Plga nanoparticles encapsulating crisper / cas9 recombinant plasmid and preparation and application thereof

Abstract

The application provides a kind of PLGA nanoparticle of CRISPR / Cas9 recombination plasmid and preparation and application.First, design sgRNA and construct SPP1-sgRNA / Cas9 recombination plasmid, then recombination plasmid and calcium phosphate form CaP / Cas9 complex by electrostatic interaction, finally, CaP / Cas9 complex is wrapped in polylactic acid-hydroxyacetic acid copolymer carrier to construct a kind of atomized inhalation nanoparticle.The nanoparticle described in the application has good biocompatibility, high gene therapy plasmid cell strain transfection efficiency, stable expression effect, can precisely knock out SPP1 gene in lung epithelial cells, and can effectively relieve pulmonary fibrosis.The application has the clinical conversion application value of pulmonary fibrosis disease treatment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to a kind of PLGA nanoparticle for loading CRISPR / Cas9 recombinant plasmid and its preparation method and the application of anti idiopathic pulmonary fibrosis. BACKGROUND

[0002] Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal interstitial lung disease, characterized by alveolar epithelial cell injury, excessive activation of fibroblasts, excessive accumulation of lung extracellular matrix (ECM), and irreversible decline in lung function. About 5 million people worldwide suffer from IPF, with a median survival of 3 to 5 years after diagnosis. Environmental factors, drug side effects, aging and genetics are known to cause IPF, but the underlying mechanisms of the disease pathology are not yet known. Currently, nintedanib and pirfenidone have been approved by the FDA for the treatment of IPF patients, which can slow down the progression of the disease to some extent. However, in clinical practice, they have poor selectivity, obvious side effects, and cannot significantly prolong the survival rate of patients to meet the clinical needs. According to the American Thoracic Society and the European Respiratory Society, there is currently no other proven method to treat IPF other than oxygen therapy and lung transplantation. Therefore, it is necessary to develop new drug products to improve the clinical benefits of IPF patients.

[0003] The relationship between osteopontin (OPN, expressed by SPP1 gene) and the mechanism of pulmonary fibrosis is one of the recent research focuses. OPN is a highly phosphorylated glycoprotein that has a variety of biological functions, including regulating cell adhesion, chemotaxis, and tissue repair processes. Under physiological conditions, OPN expression in adult lung tissue is mainly limited to macrophages, bronchioles, fibroblasts and endothelial cells, and the expression level is low. However, in the inflammatory environment of the lung, cytokines such as monocyte colony-stimulating factor (MCSF), IL-6, IL-1β and IL-33 can up-regulate the expression of SPP1, further causing damage to alveolar epithelial cells, which is a key feature of the development of pulmonary fibrosis. In the process of pulmonary fibrosis formation, OPN plays a key role in the activation of lung epithelial cells, fibroblasts and other cells, leading to abnormal accumulation of extracellular matrix (ECM) in lung tissue, which is crucial for the progression of pulmonary fibrosis. To prove the relationship between OPN and the development of IPF, it was found that SPP1 is the most significantly up-regulated gene in IPF lungs, with a 20-fold increase in SPP1 levels. At the same time, the expression of OPN in lung tissue and bronchoalveolar lavage fluid (BALF) also increased significantly, and this increase was related to the severity of fibrosis. Previous studies have reported that the absence of SPP1 can improve bleomycin-induced dermal fibrosis and carbon nanotube-induced pulmonary fibrosis, and the absence of SPP1 reduces the up-regulated expression of type 1 collagen and MMP2. Therefore, down-regulating SPP1 to treat IPF may provide a new gene therapy strategy for IPF.

[0004] CRISPR / Cas9 gene editing technology can be implemented at the molecular level to manipulate genes, with the advantages of simple design, easy operation, good specificity, high efficiency, etc., and has rapidly become a powerful strategy with great prospects in a wide range of biomedical applications. The CRISPR / Cas9 system (clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9) is a powerful and prominent tool for manipulating genetic information in mammalian cells. It recognizes target DNA by using a single guide RNA (sgRNA) and uses the nuclease activity of Cas9 to introduce site-specific double-strand breaks (DSBs) at target gene sites, thereby greatly simplifying the genome editing program. However, in order to effectively achieve genome editing, it is crucial to deliver the CRISPR / Cas9 system to the target organ or cell. Viral vectors are the most commonly used delivery vectors for the CRISPR / Cas9 system, but the limited loading capacity of viral vectors, the potential for the host to produce harmful immunogenicity and mutations, and the limitations on their applications. Compared with viral vectors, non-viral vectors have the advantages of strong loading capacity, low immunogenicity, and no endogenous viral recombination, although the delivery efficiency is lower, but it is the most potential delivery method for in vivo administration. Therefore, many researchers have devoted to the design and development of safe and efficient non-viral delivery systems.

[0005] Considering the particularity of lung tissue, direct delivery of CRISPR / Cas9 therapeutic agents to the lung through the pulmonary route is expected to treat a series of respiratory diseases, such as pulmonary fibrosis and lung injury. Nebulization inhalation is a promising delivery strategy that can improve the targeting efficiency and retention time interval of nanoparticles in lung tissue, thereby improving the therapeutic index with reduced effective dose. The present application designs a new type of nebulization inhalable CRISPR / Cas9 drug delivery system (CaP / Cas9 / PLGA) to deliver Cas9 plasmid, and finds that it can down-regulate SPP1 to relieve pulmonary fibrosis, thereby providing a new treatment idea for pulmonary fibrosis diseases. SUMMARY

[0006] The present application aims to provide a PLGA nanoparticle loaded with CRISPR / Cas9 recombinant plasmid. The PLGA nanoparticle loaded with CRISPR / Cas9 recombinant plasmid (SEQ ID NO. 1) has a particle size of 150 nm.

[0007] The second object of the present application is to provide a preparation method of the PLGA nanoparticle loaded with CRISPR / Cas9 recombinant plasmid, which is achieved by the following steps:

[0008] (1) Constructing CRISPR-Cas9 recombinant plasmid (Cas9) capable of targeting knockout SPP1 gene: design sgRNA according to selected SPP1 gene, anneal designed sgRNA, enzyme cut backbone plasmid (SEQ ID NO. 2), and then connect sgRNA with enzyme cut plasmid to construct SPP1-sgRNA / Cas9 recombinant plasmid (Cas9);

[0009] (2) Reacting calcium nitrate and diammonium hydrogen phosphate to produce calcium phosphate solution (CaP), mixing CaP and Cas9, stirring at low temperature for 5 minutes, and obtaining CaP / Cas9 complex (CaP / Cas9) after ultrafiltration;

[0010] (3) Dissolving carrier material polylactic acid-glycolic acid copolymer (PLGA) in dichloromethane, adding CaP / Cas9 solution into the carrier material solution, and preparing solution water-in-oil initial emulsion solution by ice bath ultrasonic;

[0011] (4) Adding 2% polyvinyl alcohol (PVA) aqueous solution into the initial emulsion solution, and obtaining water-in-oil-in-water multiple emulsion solution by ice bath ultrasonic;

[0012] (5) Pouring the emulsion solution into 0.1% PVA aqueous solution, and stirring at 250 rpm at room temperature for 6 hours to solidify the microspheres. Finally, centrifuging the nanoparticles at 4℃ to obtain PLGA nanoparticles loaded with CRISPR / Cas9 recombinant plasmid.

[0013] The sgRNA sequence designed in step (1) is gcagaatctccttgcgccacagg;

[0014] Synthesizing the designed sgRNA and its complementary sequence, and adding enzyme cutting sites at the beginning and end. The synthesized sequence is:

[0015] SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO. 3)

[0016] SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO. 4)

[0017] The sgRNA annealing temperature gradient in step (1) is set as: 95℃, 10 min; 95℃-85℃, 2.5℃ / s; 85℃-25℃,

[0018] 0.25℃ / s; 25℃, 5 min.

[0019] The enzyme cutting condition of Bpil in step (1) is 37℃, 2h.

[0020] The conditions for connecting sgRNA and enzyme-cut plasmid in step (1) are 16℃ for 30 min.

[0021] Preferably, the mass ratio of calcium nitrate and hydrogen phosphate in step (2) is 1:1.

[0022] Preferably, the mass ratio of CaP and Cas9 in step (2) is 1:32.

[0023] The pore size of the ultrafiltration tube in step (2) is 100Kda.

[0024] Preferably, the molar ratio of polylactic acid and hydroxyacetic acid in the copolymer in step (3) is 50:50, i.e. the polylactic acid hydroxyacetic acid segment is composed of 50% lactic acid and 50% hydroxyacetic acid (i.e. PLGA 50 / 50).

[0025] Preferably, the molecular weight of polyethylene glycol in the copolymer in step (3) is 38000-54000 Da.

[0026] Preferably, the mass ratio of Cas9 plasmid solution and polyethylene glycol-polylactic acid-hydroxyacetic acid copolymer in step (3) is 1:20.

[0027] Preferably, the ultrasonic treatment conditions in step (4) are 195W power for 3 minutes in an ice bath using an ultrasonic cell disruptor to form colostrum.

[0028] Preferably, the mass percentage of polyvinyl alcohol in the polyvinyl alcohol aqueous solution in step (4) is 2%, and the mass percentage of polyvinyl alcohol in the polyvinyl alcohol aqueous solution in step (5) is 0.1%. This concentration is the minimum effective concentration of polyvinyl alcohol for emulsification. Below this concentration, the emulsification effect is insufficient and easy to cause microsphere adhesion and poor formability. Too high concentration is easy to cause drug leakage and reduce drug loading.

[0029] The third object of the present application is to provide the use of the PLGA nanoparticle loaded with the CRISPR / Cas9 recombinant plasmid in the preparation of a drug for preventing or treating idiopathic pulmonary fibrosis. The use of the PLGA nanoparticle loaded with the CRISPR / Cas9 recombinant plasmid is to deliver the Cas9 plasmid to the lesion site of pulmonary fibrosis by atomization, to perform gene editing, to knock down the disease-related genes, to relieve the fibrosis condition, and to reduce the death of normal lung cells. The nanoparticle of the present application has uniform particle size distribution, good dispersibility, good ability of transfecting lung epithelial cells, can be effectively delivered into the fibrotic lung across the mucous membrane, is not internalized by lung cells to induce cytotoxicity, and can effectively trigger the editing of the SPP1 gene after escaping from the endosome / lysosome chamber, with an efficiency of more than 30%, to cause the expression of OPN to decrease. In addition, in a bleomycin-induced pulmonary fibrosis mouse model, the CaP / Cas9 / PLGA significantly reduces the development of fibrosis and improves the lung function, relieves the bleomycin-induced pulmonary fibrosis, and has high safety and small side effects.

[0030] The fourth object of the present application is to provide the use of the PLGA nanoparticle loaded with the CRISPR / Cas9 recombinant plasmid in the preparation of a drug for relieving TGF-β1-induced pulmonary fibrosis.

[0031] The drug dosage form prepared by the present application is a liquid preparation, preferably an atomized agent, and the administration dose is: atomization once every 3 days, with a dose of 2 mg / kg.

[0032] The beneficial effects of the present application are:

[0033] (1) The plasmid-based CRISPR / Cas9 system has higher stability and is the simplest and most efficient than the system combining Cas9 mRNA and protein; the CRISPR / Cas9 plasmid (Cas9) capable of targeting knockout of spp1 gene is successfully constructed.(2) In order to realize atomization inhalation, mucus penetration, improve the safety of gene editing, and reduce local inflammatory response, the biodegradable and non-immunogenic polylactic acid-glycolic acid (PLGA) material approved by FDA is used as the delivery carrier of Cas9, so as to achieve efficient and safe knockout of the target gene, improve the transfection efficiency, and achieve non-toxicity.(3) In order to improve the loading rate, stability and intracellular efficient lysosome escape of Cas9, the Cas9 is concentrated to form Cas9 complex (CaP / Cas9) by calcium phosphate (CaP), so as to control their physical and chemical properties (surface charge), thereby facilitating smooth delivery and rapid lysosome escape (proton sponge effect).(4) Through the construction of the mouse pulmonary fibrosis model in vivo, H&E staining, MASSON staining, immunofluorescence staining, TGF-β1 content determination, IL-1β content determination, hydroxyproline content determination, SPP1 protein expression level detection, T7EI cleavage detection are carried out; wound healing experiment, Transwell migration experiment and Western blotting experiment are carried out for in vitro verification; the results of in vivo and in vitro experiments show that the CRISPR / Cas9 has good therapeutic effect on pulmonary fibrosis, and has great application scenarios in the fields of biotechnology and medical technology. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 is the morphology and size distribution of the PLGA nanoparticle (CaP / Cas9 / PLGA) loaded with CRISPR / Cas9 recombinant plasmid before and after atomization.

[0035] Figure 2 is the zeta potential analysis in the preparation process of CaP / Cas9 / PLGA.

[0036] Figure 3 is the Cas9 encapsulation rate of the PLGA nanoparticle (Cas9 / PLGA) prepared without CaP and the CaP / Cas9 / PLGA nanoparticle before and after atomization.

[0037] Figure 4 is the in vitro release behavior analysis of Cas9 / PLGA and CaP / Cas9 / PLGA under different pH conditions.

[0038] Figure 5 is the agarose gel electrophoresis for investigating the antinuclease degradation.

[0039] Figure 6 is the cell viability analysis of different concentrations of CaP / Cas9 / PLGA co-cultured with different cells for 48 hours.

[0040] Figure 7 Cell uptake mechanism of CaP / Cas9 / PLGA.

[0041] Figure 8 Lysosomal escape performance evaluation of CaP / Cas9 / PLGA.

[0042] Figure 9 Transfection fluorescence of CaP / Cas9@PLGA.

[0043] Figure 10 Protein expression level of SPP1.

[0044] Figure 11 Cutting rate of SPP1 gene of CaP / Cas9@PLGA in cells.

[0045] Figure 12 Cell scratch test of CaP / Cas9@PLGA on TGFβ1 induced MLE12 cells.

[0046] Figure 13 Cell migration test of CaP / Cas9@PLGA on TGFβ1 induced MLE12 cells.

[0047] Figure 14 Expression level of ACTA2 and COL1A1 proteins.

[0048] Figure 15 Distribution of Did labeled CaP / Cas9@PLGA nanoparticles in major organs and lung lobes of mice in vivo.

[0049] Figure 16 Co-localization immunofluorescence results of Did labeled CaP / Cas9@PLGA nanoparticles (cy5 wavelength) and SFTPC labeled type II lung epithelial cells.

[0050] Figure 17 Body weight change and mouse survival rate during CaP / Cas9@PLGA treatment.

[0051] Figure 18 Optical image, lung section HE staining, Masson staining, and OPN protein immunohistochemical analysis of the lung of IPF mice after treatment with CaP / Cas9@PLGA.

[0052] Figure 19 IL-1β, TGF-β1, and HYP content of IPF mice after treatment with CaP / Cas9@PLGA.

[0053] Figure 20T7EI cleavage of heart, liver, spleen, lung and kidney of IPF mice after CaP / Cas9@PLGA treatment and T7EI cleavage of lung tissue of different administration groups.

[0054] Figure 21 Protein expression levels of ACTA2, COL1A1 and SPP1 in lung tissue of IPF mice after CaP / Cas9@PLGA treatment.

[0055] Figure 22 H&E staining analysis of major organs of mice in each group on the 21st day of CaP / Cas9 / PLGA treatment.

[0056] Figure 23 Serum and blood biochemical analysis of mice after CaP / Cas9 / PLGA treatment. DETAILED DESCRIPTION

[0057] The present application will be further described in detail below in conjunction with the accompanying drawings and specific examples. The protection scope of the present application is not limited to the following examples. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application, and the appended claims are the scope of protection. The process, conditions, reagents, experimental methods, etc. for implementing the present application are the general knowledge and common sense in the art, and the present application has no special limitations.

[0058] Example 1: Preparation and characterization of CaP / Cas9 / PLGA nanoparticles

[0059] Preparation method:

[0060] Construction of SPP1-sgRNA / Cas9 recombinant plasmid: CRISPR-Cas9 plasmid (Cas9) capable of targeting and knocking out SPP1 gene was constructed. The plasmid used in this paper is CMV-Cas9-P2A-GFP-P2A-luciferase-pA-U6-gRNA. The target of all candidate genes is designed through the online tool platform of Zhangfeng laboratory (http: / / chopchop.cbu.uib.no / ). The designed sgRNA sequence is gcagaatctccttgcgccacagg;

[0061] Synthesis of the designed sgRNA and its complementary sequence, and addition of enzyme cutting sites at the beginning and end. The SPP1 gene targeting site and sgRNA oligonucleotide sequence synthesis sequence is:

[0062] SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO. 3),

[0063] SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO. 4),

[0064] The annealed oligonucleotide was cloned into the CMV-Cas9 plasmid through the BbsI restriction site. The steps of annealing and cloning can be found on the website of Zhang Lab (www.genomeengineering.org). The constructed plasmid was transfected into DH-5a E. coli and inoculated into LB liquid medium with ampicillin after high-pressure sterilization, and cultured at 37°C, 200r·min -1 for 12-16h to form single colonies. A single colony was picked for expansion and plasmid extraction, and sequencing was performed to identify the successful construction of the plasmid, which was named SPP1-sgRNA / Cas9 recombinant plasmid (Cas9).

[0065] Preparation of CaP / Cas9 / PLGA nanoparticles: 105 μL (31.25 mM) of calcium nitrate and 105 μL (18.7 mM) of diammonium hydrogen phosphate were mixed in an EP tube, and the mixture was added dropwise to 10 μL (1000 ng / μL) of Cas9 plasmid, vortexed, and cooled on ice for 5 min to obtain a CaP / Cas9 complex. 1 mL of 20 mg / mL PLGA in dichloromethane (DCM) was added to the CaP / Cas9 complex and vortexed. To form an emulsion, the organic phase was added to an aqueous solution (2% PVA) while ultrasonic treatment was performed at a power of 195w for 3 minutes. Then the obtained emulsion was added to a 0.1% PVA aqueous solution and stirred at 250 rpm for 6 hours at room temperature to solidify the microspheres. Finally, the nanoparticles were collected by centrifugation at 4°C. The amounts of CaP / Cas9 and PLGA can be scaled up as needed.

[0066] Experimental results: CaP / Cas9 / PLGA nanoparticles were successfully prepared, and then the morphology and size distribution of the obtained CaP / Cas9 / PLGA nanoparticles and CaP / Cas9 / PLGA nanoparticles after nebulization by the atomizing needle were characterized by transmission electron microscopy (TEM) and dynamic light scattering (DLS), respectively. The encapsulation efficiency was calculated by measuring the absorbance at 260 nm through a microplate reader (Thermo scientific, Multiskan GO1050). The release behavior of Cas9 was investigated at pH 5.0 and pH 7.4. The protective effect of PLGA NPs on the plasmid was verified.

[0067] As Figure 1As shown, the CaP / Cas9 / PLGA nanoparticles are spherical with a dense structure and a particle size of approximately 150 nm. The morphology of the nanoparticles remains unchanged before and after nebulization, indicating that the intense shear force generated during nebulization does not alter the size and morphology of the nanoparticles. The CaP / Cas9 / PLGA nanoparticles exhibit good stability and suitable rigidity, meeting the formulation quality requirements for nebulized inhalation. Furthermore, DLS results show that the particle size is similar to that of the TEM results.

[0068] like Figure 2 As shown, Zeta potential analysis indicates that the potential of CaP / Cas9 / PLGA did not change significantly before and after nebulization, demonstrating good stability. The positively charged Ca in calcium phosphate... 2+ It can bind to negatively charged Cas9 via electrostatic adsorption to form a CaP / Cas9 complex, condensing Cas9. The CaP encapsulation can reduce the negative charge of PLGA itself, which is beneficial for the adsorption of plasmids onto it.

[0069] like Figure 3 As shown, the encapsulation efficiency of PLGA for Cas9 [(44.20±8.44)%] was significantly higher than that of Cas9 / PLGA [(6.66±2.34)%] by introducing calcium phosphate, indicating that the drug loading of PLGA can be improved by introducing CaP. There was no significant difference in the encapsulation efficiency of plasmids in NPs before and after nebulization (44.2% vs 39.66%).

[0070] like Figure 4 As shown in the figure, pH 5.0 and pH 7.4 were selected to simulate intracellular and blood conditions to investigate Cas9 release. The release results are shown in the figure. Under both pH conditions, Cas9 / PLGA released less than 10 ng / μL of Cas9 after 48 h. CaP / Cas9 / PLGA released less than 10 ng / μL of Cas9 after 48 h at pH 7.4, while at pH 5.0, Cas9 release was significantly improved, reaching nearly 50 ng / μL. These results indicate that CaP / Cas9 / PLGA exhibits pH-responsive release characteristics, which are particularly helpful for drug delivery and controlled release in weakly acidic cells, thus enhancing anti-fibrotic effects and reducing toxic side effects.

[0071] like Figure 5 As shown, Cap / Cas9 / PLGA (lane 4) and free Cas9 (lane 2) were incubated with DNase I and then subjected to agarose gel electrophoresis. A plasmid group without DNase I was also included (lane 3). The results... Figure 5 It was found that PLGA could protect plasmids from degradation by DNase I (lane 4) and there was no significant difference from the control group (lane 3), while plasmids without PLGA protection were completely degraded (lane 2).

[0072] Example 2: In vitro evaluation of CaP / Cas9 / PLGA nanoparticles

[0073] Cytotoxicity assay: 293T, A549, MLE12, and AML12 cells were cultured at 1 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of 1000 μL in 96-well plates and incubated overnight. They were then incubated with different doses of NPs for 48 h. Untreated cells served as a blank control. The culture medium was then discarded, and serum-free medium containing 10 μL of CCK8 solution was added to each well, followed by incubation at 37°C for 2 h. The absorbance (OD) of each well was measured at 450 nm using a microplate reader to calculate relative cell viability.

[0074] Cellular uptake mechanism assay: 1×10 5 MLE12 cells were seeded in 24-well plates and cultured for 24 h. The cells were then co-incubated for 2 h with different endocytosis inhibitors, including methyl-β-cyclodextrin (β-CD, 50 μM), 5-(N-ethyl-N-isopropyl)amyloidide (EIPA, 30 nM), chlorpromazine (CPZ, 30 μM), and bafloxacin (Baf1, 200 nM). CPZ inhibited clathrin-mediated endocytosis; β-CD inhibited pitot-mediated endocytosis; Baf1 inhibited proton pump-mediated cell uptake; and EIPA inhibited endocytosis. A 4°C treatment group was also included. A group treated with normal 37°C transfection (without any inhibitors) served as a positive control. The cells treated as described above were then transfected with CaP / Cas9 / PLGA (Cas9 plasmid labeled with YOYO-1). After 1 h, 3 h, or 6 h, the uptake of nanoparticles by the cells was observed using fluorescence microscopy, and the fluorescence intensity was quantitatively analyzed using ImageJ software. The mean fluorescence intensity (MFI) of the cells in each group was quantitatively analyzed by flow cytometry.

[0075] Endosomal escape: The uptake of CaP / Cas9 / PLGA in MLE12 cells was evaluated by confocal laser scanning microscopy (CLSM, LSM-810, Carl Zeiss, Germany). Cas9 plasmid was labeled with green fluorescent dye YOYO-1 to track the delivery in cells in real time. Lysosomes in cells were labeled with red fluorescent dye Lysotracker, and the nucleus was labeled with blue fluorescent dye Hoechst 33342. After different time (1, 3 and 6 h) of CaP / Cas9 / PLGA NPs transfection, the process of cell uptake, nanoparticle lysosome escape and plasmid entering the nucleus was observed and recorded under laser confocal microscope. The excitation (Ex) and emission (Em) wavelengths of fluorescent dyes were as follows: Hoechst 33342 (Ex: 350 nm, Em: 440 nm), YOYO-1 (Ex: 491 nm, Em: 509 nm) and Lysotracker (Ex: 577 nm, Em: 590 nm).

[0076] In vitro transfection experiment: MLE12 cells were seeded in 48-well plates at a density of 5 x 10 4 cells per well and cultured overnight. After the cells adhered, the transfection experiment was performed. During transfection, the positive control vector Lipofectamine 3000 was mixed with an appropriate amount of Cas9 in nuclease-free deionized water at room temperature for 30 min. Then the positive control sample and CaP / Cas9 / PLGA NPs were mixed with culture medium without fetal bovine serum, respectively, and added to the cells for culture. After 6 h of culture in the incubator, the old liquid was aspirated and replaced with full culture medium containing 10% FBS. After 48 h of incubation, the culture medium was removed, the cells were gently washed with PBS, and then the expression of EGFP in the cells was observed by fluorescence microscopy. The cells were collected and the proportion of EGFP positive cells was detected by flow cytometry.

[0077] Western blotting (WB): Cells were lysed with RIPA buffer (Beyotime, Nanjing, China) to extract proteins from cells. The BCA protein assay kit (Beyotime) was used for quantification of proteins. SDS-PAGE was used to separate proteins. The proteins were transferred to 0.45 μm PVDF membranes, blocked with 5% milk, and then incubated with TBST-diluted primary antibodies. SPP1, COL1A1, ACTA2, β-actin and GAPDH antibodies were from Huannanbio, abclonal, Proteintech, respectively. Then, HRP-conjugated secondary antibodies (Proteintech, China) were incubated for 1 h at room temperature, and the membranes were washed. The BeyoECL Plus (ultra-sensitive ECL chemiluminescence kit) was used to show the proteins, and after imaging, it was used for further analysis.

[0078] T7EI assay: The efficiency of SPP1 gene site disruption was studied by T7EI assay. According to the standard method provided by the reagent company, the transfected cells and tissues were harvested, and the genomic DNA in the cells and lung tissues was extracted using a universal genomic DNA extraction kit (China Vazyme Company). The target genomic region was amplified by polymerase chain reaction (PCR), and the primers used were (SEQ ID NO. 5, SEQ ID NO. 6), and then purified using a PCR / gel extraction and purification kit (China Vazyme Company) according to the instructions. 200 ng of PCR product was used for T7E1 detection, and the denaturation and annealing of DNA were performed using a kit (NEB, USA). After the annealing was completed, 0.5 μL of T7EI enzyme was added to the system for enzymatic reaction at 37°C for 30 min. The DNA product was analyzed by 2% agarose gel electrophoresis, and imaged using a gel recording system (c150, Azure Biosystems, USA). The gray values of the uncut and cut bands were calculated using ImageJ software for indel rate analysis. The Indel (%) analysis was calculated using the formula as follows. Indel (%) = [1-(1-fraction cleaved)1 / 2] x 100%, and the "fraction cleaved" refers to the intensity ratio of the gray value of each cut band to the cut and uncut bands. In order to detect gene mutations in the lung, the transfected lung tissue was first homogenized, and further analyzed according to the above scheme.

[0079] Wound-healing assay: MLE12 cells were seeded at a density of 1.0 x 10 5 cells per well in a 24-well plate, induced with 10 ng / mL of TGF-β1, and cultured in DMEM F12 medium containing 10% FBS and 1% penicillin-streptomycin to 90% confluency. The cells were incubated with CaP / Cas9 / PLGA NPs before and after atomization and an equal volume of PBS for 4 h, and then cultured in complete medium at 37°C for another 24 h. The cell monolayer was directly scraped with a 200 μL sterile pipette and washed with PBS three times to remove cell debris and exfoliated cells. After 24 h of culture in serum-free DMEM F12, the migration image was collected to determine the percentage of wound healing.

[0080] Cell migration assay: 24-well transwell chamber migration assay was used to evaluate the migration of myofibroblasts. Equal amount of MLE12 cells were seeded in culture dishes and then induced with TFG-β1 for 48 h. Then, PLGA NPs or / CaPCas9 / PLGA NPs were added for 6 h. After washing the cells, they were incubated in complete medium for another 20 h. Non-migrated cells on the upper part of the membrane were removed with a cotton swab, and the migrated cells were fixed in 4% paraformaldehyde and stained with crystal violet staining solution. Images were collected, and the number of migrated cells in 3 non-overlapping fields of each membrane was counted under a x20 magnifying lens.

[0081] Experimental results: in vitro evaluation of CaP / Cas9 / PLGA nanoparticles

[0082] As shown in FIG. 1, 293T, A549, MLE12 and AML12 cells were used respectively, and the cytotoxicity of CaP / Cas9 / PLGA was detected by CCK8 method. The results showed that pCas9, PLGA, and CaP / Cas9 / PLGA had no significant toxicity to the above-mentioned cells. The results showed that CaP / Cas9 / PLGA had good cell compatibility. Figure 6 As shown in FIG. 2, different inhibitors were used to explore the uptake pathway of CaP / Cas9 / PLGA nanoparticles by MLE12 cells. The results showed that under the conditions of CPZ and 4°C, the fluorescence intensity of Cas9 labeled with YOYO-1 was dark, and the image J quantitative and flow quantitative analysis also obtained similar results. It is known that CPZ can inhibit clathrin-mediated endocytosis, therefore, the pathway of CaP / Cas9 / PLGA into cells may be mainly clathrin-mediated endocytosis.

[0083] Figure 7 As shown in FIG. 3, YOYO-1 labeled CaP / Cas9 / PLGA was transfected into MLE12 cells, and after 1 h, 3 h, and 6 h of transfection, the process of endolysosomal escape of nanoparticles and plasmid entering the nucleus was observed and recorded under a laser confocal microscope, and Manders’s colocalization coefficient calculation was used to evaluate the colocalization. The results showed that at 1 h of transfection, the plasmid was mainly located in the cytoplasm of the cells, then at 3 h, it was colocalized with the red lysosome, and after 6 h, it escaped from the lysosome and was released. The results showed that the prepared CaP / Cas9 / PLGA nanoparticles could be successfully taken up by lung cells and achieve endosome escape, and could be used for efficient delivery of Cas9 in cells.

[0084] As shown in FIG. 4, YOYO-1 labeled CaP / Cas9 / PLGA was transfected into MLE12 cells, and after 1 h, 3 h, and 6 h of transfection, the process of endolysosomal escape of nanoparticles and plasmid entering the nucleus was observed and recorded under a laser confocal microscope, and Manders’s colocalization coefficient calculation was used to evaluate the colocalization. The results showed that at 1 h of transfection, the plasmid was mainly located in the cytoplasm of the cells, then at 3 h, it was colocalized with the red lysosome, and after 6 h, it escaped from the lysosome and was released. The results showed that the prepared CaP / Cas9 / PLGA nanoparticles could be successfully taken up by lung cells and achieve endosome escape, and could be used for efficient delivery of Cas9 in cells. Figure 8 As shown in FIG. 5, YOYO-1 labeled CaP / Cas9 / PLGA was transfected into MLE12 cells, and after 1 h, 3 h, and 6 h of transfection, the process of endolysosomal escape of nanoparticles and plasmid entering the nucleus was observed and recorded under a laser confocal microscope, and Manders’s colocalization coefficient calculation was used to evaluate the colocalization. The results showed that at 1 h of transfection, the plasmid was mainly located in the cytoplasm of the cells, then at 3 h, it was colocalized with the red lysosome, and after 6 h, it escaped from the lysosome and was released. The results showed that the prepared CaP / Cas9 / PLGA nanoparticles could be successfully taken up by lung cells and achieve endosome escape, and could be used for efficient delivery of Cas9 in cells.

[0085] Figure 9 ​​As shown, in order to explore the transfection efficiency of CaP / Cas9 / PLGA nanoparticles in lung cells, CaP / Cas9 / PLGA carrying EGFP reporter gene was transfected into MLE12 cells, and the green fluorescence expression of EGFP was observed by fluorescence microscope after 48h of transfection. The results showed that the transfection effect of CaP / Cas9 / PLGA was comparable to that of Lipo3000. The results showed that PLGA had certain transfection ability and could play the effect of intracellular drug delivery.

[0086] As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene. Figure 10

[0087] As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene. Figure 11 As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene.

[0088] Figure 12 As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene.

[0089] As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene. Figure 13 As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene.

[0090] Figure 14 As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene.

[0091] As shown in the protein level, the WB results found that CaP / Cas9 / PLGA could effectively down-regulate the protein level of SPP1 gene.

[0092] ​​​Establishment of a bleomycin-induced mouse pulmonary fibrosis model: A mouse model of pulmonary fibrosis (IPF mouse) was established by a single intratracheal injection of bleomycin sulfate (BLM) at a dose of 1.5 U / kg.

[0093] Biodistribution Study: To observe the distribution of CaP / Cas9 / PLGA NPs in IPF mice, free Did or Did-labeled CaP / Cas9 / PLGA nanoparticles diluted 10,000 times were nebulized intratracheally into the lungs of mice. The distribution of nanoparticles in the mice was recorded over 48 hours using an in vivo fluorescence imaging system (IVIS, PerkinElmer). After imaging, the mice were euthanized, and major organs (heart, liver, spleen, lung, and kidney) were removed for in vitro fluorescence imaging. The lung lobes were further separated and imaged based on their structure. The fluorescence intensity of Did was quantified using Living Image analysis software. The distribution of nebulized CaP / Cas9 / PLGA in lung cells was determined using immunofluorescence. After 48 hours of nebulized administration of cy5-labeled CaP / Cas9 / PLGA, mice were sacrificed and lung tissue was dissected. Paraffin sections were then prepared and primary antibodies (cd31, cd68, SFTPC) were added to label endothelial cells, macrophages, and type II lung epithelial cells, respectively. Secondary antibodies were then added, and cell nuclei were counterstained with DAPI. After mounting, the sections were imaged and analyzed using a confocal scanner.

[0094] In vivo anti-pulmonary fibrosis effect of CaP / Cas9 / PLGA: To investigate the therapeutic effect of CaP / Cas9 / PLGA NPs on pulmonary fibrosis in mice, male C57BL / 6 mice were randomly divided into 5 groups: 1) healthy group, 2) PBS, 3) PLGA, 4) Cas9 (2 mg / kg), 5) Cas9 / PLGA (containing 2 mg / kg of Cas9), and 5) CaP / Cas9 / PLGA (containing 2 mg / kg of Cas9). Following bleomycin injury, the mice were administered the drug via nebulized lung treatment every 3 days for 3 weeks. Mouse weight was recorded regularly, and survival rates in different treatment groups were analyzed. Mice were euthanized on day 21 after bleomycin modeling, and lung tissue was collected for imaging and serum for biochemical analysis. Simultaneously, T7E1 levels and Western blot analysis were performed on the processed lung tissue.

[0095] Enzyme-linked immunosorbent assay (ELISA): Accurately weigh an appropriate amount of mouse lung lobe, add RIPA lysis buffer and grind, centrifuge at 18000g for 20 min at 4°C. Collect the supernatant of the lysate. Then, centrifuge at 2000g for 15 min at 4°C and collect the supernatant. After a series of dilutions, determine the levels of TGF-β1 and IL-1β in the supernatant according to the ELISA kit instructions.

[0096] Hydroxyproline level: The detection of hydroxyproline level was performed by using hydroxyproline (HYP) content detection kit (AK139, Beijing Boao Sun Bio). According to the method of the instruction, the mouse lung lobe was cut and lysed with extraction solution, and the supernatant was detected at 560 nm.

[0097] Histological analysis: To evaluate the degree of inflammation and fibrosis of the mouse lung tissue, paraffin-embedded lung sections were subjected to H&E staining and Masson staining. The left lung was quickly immersed in 4% paraformaldehyde for 24 hours. Half of the lung was dehydrated and embedded in paraffin, and then analyzed by H&E and Masson staining. The remaining lung was dehydrated with a sucrose gradient, embedded in OCT compound, and then frozen sectioned for immunofluorescence staining. For immunohistochemical analysis, tissue sections were treated with the appropriate primary antibody (SPP1 antibody), then incubated with DAKO secondary antibody, and then stained with hematoxylin and mounted with neutral resin for microscopic examination. The above sections were semi-quantitatively analyzed by ImageJ software, and the differences were statistically analyzed.

[0098] In vivo safety evaluation: To further evaluate the safety of CaP / Cas9 / PLGA application toxicity, C57BL / 6 mice were randomly divided into two groups, and were aerosolized with CaP / Cas9 / PLGA (2 mg / kg) or normal saline solution, respectively. At different time points (1 day, 7 days and 14 days), blood was collected for serum biochemical analysis and blood routine analysis, and major organs were dissected for H&E staining analysis.

[0099] Experimental results:

[0100] As shown in Figure 15 , after CaP / Cas9 / PLGA-Dye was aerosolized into IPF mice, CaP / Cas9 / PLGA-Dye had good lung accumulation ability. Further investigation of the distribution of nanoparticles in the lung lobe showed that the distribution of nanoparticles in the left lung lobe was the most, followed by Cranial and Caudal, which was proportional to the area of the lung lobe.

[0101] As shown in Figure 16 , further immunofluorescence staining of lung tissue was performed to investigate the distribution of cells reached by nanoparticle uptake. The results showed that CaP / Cas9 / PLGA could be distributed in lung epithelial cells. Therefore, CaP / Cas9 / PLGA allows Cas9 therapeutic drugs to penetrate deeply into lung tissue, and can effectively mediate Cas9-based gene editing therapy in the lung.

[0102] As shown in Figure 17As shown, daily weight was recorded as a measure of disease burden. The results indicate that after CaP / Cas9 / PLGA treatment, the mice's weight remained relatively stable during the treatment period. Survival statistics during the treatment period also demonstrate that CaP / Cas9 / PLGA effectively inhibits the fibrosis process, with a survival rate reaching 80%.

[0103] like Figure 18 As shown, preliminary histological examination after treatment revealed hemorrhagic necrosis in the bleomycin-treated group, while the CaP / Cas9 / PLGA-treated group exhibited significantly reduced hemorrhagic necrosis, milder pulmonary edema, and lung morphology similar to that of healthy mice. H&E staining results showed that, compared with the PBS, PLGA NPs, or Cas9 control groups, Cas9 / PLGA and CaP / Cas9 / PLGA NPs treatments significantly reduced the severity of bleomycin-induced fibrosis by protecting alveolar epithelial structure, with CaP / Cas9 / PLGA showing better results. Masson staining and Immunohistochemistry staining revealed that after inhalation of CaP / Cas9 / PLGA NPs, lung tissue showed less inflammatory cell infiltration and alveolar dilation, significantly reduced collagen deposition and parenchymal destruction, and decreased OPN expression levels.

[0104] like Figure 19 As shown, TGF-β1 and IL-1β are key pro-fibrotic mediators in the development of fibrosis and participate in various pathological processes such as apoptosis, myofibroblast differentiation, and collagen deposition. Enzyme-linked immunosorbent assay (ELISA) of TGF-β1 and IL-1β in lung tissue fluid revealed that, compared with the untreated group, the levels of these two inflammatory factors in the CaP / Cas9 / PLGA treatment group increased only slightly, indicating that CaP / Cas9 / PLGA NPs treatment significantly inhibited the bleomycin-induced increase in TGF-β1 and IL-1β. Furthermore, we quantified the concentration of hydroxyproline using a hydroxyproline kit; hydroxyproline is known to reflect the progression of pulmonary fibrosis. Notably, a significantly reduced hydroxyproline concentration was detected in the lungs of mice treated with CaP / Cas9 / PLGA, demonstrating the excellent therapeutic effect of CaP / Cas9 / PLGA in alleviating bleomycin-induced pulmonary fibrosis.

[0105] like Figure 20 As shown, the in vivo cleavage rate was verified by the T7EI experiment, revealing that gene editing occurred exclusively in the lungs, with an editing rate of 17.92%, indicating that CaP / Cas9 / PLGA can mediate specific in vivo gene editing. Deep sequencing of lung tissue revealed that 11.25% of the DNA contained mutations, deletions, and insertions.

[0106] As shown in Figure 21 , the protein expression levels of lung tissue ACTA2, COL1A1, SPP1 were studied by Western blot analysis, and it was found that the expression level of SPP1 was reduced. The results show that CaP / Cas9 / PLGA can precisely target and knock out SPP1, and reduce the level of bleomycin-induced pulmonary fibrosis.

[0107] As shown in Figure 22 , the main organs of mice in each group were taken on the 21st day of treatment for H&E staining, and the results showed that compared with the healthy control group, the CaP / Cas9 / PLGA treatment group had no toxicity and no obvious damage to the tissues.

[0108] As shown in Figure 23 , the results of serum and blood biochemical analysis also showed that there were no abnormal indicators in the CaP / Cas9 / PLGA treatment group, and the results showed that CaP / Cas9 / PLGA was safe for in vivo application.

[0109] The above examples are only to illustrate the technical concept and characteristics of the present application, so that those skilled in the art can understand the content of the present application and implement it, and cannot limit the protection scope of the present application. Any equivalent changes and modifications made according to the essence of the present application should be covered within the protection scope of the present application.

Claims

1. The application of PLGA nanoparticles encapsulating CRISPR / Cas9 recombinant plasmids in the preparation of drugs for the prevention or treatment of idiopathic pulmonary fibrosis, characterized in that, The sequence of the recombinant plasmid is shown in SEQ ID NO.

1. The PLGA nanoparticles have a particle size of 150 nm. The drug is formulated as an aerosol formulation. The preparation method of the PLGA nanoparticles loaded with the CRISPR / Cas9 recombinant plasmid is achieved through the following steps: (1) Design sgRNA based on the selected SPP1 gene, anneal the designed sgRNA, digest the backbone plasmid containing clustered regularly spaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 system with BpiI restriction endonuclease, and then ligate the sgRNA with the digested fragment to construct the SPP1-sgRNA / Cas9 recombinant plasmid (Cas9). The sequence of the designed sgRNA is gcagaatctccttgcgccacagg, and the sequence of the backbone plasmid is SEQ ID NO.

2. (2) Calcium nitrate and diammonium hydrogen phosphate are reacted to produce calcium phosphate (CaP) solution, and then CaP and Cas9 are mixed, stirred at low temperature for 5 minutes, and ultrafiltered to obtain CaP / Cas9 complex; the mass ratio of CaP to Cas9 is 1:

32. (3) Dissolve the carrier material polylactic acid-glycolic acid copolymer (PLGA) in dichloromethane, add the CaP / Cas9 composite solution to the carrier material solution, and sonicate in an ice bath to prepare a water-in-oil primary emulsion solution; the molar ratio of lactic acid and glycolic acid monomers in the copolymer is 50:50; (4) Add 2% polyvinyl alcohol aqueous solution to the colostrum solution, and sonicate in an ice bath to obtain a water-in-oil-in-water double emulsion solution; (5) Pour the double emulsion solution into a 0.1% polyvinyl alcohol aqueous solution and stir at 250 rpm for 6 hours at room temperature to solidify the microspheres. Finally, centrifuge at 4 °C to collect the nanoparticles and obtain PLGA nanoparticles loaded with CRISPR / Cas9 recombinant plasmid.

2. The application according to claim 1, characterized in that, The sequence of the sgRNA designed in step (1) of the preparation method is gcagaatctccttgcgccacagg; The designed sgRNA and its complementary sequence were synthesized, and restriction enzyme sites were added to both ends. The synthesized sequence is as follows: SPP1-sgRNA-F caccggcagaatctccttgcgccacagg (SEQ ID NO.3) SPP1-sgRNA-R aaaccctgtggcgcaaggagattctgc (SEQ ID NO.4) In step (1), the sgRNA annealing temperature gradient was set as follows: 95℃, 10min; 95℃ - 85℃, 2.5℃ / s; 85℃ - 25℃, 0.25℃ / s; 25℃, 5min.

3. The application according to claim 1, characterized in that, In step (1) of the preparation method, the enzyme digestion conditions for the backbone plasmid are 37℃ for 2h, and the conditions for ligating sgRNA with the enzyme-digested plasmid are 16℃ for 30min.

Images