CCK8 method. The results showed that pCas9, PLGA, and CaP / Cas9 / PLGA had no significant toxicity to the above cells. The results show that CaP / Cas9 / PLGA has good cell compatibility.

[0072] like Figure 7 As shown in the figure, different inhibitors were used to explore the MLE12 cell uptake pathway of CaP / Cas9 / PLGA nanoparticles. The results showed that under CPZ and 4°C conditions, the fluorescence intensity of Cas9 labeled with YOYO-1 fluorescence was dim, and similar results were obtained by image J quantification and flow cytometry. CPZ is known to inhibit clathrin-mediated endocytosis, so the pathway for CaP / Cas9 / PLGA to enter cells may be mainly clathrin-mediated endocytosis.

[0073] like Figure 8 As shown, YOYO-1-labeled CaP / Cas9 / PLGA was transfected into MLE12 cells. After 1h, 3h, and 6h of transfection, the intracellular lysosomal escape of the nanoparticles and the process of the plasmid entering the nucleus were observed and recorded under a laser confocal microscope, and the colocalization was evaluated using the Manders's colocalization coefficient calculation. The results showed that at 1h of transfection, the plasmid was mainly located in the cell cytoplasm, then colocalized with the red lysosomes at 3h, and escaped and released from the lysosomes after 6h. The results show that the prepared CaP / Cas9 / PLGA nanoparticles can be successfully taken up by lung cells and achieve endosomal escape, and can be used for efficient delivery of Cas9 in cells.

[0074] like Fig. 9As shown in the figure, in order to explore the transfection efficiency of CaP / Cas9 / PLGA nanoparticles in lung cells, CaP / Cas9 / PLGA carrying the EGFP reporter gene was transfected into MLE12 cells, and the green fluorescence expression of EGFP was observed under a fluorescence microscope 48 hours after transfection. The results showed that the transfection effect of CaP / Cas9 / PLGA was comparable to that of Lipo3000. The results show that PLGA has a certain transfection ability and can play the role of intracellular drug delivery.

[0075] like Fig.10 As shown, at the protein level, WB results found that CaP / Cas9 / PLGA can effectively down-regulate the protein level of the SPP1 gene.

[0076] like Fig.11 As shown, the results of the T7EI experiment showed that at the gene level, Cas9 transfected by CaP / Cas9 / PLGA could cause double-strand breaks and efficient cutting, and its cutting rate was high, comparable to that of Lipo3000.

[0077] like Fig.12 As shown, MLE12 was induced to become myofibroblasts by TGF-β1, and then CaP / Cas9 / PLGA was transfected into the cells. After 48 hours, the migration ability of the cells was observed. From the scratch healing area of ​​the cells under a microscope, it can be seen that CaP / Cas9 / PLGA can significantly inhibit the migration of cells, indicating that it has an inhibitory effect on the migration of myofibroblasts.

[0078] like Fig.13 As shown, the transwell experiment was used to further verify whether CaP / Cas9 / PLGA treatment could inhibit the migration of fibrotic cells. The cells that migrated from the upper chamber to the bottom were stained and observed. The results showed that the PBS group stimulated by TGF-β1 but not treated with other methods showed obvious changes in morphology. Compared with other groups, CaP / Cas9 / PLGA treatment inhibited fibroblast differentiation to a certain extent, with the best inhibitory effect.

[0079] like Fig.14 As shown, the intracellular proteins were analyzed by immunoblotting, and the results showed that CaP / Cas9 / PLGA inhibited the expression of ACTA2 actin and COL1A1 fibrillar collagen, both of which are myofibroblast markers, indicating that knocking out SPP1 can indeed inhibit myofibroblast differentiation. Therefore, CaP / Cas9 / PLGA can alleviate TGF-β1-mediated fibroblasts in vitro.

[0080] Example 5: CaP / Cas9 / PLGA for the treatment of bleomycin-induced pulmonary fibrosis

[0081] Establishment of bleomycin-induced mouse pulmonary fibrosis model: A single intratracheal injection of bleomycin sulfate (BLM) at a dose of 1.5 U / kg was used to establish a pulmonary fibrosis mouse model (IPF mouse).

[0082] Biodistribution study: In order to observe the distribution of CaP / Cas9 / PLGA NPs in IPF mice, free Did or Did-labeled CaP / Cas9 / PLGA nanoparticles diluted 10,000 times were intratracheally aerosolized into the mouse lungs. The distribution of nanoparticles in mice within 48 hours was recorded by the in vivo fluorescence imaging system (IVIS, PerkinElmer). After the imaging, the mice were euthanized, and the main organs (heart, liver, spleen, lungs, and kidneys) were removed for in vitro fluorescence imaging. The lung lobes of the mice were then separated and imaged according to their structure. The fluorescence intensity of Did was quantified using Living Image analysis software. The distribution of CaP / Cas9 / PLGA in lung cells after aerosolization was performed by immunofluorescence. 48 hours after the aerosol administration of cy5-labeled CaP / Cas9 / PLGA, the mice were killed and the lung tissues were dissected out, then paraffin sections were made and the corresponding primary antibodies (cd31, cd68, SFTPC) were added to mark endothelial cells, macrophages and type II pneumonic epithelial cells, respectively, and then secondary antibodies were added, DAPI was used to counterstain the cell nuclei, and the sections were sealed and imaged and analyzed under a confocal scanner.

[0083] In vivo anti-pulmonary fibrosis of CaP / Cas9 / PLGA: To study the therapeutic effect of CaP / Cas9 / PLGA NPs on pulmonary fibrosis mice in vivo, male C57BL / 6 mice were randomly divided into 5 groups: 1) healthy group, 2) PBS, 3) PLGA, 4) Cas9 (2 mg / kg), 5) Cas9 / PLGA (containing 2 mg / kg of Cas9), CaP / Cas9 / PLGA (containing 2 mg / kg of Cas9). After bleomycin injury, pulmonary aerosol administration was performed every 3 days for 3 weeks. The body weight of mice was recorded regularly and the survival rate of different treatment groups was analyzed. The mice were euthanized on the 21st day after BLM modeling, and lung tissues were collected for photography and serum for biochemical analysis. At the same time, lung tissues were processed for T7E1 detection and protein immunoblotting analysis.

[0084] Enzyme-linked immunosorbent assay (ELISA): Accurately weigh an appropriate amount of mouse lung lobes, add RIPA lysis buffer, grind, and centrifuge at 18,000 g for 20 min at 4°C. Collect the supernatant of the lysate. Then, centrifuge at 2,000 g for 15 min at 4°C to collect the supernatant. After a series of dilutions, determine the levels of TGF-β1 and IL-1β in the supernatant according to the ELISA kit instructions.

[0050] Hydroxyproline level: Hydroxyproline level was detected using a hydroxyproline (HYP) content detection kit (AK139, Beijing Bioson Biotech). According to the instructions, the mouse lung lobes were cut into pieces and lysed with an extract, and the supernatant was taken for detection at 560 nm.

[0085] Histological analysis: To evaluate the degree of inflammation and fibrosis in the mouse lung tissue, paraffin-embedded lung sections were subjected to H&E staining and Masson staining. The left lung was quickly immersed in 4% paraformaldehyde for 24 hours. Half of the lung was dehydrated and embedded in paraffin, and then analyzed by H&E and Masson staining. The remaining lung was dehydrated by sucrose gradient sedimentation, embedded in OCT compound, and then frozen sectioned for immunofluorescence staining. For immunohistochemical analysis, tissue sections were treated with appropriate primary antibodies (SPP1 antibody), then incubated with DAKO secondary antibodies, counterstained with hematoxylin, and mounted with neutral gum for microscopic examination. All of the above sections were semi-quantitatively analyzed and processed using ImageJ software, and the differences were statistically analyzed.

[0086] In vivo safety evaluation: In order to further evaluate the toxicity of the application safety of CaP / Cas9 / PLGA, C57BL / 6 mice were randomly divided into two groups and nebulized with CaP / Cas9 / PLGA (2 mg / kg) or saline solution, respectively. Blood was collected at different time points (1 day, 7 days and 14 days) for serum biochemical analysis and routine blood analysis, and major organs were dissected for H&E staining analysis.

[0087] Experimental results:

[0088] like Fig.15 As shown, after CaP / Cas9 / PLGA-Dye was administered to IPF mice by aerosol, CaP / Cas9 / PLGA-Dye had a good lung accumulation ability. The distribution of nanoparticles in the lung lobes was further investigated by separating the lung lobes, and it was found that the nanoparticles were most distributed in the left lung lobe, followed by Cranial and Caudal, which was directly proportional to the area of ​​the lung lobe.

[0089] like Fig.16 As shown, immunofluorescence staining was further performed on lung tissue to examine the distribution of cells reached by nanoparticle uptake. The results showed that CaP / Cas9 / PLGA can be distributed in lung epithelial cells. Therefore, CaPCas9 / PLGA allows Cas9 therapeutic drugs to penetrate deeply into lung tissue and can effectively mediate Cas9-based gene editing therapy in the lung.

[0090] like Fig.17As shown in the figure, the body weight was recorded every day as a measure of disease burden. The results show that after CaP / Cas9 / PLGA treatment, the body weight of mice can be maintained at a relatively stable level during the treatment period. The survival rate of mice during the treatment period also proved that CaP / Cas9 / PLGA effectively inhibited the fibrosis process, and its survival rate reached 80%.

[0091] like Fig.18 As shown, after the treatment, preliminary histological examination showed that the group treated with bleomycin had hemorrhagic necrosis, while the group treated with CaP / Cas9 / PLGA had significantly less hemorrhagic necrosis, significantly less pulmonary edema, and the morphology was similar to that of the lungs of healthy mice. H&E staining results showed that compared with the PBS, PLGA NPs or Cas9 control groups, Cas9 / PLGA and CaP / Cas9 / PLGA NPs treatments greatly reduced the severity of bleomycin-induced fibrosis by protecting the alveolar epithelial structure, and CaP / Cas9 / PLGA had a better effect. Masson staining and Immunohistochemistry staining showed that after inhalation of CaP / Cas9 / PLGA NPs, the lung tissue had less inflammatory cell infiltration and alveolar expansion, collagen deposition and parenchymal destruction were significantly reduced, and the expression level of OPN was also reduced.

[0092] like Fig.19 As shown in the results, TGF-β1 and IL-1β are key profibrotic mediators in the development of fibrosis and are involved in a variety of pathological processes such as apoptosis, myofibroblast differentiation, and collagen deposition. Enzyme-linked immunosorbent assay (ELISA) of TGF-β1 and IL-1β in lung tissue fluid revealed that the levels of the two inflammatory-related factors in the CaP / Cas9 / PLGA-treated group were only slightly increased compared with the untreated group, indicating that CaP / Cas9 / PLGA NPs treatment significantly inhibited the increase of TGF-β1 and IL-1β induced by bleomycin. In addition, we quantified the concentration of hydroxyproline using a hydroxyproline kit, which is known to reflect the progression of pulmonary fibrosis. Notably, a significant decrease in hydroxyproline concentration was detected in the lungs of mice treated with CaP / Cas9 / PLGA, showing the excellent therapeutic effect of CaP / Cas9 / PLGA in alleviating bleomycin-induced pulmonary fibrosis.

[0093] like Fig. 20 As shown in the figure, the in vivo cleavage rate was verified by T7EI experiment, and it can be seen that gene editing occurred only in the lungs, with an editing rate of 17.92%, indicating that CaP / Cas9 / PLGA can mediate specific in vivo gene editing. Deep sequencing of lung tissues revealed that 11.25% of DNA had mutations, deletions, insertions, etc.

[0094] like Fig.21 As shown, the protein expression levels of ACTA2, COL1A1, and SPP1 in lung tissues were studied by Western blot analysis, and it was found that the expression level of SPP1 was reduced. The results show that CaP / Cas9 / PLGA can accurately target and knock out SPP1 and reduce the level of bleomycin-induced lung fibrosis.

[0095] like Fig. 22 As shown, on the 21st day of treatment, the main organs of each group of mice were taken for H&E staining. The results showed that compared with the healthy control group, the CaP / Cas9 / PLGA treatment group had no toxicity and no obvious tissue damage.

[0096] like Fig.23 As shown, the results of serum and blood biochemical analysis also showed that there were no abnormal indicators in the CaP / Cas9 / PLGA treatment group, indicating the safety of CaP / Cas9 / PLGA in vivo.

[0097] The above embodiments are only for illustrating the technical concept and features of the present invention, so that those skilled in the art can understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. All equivalent changes and modifications made according to the essence of the content of the present invention should be included in the protection scope of the present invention.

Claims

1. A PLGA nanoparticle encapsulating a CRISPR / Cas9 recombinant plasmid, characterized in that: The CRISPR / Cas9 recombinant plasmid is encapsulated, the sequence of the recombinant plasmid is shown in SEQ ID NO.1, and the particle size of the PLGA nanoparticle is 150nm.

2. The method for preparing PLGA nanoparticles encapsulating CRISPR / Cas9 recombinant plasmid according to claim 1, characterized in that: This is accomplished by following these steps: (1) designing sgRNA according to the selected SPP1 gene, annealing the designed sgRNA, digesting the backbone plasmid containing clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) system with BpiI restriction endonuclease (SEQ ID NO. 2), and then connecting the sgRNA with the digested fragment to construct SPP1-sgRNA / Cas9 recombinant plasmid (Cas9); (2) reacting calcium nitrate and diammonium hydrogen phosphate to produce a calcium phosphate solution (CaP), then mixing CaP and Cas9, stirring at low temperature for 5 minutes, and ultrafiltration to obtain a CaP / Cas9 complex; (3) dissolving the carrier material polylactic acid-glycolic acid copolymer (PLGA) in dichloromethane, adding the CaP / Cas9 complex solution to the carrier material solution, and ultrasonicating in an ice bath to prepare a water-in-oil colostrum solution; (4) adding 2% polyvinyl alcohol aqueous solution to the colostrum solution and performing ultrasonication in an ice bath to obtain a water-in-oil-in-water emulsion solution; (5) The latex solution was poured into a 0.1% polyvinyl alcohol aqueous solution and stirred at 250 rpm for 6 hours at room temperature to solidify the microspheres. Finally, the nanoparticles were collected by centrifugation at 4°C to obtain PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid.

3. The preparation method according to claim 2, characterized in that: The sequence of the sgRNA designed in step (1) is gcagaatctccttgcgccacagg; The designed sgRNA and its complementary sequence were synthesized, and restriction sites were added at the beginning and end. The synthetic sequence was: SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO.3) SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO.4) In step (1), the sgRNA annealing temperature gradient was set as follows: 95°C, 10 min; 95°C-85°C, 2.5°C / s; 85°C-25°C, 0.25℃ / s; 25℃, 5min.

4. The preparation method according to claim 2, characterized in that: In step (1), the digestion conditions of the backbone plasmid were 37°C for 2 h, and the conditions for connecting the sgRNA to the digested plasmid were 16°C for 30 min.

5. The preparation method according to claim 2, characterized in that: The mass ratio of CaP and Cas9 described in step (2) is 1:

32.

6. The preparation method according to claim 2, characterized in that: The mass ratio of the Cas9 plasmid solution described in step (3) to the polyethylene glycol-polylactic acid-glycolic acid copolymer is 1:20, the molar ratio of the two monomers of polylactic acid and glycolic acid in the copolymer is 50:50, and the molecular weight of the polyethylene glycol in the copolymer is 38000-54000Da.

7. Use of the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid according to claim 1 in the preparation of a drug for preventing or treating idiopathic pulmonary fibrosis.

8. Use of the PLGA nanoparticles encapsulating the CRISPR / Cas9 recombinant plasmid according to claim 1 in the preparation of a drug for alleviating TGF-β1-induced pulmonary fibrosis.

9. The use according to claim 7, characterized in that: The application is to use PLGA nanoparticles encapsulating CRISPR / Cas9 recombinant plasmids to deliver the Cas9 plasmids to the site of pulmonary fibrosis lesions through aerosolization, perform gene editing, knock down disease-related genes, alleviate fibrosis, and reduce the death of normal lung cells.

10. The use according to claim 7 or 8, characterized in that: The dosage form of the drug is an aerosol preparation.

Images