Small molecule compound targeting hepatic stellate cells, targeting drug and application of small molecule compound and targeting drug

Abstract

The invention discloses a hepatic stellate cell targeting small molecule compound, a targeting drug and application thereof, and belongs to the technical field of biological medicine. The small molecule compound GalNAz-AA comprises an N3 release group and a hepatic stellate cell targeting group, the structural formula of the small molecule compound GalNAz-AA is as follows: # imgabs0 #, R is a halobenzamide or formamide group containing thiohemiacetal, and the small molecule compound GalNAz-AA has a hepatic stellate cell targeting function. The GalNAz-AA prepared by the preparation method disclosed by the invention has very good ROS responsiveness and can be used for efficiently releasing the azide sugar in an active oxygen environment; and through the structural design of the R group, the azide sugar can be targeted to different tissue cells. Meanwhile, the invention also verifies that the GalNAz-AA can more effectively detect the liver fibrosis compared with other liver fibrosis detection means, and peripheral early liver fibrosis can be found.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a small molecule compound targeting hepatic stellate cells, a targeted drug and uses thereof. Background Art

[0002] Liver fibrosis is a typical chronic liver disease. Many pathological factors lead to liver inflammation, and chronic liver inflammation is the direct cause of liver fibrosis. For example, viral infection, excessive alcohol intake, obesity, metabolic disorders, cholestatic injury, diabetes, and autoimmune diseases. Liver fibrosis is a key step in the development of various chronic liver diseases to cirrhosis, and it is also an important link affecting the prognosis of chronic liver disease. If liver fibrosis is discovered in time, it can be reversed, thereby blocking the formation of cirrhosis. So far, no drug specifically for the treatment of liver fibrosis has been approved for marketing, so the development of effective diagnosis and treatment methods for liver fibrosis is very important for the treatment of chronic liver disease.

[0003] Since liver fibrosis has no obvious clinical symptoms, its diagnosis is very difficult. Currently, liver biopsy is the "gold standard" for diagnosing and evaluating liver fibrosis, but liver biopsy has many limitations. Because of the heterogeneous distribution of liver fibrosis, there are objective sampling errors in biopsy specimens, and the requirements for biopsy specimens are high and difficult to operate. More importantly, liver biopsy is an invasive examination with secondary risks such as infection and injury. At present, the non-invasive evaluation methods for liver fibrosis include: serum markers, biochemical indicators, B-ultrasound, CT, MRI and other conventional imaging methods. However, these methods have failed to better reflect the molecular pathological changes such as the phenotype and quantity changes of activated cells during the repair process of chronic liver damage, and there are inconsistencies in reliability, sensitivity, operability, etc., which are difficult to meet the clinical requirements for real-time dynamic evaluation of liver fibrosis diagnosis and treatment effects. On this basis, the liver fibrosis comprehensive scoring system can improve the accuracy of a single detection method by combining existing clinical detection methods. For example, combining different indicators of blood markers: by combining markers that directly reflect the fibrosis process and indirect markers that reflect liver function damage and regeneration to infer the degree of fibrosis, a comprehensive score is calculated, such as APRI (AST to Platelet Ratio Index). Imaging diagnosis is also often combined with blood markers to assist in the diagnosis of liver fibrosis, and its examination methods include ultrasound elastography, magnetic resonance elastography, and CT scans. Based on the results of comprehensive imaging examinations and serum markers, a non-invasive scoring system has been established to assess the degree of liver fibrosis. For example: FibroScan, etc. This method greatly improves the probability of detecting liver fibrosis, but the biochemical indicators have poor specificity and many factors have different assessment accuracy for different fibrosis patients, and the comprehensive fibrosis score still cannot meet clinical requirements. Therefore, it is of great clinical significance to develop a non-invasive method to diagnose and evaluate liver fibrosis.

[0004] Fluorescence imaging technology plays an important role in modern biomedical research and clinical practice with its advantages of high sensitivity, multi-color imaging capability, real-time monitoring and non-invasiveness. It can help researchers diagnose diseases, evaluate treatment effects, deeply explore disease mechanisms and biomarkers, and provide key information for personalized medicine. Therefore, it has a wide range of application potential in disease detection, diagnosis and treatment monitoring. Therefore, among the many non-invasive liver fibrosis detection methods, the fluorescence imaging system is undoubtedly one of the most promising methods to replace liver fibrosis biopsy due to its high sensitivity, rapidity, simplicity, real-time imaging and strong penetration.

[0005] Although people have a relatively clear understanding of the pathological process of liver fibrosis, how to use these studies to guide the treatment of fibrotic diseases is still a huge challenge. Hepatic stellate cells (HSC) play an important role in the detection and treatment of liver fibrosis. Liver fibrosis is mainly manifested by excessive secretion of extracellular matrix (ECM) by HSC. When chronic inflammation occurs in the liver, immune cells are activated and further secrete chemokines to activate HSC. aHSC (actived hepatic stellate cell) will cause imbalance in liver cell renewal by secreting excessive ECM and inhibiting the activity of matrix metalloproteinases. aHSC secretes a large amount of extracellular matrix, including type I and III glial deposits, forming fibrous scars to replace the normal structure of the liver. In addition, the ECM secreted by aHSC is deposited near the sinusoidal window, causing the structure of the sinusoidal window to change, the hepatic sinusoids gradually become capillary, and the hepatic sinusoidal window will gradually shrink and eventually disappear. At present, the activation of HSC is recognized to play a decisive role in the process of liver fibrosis. Therefore, how to reverse the activation of aHSC has become the key to treating liver fibrosis. Targeting aHSC can directly reflect the degree of liver fibrosis and is not easily interfered by other disease factors. The occurrence and progression of liver fibrosis can be determined by detecting aHSC.

[0006] During the activation process, HSCs will transform into fibroblasts, a process that will lead to the upregulation or downregulation of the corresponding gene signaling pathways. Therefore, compared to small molecule drugs that can only work at the protein level, siRNA technology can reverse the activation of HSCs at the mRNA level, alleviating or even reversing the occurrence and development of liver fibrosis. Florian Winau's team at Harvard University found that the occurrence of liver fibrosis is often accompanied by the expression of GARP (Glycoprotein Arepetitions predominant) protein on HSC cells. GARP protein directly activates HSC by binding to TGF-β (Transforming growth factor-β), the strongest activator of HSC. They successfully blocked the occurrence of liver fibrosis in mice by knocking out the GARP gene in mice. In addition, knocking out the GARP gene does not cause severe inflammatory reactions in mice, which has advantages over knocking out the TGF-β gene.

[0007] However, due to the lack of specificity, effective targeting of aHSC is a major challenge. Currently, there are two main ways to target aHSC, namely passive targeting and active targeting. Among them, passive targeting is achieved by changing the physical characteristics of the drug carrier, such as particle size and shape. This targeting method will lead to non-specific accumulation of non-targeted organs and tissues, great differences in the distribution of drugs in different individuals, and the inability to distinguish between HSCs in a static state and an activated state. In addition, the constructed macromolecules are difficult to cross the extracellular matrix barrier rich in liver fibrosis. This targeting efficiency is often low and accompanied by side effects. Therefore, most researchers use an active targeting strategy to target aHSC. This method generally modifies the drug carrier with VA, folic acid, RGD peptide or aptamer, but the complex surface modification inevitably increases the particle size and preparation difficulty of the drug carrier, which makes it difficult for nanoparticles to penetrate the fibrotic barrier. In addition, this single targeting design still has the phenomenon of poor targeting and off-target. Therefore, it is urgent to develop a new aHSC targeting method. Summary of the invention

[0008] In view of the above-mentioned deficiencies in the prior art, the present invention provides a small molecule compound targeting hepatic stellate cells, a targeted drug and uses thereof, which solve the shortcomings of low drug penetration and poor targeting of current drugs for detecting liver fibrosis.

[0009] The technical principle of the present invention is as follows: The small molecule compound GalNAz-AA designed by the present invention is a small molecule that can penetrate well across the fibrosis barrier, so that the azido sugar molecules accumulate in the lesion site. Then the benzamide ligand modified by GalNAz-AA can target and distinguish aHSC. Finally, due to the high expression of ROS in the inflammatory site, the hemiketal bond in GalNAz-AA can release azido sugar (GalNAz) through ROS responsive cleavage. GalNAz can participate in cell metabolism, so that the orthogonal group N3 is modified on the membrane protein and does not affect normal physiological activities. Bioorthogonal chemistry refers to a series of chemical reactions that occur in organisms. These reactions have unique characteristics: they do not interact or interfere with any naturally occurring molecules or chemical processes in the organism. Bioorthogonal reactions can be carried out in complex biological environments without being affected by background biological activities. This dual-responsive design structure allows GalNAz-AA to target and identify liver fibrosis sites and highly express N3. We only need to modify the DBCO group on the fluorescent probe to specifically covalently bind to N3 on the surface of aHSC in liver fibrosis without specifically binding to other cells. The method of GalNAz-AA labeling liver fibrosis provides a good solution for liver fibrosis detection and targeted treatment. The present invention provides an azidogalactose derivative and its preparation method and application. The compound can effectively target aHSC and express N3 receptors on the cell surface. Based on this, this patent uses the reported cell-penetrating poly (disulfide)s (VECTOR) as a carrier to treat liver fibrosis. On the basis of VECTOR, the carrier is modified with DBCO group to target the N3 group outside the aHSC membrane, and the carrier carries the GARP (Lrrc32) gene to enter the cytoplasm through the thiol-mediated pathway. The carrier can degrade and release siRNA under the action of GSH in the cell. This membrane-penetrating method can reduce the problem of gene degradation caused by the lysosomal pathway.

[0010] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is: The purpose of the present invention is to provide a small molecule compound (GalNAz-AA) targeting hepatic stellate cells, which includes an N3 releasing group and a group targeting hepatic stellate cells, and its structural formula is as follows:

[0011] Wherein, R is a halobenzamide or formamide group containing hemithioacetal, which has the function of targeting hepatic stellate cells.

[0012] Furthermore, in the structural formula, C2 is in R or S configuration.

[0013] Furthermore, the R group targets the sigma-1 receptor on hepatic stellate cells.

[0014] Further, the structural formula of R is as follows: , , , , , , , , , or .

[0015] Further, the obtained compound is as follows: , , , , , , , , , , .

[0016] Further, R is an anisidine ligand, and its structural formula is as follows: .

[0017] Another object of the present invention is to provide a method for preparing the above-mentioned small molecule compound, the specific process is as follows: (1) Preparation of benzoic acid derivatives modified with different substituents Ⅰ Dissolve p-methoxybenzoic acid (760 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) in 100 mL (40 eq) of acetonitrile solution and react for 12 h. Remove the solvent, add 50 mL of deionized water to the residue, stir for 3 h, and filter. Collect the solid and freeze-dry it.

[0018]

[0019] (2) Preparation of benzoic acid derivatives modified with different substituents II o-Iodobenzoic acid (1240 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) were dissolved in 100 mL (40 eq) of acetonitrile solution and reacted for 12 h. The solvent was removed, 50 mL of deionized water was added to the residue and stirred for 3 h, and filtered. The solid was collected and freeze-dried.

[0020]

[0021] (3) Preparation of benzoic acid derivatives modified with different substituents III 2-Fluorobenzoic acid (700 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) were dissolved in 100 mL (40 eq) of acetonitrile solution and reacted for 12 h. The solvent was removed, 50 mL of deionized water was added to the residue and stirred for 3 h, and filtered. The solid was collected and freeze-dried.

[0022]

[0023] (4) Preparation of benzoic acid derivatives modified with different substituents IV Methyl 3-iodo-4-methoxybenzoate (1460 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) were dissolved in 100 mL (40 eq) of acetonitrile solution and reacted for 12 h. The solvent was removed, 50 mL of deionized water was added to the residue and stirred for 3 h, and filtered. The solid was collected and freeze-dried.

[0024]

[0025] (5) Preparation of benzoic acid derivatives modified with different substituents V Dissolve p-iodobenzoic acid (1240 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) in 100 mL (40 eq) of acetonitrile solution and react for 12 h. Remove the solvent, add 50 mL of deionized water to the residue, stir for 3 h, and filter. Collect the solid and freeze-dry it.

[0026]

[0027] (6) Preparation of benzoic acid derivatives VI modified with different substituents Dissolve p-fluorobenzoic acid (700 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) in 100 mL (40 eq) of acetonitrile solution and react for 12 h. Remove the solvent, add 50 mL of deionized water to the residue, stir for 3 h, and filter. Collect the solid and freeze-dry it.

[0028]

[0029] (7) Preparation of intermediate I Dissolve mercaptomethylamine (316 mg, 5 mmol, 1.0 eq) and 2-iodoethane-1-amine (850 mg, 5 mmol, 1.0 eq) in 100 mL of dichloromethane solution and react for 12 h; remove the solvent and perform silica gel column chromatography with methanol: dichloromethane = 1:30 to obtain the product.

[0030]

[0031] (8) Preparation of anisidine derivative ligand Ⅰ At room temperature, mercaptoethylamine hydrochloride (154 mg, 2 mmol, 2.0 eq) was dissolved in MeOH, and then 200 μL of triethylamine was added; and 2,5-dioxopyrrolidin-1-yl 4-methoxybenzoate (249 mg, 1 mmol, 1.0 eq) was added. After reacting overnight, TLC monitored the completion of the reaction, the solvent was removed, and the product was obtained by silica gel column chromatography with ethyl acetate: petroleum ether = 1:1.

[0032]

[0033] (9) Preparation of anisidine derivative ligand II At room temperature, intermediate Ⅰ (212 mg, 2 mmol, 2.0 eq) was dissolved in MeOH, and then 200 μL of triethylamine was added; and 2,5-dioxopyrrolidin-1-yl 4-methoxybenzoate (249 mg, 1 mmol, 1.0 eq) was added. After reacting overnight, the reaction was completed as monitored by TLC, and the solvent was removed. The product was obtained by silica gel column chromatography with ethyl acetate: petroleum ether = 1:1.

[0034]

[0035] (10) Preparation of anisidine derivative ligand III At room temperature, mercaptomethylamine (126 mg, 2 mmol, 2.0 eq) was dissolved in MeOH, and then 200 μL of triethylamine was added; and 2,5-dioxopyrrolidin-1-yl 4-methoxybenzoate (249 mg, 1 mmol, 1.0 eq) was added. After reacting overnight, TLC monitored the completion of the reaction, the solvent was removed, and the product was obtained by silica gel column chromatography with ethyl acetate: petroleum ether = 1:1.

[0036]

[0037] (11) Preparation of intermediate V At room temperature, galactosamine hydrochloride (179 mg, 1 mmol, 1.0 eq) was dissolved in MeOH solution, and then 200 μL of triethylamine was added, and finally N, N-carbonyldiimidazole (2.0 eq) was slowly added to the reaction solution. After reacting at room temperature for 12 hours, the reaction was complete after TLC detection, and the solvent was removed by reduced pressure distillation. The solid residue was purified by column chromatography to obtain the target compound.

[0038]

[0039] (12) Preparation of intermediate VI At room temperature, intermediate II (262 mg, 1 mmol, 1.0 eq) was dissolved in 10 mL pyridine solution, and 5 mL acetic anhydride and 20 mg DMAP were added in sequence. The mixture was stirred at room temperature for 12 h. After the reaction was completed by TLC monitoring, the solvent was removed; the residue was poured into 1 M HCl aqueous solution and extracted with DCM; the organic phase was washed with saturated NaHCO3 and NaCl aqueous solutions in sequence, and then dried with anhydrous sodium sulfate; the solvent was removed, and the solid was purified by column chromatography to obtain the target product.

[0040]

[0041] (13) Synthesis of small molecule compounds Under anhydrous and oxygen-free conditions, firstly, the intermediate III (430 mg, 1 mmol, 1.0 eq) was dissolved in an ultra-dry DCM solution, then placed in a -20°C cold trap, and boron trifluoride (1 mL) was slowly added, followed by the intermediate I, and the reaction bottle was placed in an ice-water bath for 12 hours. After TLC detection, the reaction solvent was removed by vacuum distillation to obtain a crude product. The crude product was purified by column chromatography to obtain the target compound.

[0042]

[0043] Another object of the present invention is to provide the use of the above small molecule compound in the preparation of hepatic stellate cell targeting drugs.

[0044] Another object of the present invention is to provide the use of the above-mentioned small molecule compound in the preparation of targeted drugs for detecting or treating liver fibrosis.

[0045] Another object of the present invention is to provide a targeted drug for treating liver fibrosis, which comprises the above-mentioned small molecule compound and a drug for treating liver fibrosis that targets and recognizes the N3 group released by the small molecule compound.

[0046] Furthermore, liver fibrosis therapeutic drugs target the N3 group released by small molecule compounds through the modified DBCO gene.

[0047] Furthermore, the liver fibrosis treatment drug uses a vector loaded with the GARP gene as a carrier, and modifies the DBCO gene thereon, which can degrade and release siRNA under the action of GSH in the cell.

[0048] Furthermore, the drug for treating liver fibrosis also includes a vector loaded with a siGARP sequence, and the vector is modified with a DBCO gene.

[0049] Further, the siGARP sequence is as follows: siGARP-F: 5'-GUACUAGACUUGAGCCUGCA-3'; siGARP-R: 5'-UGCAGCUCAAGUCUAGUACCT-3'.

[0050] Beneficial effects of the present invention: The azidosugar derivative prepared by the present invention has good ROS responsiveness and can efficiently release azidosugar in an active oxygen environment; and by designing the structure of the R group, azidosugar can be targeted to different tissue cells, for example, the modified σ-1R targeting small molecule anisidine mentioned in the present invention can effectively target GalNAz-AA to aHSC. The dual switch design of active targeting receptors and passive ROS responsive release greatly improves the specificity of GalNAz-AA, and the unique design makes GalNAz-AA have an efficient labeling efficiency for liver fibrosis. Small molecules can effectively cross liver fibrosis pathological tissues (narrowed sinus windows, dense extracellular matrix), not only can strongly target aHSC, but also can distinguish between quiescent HSC and aHSC, and then use the characteristics of the liver fibrosis microenvironment to break GalNAz-AA and release azidosugar to label aHSC. At the same time, the present invention also verifies that GalNAz-AA can more effectively detect liver fibrosis than other liver fibrosis detection methods, and can detect early liver fibrosis at four weeks. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1For the ROS-responsive fragmentation and ROS consumption detection of GalNAz-AA; Figure 2 For GalNAz-AA targeting aHSC detection; Figure 3 GalNAz-AA targeted specific labeling of liver fibrosis in mice liver detection; Figure 4 Research on gene loading for gene vector VECTOR; Figure 5 The effect of GalNAz-AA on the uptake efficiency of Vector@Cy5-siNC; Figure 6 To detect the knockout ability of siGARP on target protein; Figure 7 To detect the inhibitory function of siGARP on extracellular matrix; Figure 8 To detect the inhibitory function of siGARP on aHSC cell proliferation; Fig. 9 The cell scratch assay was used to detect the effect of GalNAz-AA on the efficacy of Vector@ siGARP; Fig.10 To detect the effect of GalNAz-AA on Vector@ siGARP efficacy and siGARP knockout efficiency; Fig.11 This was an in vitro experiment to detect the effect of GalNAz-AA on the efficacy of Vector@ siGARP. DETAILED DESCRIPTION

[0052] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0053] The present invention uses a vector (DBCO-CPD) for experiments, and its chemical structure is: , where n=13~30.

[0054] The preparation method is: (1) Preparation of monomer M1 Dissolve lipoic acid (784 mg, 3.8 mmol) and N,N-carbonyldiimidazole (812 mg, 5.0 mmol) in 25 mL of methanol. Add a certain amount of diethylamine arginine methanol solution. The reaction mixture is reacted for 4 hours under nitrogen protection, and then the solvent is removed and purified using silica gel column chromatography methanol: dichloromethane V:V = 1:9 to obtain monomer M1.

[0055]

[0056] (2) Preparation of polymer vector The prepared initiator DBCO-PEG-SH (2 mg), monomer M1 (1 mmol, 377.54 mg), buffer (5 mL) and terminator iodoacetamide (90 mg) were reacted for 20 minutes to generate a polymer. The product was dialyzed using a dialysis bag with a molecular weight of 10 kDa, and the water was changed every 12 hours during the 48-hour dialysis. Finally, the product in the dialysis bag was collected and lyophilized to obtain the product Vector.

[0057]

[0058] Its NMR data are: 1 H NMR (400 MHz, D2O) δ 7.22 (s, 8H), 4.37 (d, J = 7.7 Hz, 15H), 3.72 (s, 45H), 3.65 (s, 180H). The structural formula of the fluorescent label probe used in the present invention is:

[0059] Example 1 Synthesis of GalNAz-AA The specific process of synthesizing GalNAz-AA is as follows: (1) Synthesis of 2,5-dioxopyrrolidin-1-yl 4-methoxybenzoate Dissolve p-methoxybenzoic acid (760 mg, 5 mmol, 1.0 eq), N,N'-disuccinimidyl carbonate (1280 mg, 5 mmol, 1.0 eq) and pyridine (395 mg, 5 mmol) in 100 mL (40 eq) of acetonitrile solution and react for 12 h. Remove the solvent, add 50 mL of deionized water to the residue, stir for 3 h, and filter. Collect the solid and freeze-dry it.

[0060]

[0061] (2) Preparation of intermediate Ⅰ At room temperature, mercaptoethylamine hydrochloride (154 mg, 2 mmol, 2.0 eq) was dissolved in MeOH, and then 200 μL of triethylamine was added; and 2,5-dioxopyrrolidin-1-yl 4-methoxybenzoate (249 mg, 1 mmol, 1.0 eq) was added. After reacting overnight, TLC monitored the completion of the reaction, the solvent was removed, and the product was obtained by silica gel column chromatography with ethyl acetate: petroleum ether = 1:1.

[0062]

[0063] (3) Preparation of intermediate II At room temperature, galactosamine hydrochloride (179 mg, 1 mmol, 1.0 eq) was dissolved in MeOH solution, and then 200 μL of triethylamine was added, and finally N, N-carbonyldiimidazole (2.0 eq) was slowly added to the reaction solution. After reacting at room temperature for 12 hours, the reaction was complete after TLC detection, and the solvent was removed by reduced pressure distillation. The solid residue was purified by column chromatography to obtain the target compound.

[0064]

[0065] (4) Preparation of intermediate III At room temperature, intermediate II (262 mg, 1 mmol, 1.0 eq) was dissolved in 10 mL pyridine solution, and 5 mL acetic anhydride and 20 mg DMAP were added in sequence. The mixture was stirred at room temperature for 12 h. After the reaction was completed by TLC monitoring, the solvent was removed; the residue was poured into 1 M HCl aqueous solution and extracted with DCM; the organic phase was washed with saturated NaHCO3 and NaCl aqueous solutions in sequence, and then dried with anhydrous sodium sulfate; the solvent was removed, and the solid was purified by column chromatography to obtain the target product.

[0066]

[0067] (5) Synthesis of small molecule compounds Under anhydrous and oxygen-free conditions, firstly, the intermediate III (430 mg, 1 mmol, 1.0 eq) was dissolved in an ultra-dry DCM solution, then placed in a -20°C cold trap, and boron trifluoride (1 mL) was slowly added, followed by the intermediate I, and the reaction bottle was placed in an ice-water bath for 12 hours. After TLC detection, the reaction solvent was removed by vacuum distillation to obtain a crude product. The crude product was purified by column chromatography to obtain the target compound.

[0068] .

[0069] Example 2 Detection of ROS-responsive fragmentation and consumption of GalNAz-AA 1. Set p-methoxybenzoic acid (AA), GalNAz, GalNAz-AA and GalNAz-AA into four groups in order, and dilute them to a concentration of 1 mM with PBS solution for later use. Then add H2O2 to the GalNAz-AA solution of the fourth group to make the H2O2 concentration reach 10 mM, and incubate for 24 hours. After the incubation is completed, add excess sodium pyruvate to consume the remaining H2O2, and then filter the above four sample solutions with a 50 μm filter membrane, and use HPLC to analyze the solution components. The chromatographic conditions are: ACN: H2O = 4:6. Among them, the detection wavelength of groups 1, 3, and 4 is 254 nm; the detection wavelength of group 2 is 190nm. After exporting the elution curve, draw a graph, and the results are shown in Figure 1 Figure a in the middle.

[0070] like Figure 1 As shown in Figure a, the retention times of the three substances are different, the elution conditions can distinguish different substances, and the GalNAz-AA peak disappeared after adding H2O2 in the fourth group, which indicates that H2O2 may cause the decomposition of GalNAz-AA.

[0071] 2. Weigh five equal amounts of GalNAz-AA, dissolve the above substances in PBS to make the concentration of GalNAz-AA 10mM, and add H2O2 to the above five groups of solutions at the same time to make the concentration of 10mM. Take the above solutions at the corresponding time 0, 1, 2, 4, and 6, and use 2,7-dichlorodihydrofluorescein diacetate (H2DCF-DA) as the detection probe to test the ROS content in the solution at a specific time. In order to convert H2DCF-DA to 2,7-dichlorodihydrofluorescein (H2DCF), add 0.25mL of H2DCF-DA ethanol solution (1 mM) to 1mL of NaOH (10 mM) aqueous solution, and then stir at room temperature for 30 min. Then adjust the pH of the solution with 5mL PBS solution (pH 7.4), freeze the obtained solution for future use, add the solutions of the five time periods to the above solution, and the final concentration is 10mM. Place the sample in a fluorescence spectrometer to test the fluorescence intensity of the solution, (λ ex :488nm), the results are shown in Figure Figure 1 Figure b.

[0072] like Figure 1 As shown in Figure b, the ROS content in the solution gradually decreased with time, indicating that GalNAz-AA can quickly consume ROS in the solution.

[0073] 3. Prepare four groups of GalNAz-AA PBS solutions with a concentration of 1 mM. Add H2O2 to three of the solutions to make the H2O2 content in the solution 10 mM, 1 mM, and 0.5 mM, respectively. Take four groups of solutions at 12 h, 24 h, 36 h, 48 h, and 60 h, add excess sodium pyruvate to consume the remaining H2O2, and then filter the above four sample solutions with a 50 μm filter membrane. Use HPLC to analyze the solution components. Chromatographic conditions: ACN: H2O = 4:6; detection wavelength 254 nm. After obtaining the elution peak area, quantitatively calculate the GalNAz-AA content in the solution. The results are shown in the figure. Figure 1 Figure e.

[0074] like Figure 1 As shown in Figure e, as the H2O2 concentration increases, the decomposition rate of GalNAz-AA increases significantly, indicating that GalNAz-AA will decompose rapidly under high concentrations of ROS, reflecting its excellent ROS-responsive breaking ability.

[0075] 4. Flow cytometry analysis of the intracellular reactive oxygen species level consumed by GalNAz-AA When HSC reached the logarithmic growth phase, trypsin was used to digest HSC from the cell culture dish, centrifuged, and the supernatant was discarded to obtain the HSC cell mass and resuspended. Serum-containing high-glucose medium (DMEM) was added for dilution, and 100 μL of the cell suspension was added to a 96-well plate so that the cell density in the well plate reached 80% when the drug was added. The plated cells were divided into three groups ((1) qHSC, (2) aHSC, (3) aHSC+GalNAz-AA), and LPS was added to groups (2) and (3) 24 h in advance to activate HSC. After activation, GalNAz-AA was added to (3) to make its concentration reach 50 mM. After incubation for 12 h, the culture medium in each well was aspirated, and the cells were washed three times with PBS. Then, serum-free DMEM containing 10 μM H2DCF-DA was added and incubated for 30 min. The cells were then washed three times with Facs Buffer. 25 μL of mild trypsin was added to each well and incubated for three minutes. After the incubation, 75 μL of Facs Buffer was added to each well to blow down the cells. The cells were filtered with a cell filter membrane, and the filtrate was analyzed by flow cytometry. The FL-1 channel was selected. The results are shown in Figure 1. Figure 1 Middle d figure.

[0076] like Figure 1 As shown in Figure d, after HSC is activated by LPS, the level of intracellular reactive oxygen species increases significantly, and the addition of GalNAz-AA can clear the intracellular reactive oxygen species, demonstrating its excellent reactive oxygen species scavenging effect.

[0077] 5. Fluorescence microscopy demonstrates the ability of GalNAz-AA to remove intracellular reactive oxygen species According to step 4, the plated cells were divided into three groups ((1) qHSC, (2) aHSC, (3) aHSC+GalNAz, (4) aHSC+GalNAz-AA). LPS was added to groups (2), (3), and (4) 24 h in advance to activate HSC. After activation, GalNAz was added to (3) to a concentration of 50 mM and GalNAz-AA was added to (4) to a concentration of 50 mM. After incubation for 12 h, the medium in each well was aspirated and the cells were washed three times with PBS. Serum-free DMEM containing 10 μM H2DCF-DA was then added and incubated for 30 min. The medium in each well was aspirated and the cells were washed three times with Facs Buffer. The fluorescence intensity of each group was photographed using a fluorescence microscope. Figure 1 Figure e in the middle shows that GalNAz does not consume intracellular reactive oxygen species, but the addition of GalNAz-AA can clear intracellular reactive oxygen species, demonstrating its excellent reactive oxygen species clearing effect.

[0078] Example 3 Validation of GalNAz-AA targeting aHSC 1. Screening of GalNAz-AA azide-labeled aHSC concentration According to the fourth step of Example 2, the plates were plated. First, 100 ng / mL LPS was added to the aHSC group and incubated for 24 h to activate HSC. GalNAz-AA was then added to each of the aHSC and qHSC groups so that the concentrations in the wells were 40 mM, 50 mM, 60 mM, and 70 mM, respectively. After incubation for 24 h, the culture medium of each well was aspirated, washed 3 times with PBS, and then serum-containing DMEM containing 5 μM DBCO-Cy 5 was added to each well and incubated for 1 h. The culture medium of each well was aspirated, washed 3 times with Facs Buffer, and 25 μL of mild trypsin was added to each well and incubated for three minutes. After the incubation, 75 μL of Facs Buffer was added to each well to blow down the cells, filtered with a cell filter, and the filtrate was analyzed by flow cytometry, and the channel selected was the FL-4 channel. Since DBCO-Cy 5 can selectively covalently bind to N3 expressed on the cell surface, the cell fluorescence intensity of each group can be used to evaluate the expression level of N3 on the cell surface. The results are shown in Figure 2 Figure a in the middle.

[0079] As shown in Figure a, compared with the qHSC+GalNAz-AA group, the fluorescence intensity of aHSC+GalNAz-AA was significantly higher than that of qHSC, proving that DBCO-Cy 5 has a good binding efficiency with aHSC, which is attributed to the good N3 labeling efficiency of GalNAz-AA for aHSC. And through concentration screening, GalNAz-AA 50 mM was determined to be the optimal concentration.

[0080] 2. Confocal laser scanning verifies the selective labeling of aHSC by GalNAz-AA When HSC reached the logarithmic growth phase, trypsin was used to digest HSC from the cell culture dish, centrifuged, and the supernatant was discarded to obtain the HSC cell mass and resuspended. Serum-containing high-glucose medium (DMEM) was added for dilution, and 1 mL of the cell suspension was added to a laser confocal microplate (Φ=10 mm) so that the cell density in the well plate reached 80% when the drug was added. The plated cells were divided into 6 groups ((1) qHSC, (2) qHSC+GalNAz, (3) qHSC+GalNAz-AA, (4) aHSC+GalNAz, (5) aHSC+GalNAz-AA, (6) aHSC+GalNAz-AA+HP). (4), (5), and (6) were added with 100 ng / mL LPS in advance and incubated for 24 h to activate HSC. Then HP (haloperidol, a σ-1R specific blocker) was added to group (6) 2 h in advance. GalNAz and GalNAz-AA were then added to the corresponding groups so that the drug concentration in each well was 50 mM. After incubation for 12 h, the culture medium of each well was aspirated, the cells were washed three times with PBS, and serum-containing DMEM containing 5 μM DBCO-Cy 5 was added to the small dish and incubated for 1 h. The culture medium of each well was aspirated, the cells were washed three times with PBS, and DMEM complete culture medium containing 1 μg / mL Hoechst 33342 was added to the small dish and incubated for 10 minutes. The culture medium of each well was aspirated, the cells were washed three times with PBS, and laser confocal imaging was used. The results are shown in Figure 2. Figure 2 Figure b.

[0081] As shown in Figure b, the unmodified GalNAz has a good labeling efficiency for both aHSC and qHSC, proving its lack of selectivity, while GalNAz-AA has a good labeling efficiency only for aHSC, proving the aHSC-selective labeling ability of GalNAz-AA. After using the σ-1R-specific blocker HP, the labeling efficiency of GalNAz-AA for aHSC decreased significantly, indicating that GalNAz-AA is mainly taken up by aHSC mediated by σ-1R.

[0082] 3. Flow cytometry detection of cellular reactive oxygen levels in different groups According to the fourth step of Example 2, the plated cells were plated and divided into three groups ((1) qHSC, (2) qHSC+200 μM H2O2, (3) qHSC+100 ng / L LPS). First, 200 μM H2O2 or 100 ng / mL LPS was added to the corresponding group and incubated for 24 h to activate HSC. The culture medium in each well was aspirated, and then washed three times with PBS. Then, serum-free DMEM containing 10 μM H2DCF-DA was added and incubated for 30 minutes. Then, it was washed three times with Facs Buffer. 25 μL of mild trypsin was added to each well and incubated for three minutes. After the incubation, 75 μL Facs Buffer was added to each well to blow down the cells, and the cells were filtered with a cell filter membrane. The filtrate was analyzed by flow cytometry, and the FL-1 channel was selected. The results are shown in FIG. Figure 2 Figure c.

[0083] As shown in Figure c, LPS will cause an increase in reactive oxygen species in HSC cells. Therefore, the ROS in aHSC cells makes it easier for GalNAz-AA to break and release azido sugar, which participates in the cell's metabolic process and expresses more N3 on the cell surface.

[0084] 4. Flow cytometry flow shift plots verify the labeling efficiency and selectivity of GalNAz-AA Plate the cells as described above and divide the plated cells into 5 groups ((1) qHSC, (2) qHSC+GalNAz, (3) qHSC+GalNAz-AA, (4) aHSC+GalNAz, (5) aHSC+GalNAz-AA). (4) and (5) 100 ng / mL LPS was added in advance and incubated for 24 h to activate HSC, and then GalNAz and GalNAz-AA were added to the corresponding groups so that the drug concentration in each well was 50 mM. After incubation for 12 h, the culture medium of each well was aspirated, and the cells were washed three times with PBS. Then, serum-containing DMEM containing 5 μM DBCO-Cy 5 was added to the small dish and incubated for 1 h. The culture medium of each well was aspirated, and the cells were washed three times with Facs Buffer. 25 μL of mild trypsin was added to each well and incubated for three minutes. After the incubation, 75 μL Facs was added to each well. The cells were blown off the buffer, filtered with a cell filter, and the filtrate was analyzed by flow cytometry, and the channel was selected as FL-4 channel. The unmodified group GalNAz has good labeling efficiency for both aHSC and qHSC, proving its lack of selectivity, while GalNAz-AA has good labeling efficiency only for aHSC, proving the selective labeling ability of GalNAz-AA for aHSC ( Figure 2 (middle d figure).

[0085] 5. Labeling effect of GalNAz-AA on different cells When RAW, EC, and LO2 reached the logarithmic growth phase, the plates were plated as described above, and GalNAz and GalNAz-AA were added to the corresponding groups so that the drug concentration in each well was 50 mM. After incubation for 12 hours, the culture medium of each well was aspirated, and the cells were washed three times with PBS. Serum-containing DMEM containing 5 μM DBCO-Cy 5 was added to each well and incubated for 1 hour. The culture medium of each well was aspirated, and then washed three times with Facs Buffer. 25 μL of mild trypsin was added to each well and incubated for three minutes. After the incubation, 75 μL Facs Buffer was added to each well to blow down the cells, and the cells were filtered with a cell filter membrane. The filtrate was analyzed by flow cytometry, and the FL-4 channel was selected as the channel. The results showed that GalNAz had good labeling efficiency for the three cells, and compared with the wide labeling ability of GalNAz, the labeling ability of GalNAz-AA for the three cells was much lower than that of GalNAz ( Figure 2 (Fig. e).

[0086] 6. GalNAz-AA targeted specific labeling of the liver of mice with liver fibrosis Eight-week-old male C57BL / 6 mice (20±2 g) were used as experimental animals. The mice were weighed and divided into (1) Normal, (2) CCl4, (3) CCl4+GalNAz 4 Week, (4) CCl4+GalNAz-AA 4 Week, and (5) CCl4+GalNAz-AA 4 Week. For (2), (3), (4), and (5), a solution of CCl4 and olive oil was prepared at a volume ratio of 1:3 and intraperitoneally injected at a dose of 4 mL / kg twice a week for 2 and 4 weeks, respectively, to establish a liver fibrosis mouse model. After the modeling was completed, the corresponding groups were injected with GalNAz (64.6 mg / kg, dissolved in 200 μL PBS) or GalNAz-AA (87.2 mg / kg, dissolved in 200 μL PBS) through the tail vein once a day for 3 days. Then, DBCO-Cy5 (5 mg / kg, dissolved in 200 μL PBS) was injected into the tail vein of mice in (2), (3), (4), and (5). After 24 hours, in vivo imaging was performed using an in vivo imaging system. The mice were anesthetized with isoflurane, and their hair was removed with a depilatory cream. In vivo imaging was performed using the in vivo imaging system with a maximum excitation / emission wavelength of 748 / 780 nm. The results are shown in Figure 3 Figure a in the middle.

[0087] Figure a shows that the results show that the mouse modeling presented a good liver fibrosis model in the 4th week, and also showed that GalNAz-AA was able to effectively label and detect the liver of fibrotic mice, while other mice had no liver labeling ability, indicating that GalNAz-AA successfully detected liver fibrosis in the 4-week modeling. At the same time, in order to eliminate other interferences such as hair and excrement, the corresponding in vitro imaging analysis was performed using organs (heart, liver, spleen, lungs, and kidneys) removed after killing the mice. The above-mentioned mouse organs were isolated and imaged using an in vivo imager. The results show that GalNAz-AA can specifically label the liver of mice with liver fibrosis and has good liver targeting ( Figure 3 (middle panel b).

[0088] Example 4 Gene vector VECTOR 1. Explore the ratio of vector to gene combination The amount of siRNA was fixed at 100 ng, and the binding of the vector to the gene was investigated under different ratios of the molar amount of guanidine groups in VECTOR to the molar amount of phosphate groups in siRNA (R / P). A certain amount of vector VECTOR was taken and ultrasonically dissolved in ultrapure water (nuclease-free, sterile) to prepare a solution. According to the R / P value, VECTOR was mixed with 100 ng of siRNA solution, and 20 mM Hepes buffer (pH 7.2) was added to dilute it to a final concentration of 2 mM to prepare a nanoparticle solution with a final volume of 20 μL. The solution was mixed with a vortex mixer, centrifuged at 1000 rpm for 1 min, and then placed on a shaker at 37 °C for 30 min to successfully prepare VECTOR / siRNA nanoparticles. Nanoparticles with different R / P values ​​(0, 10, 20, 30, 40, 50, 60) were prepared according to the above steps. Weigh 0.6 g of agarose into a conical flask, add 60 mL of 1×TBE buffer to the flask, heat until the agarose is completely dissolved, cool to about 50°C, add 2.6 μL of EB nucleic acid dye and mix. Slowly pour the agarose gel into the tray with a comb inserted, and let it stand at room temperature until the gel is completely solidified. Pull out the comb vertically, place the gel and tray into the electrophoresis tank, and add 1×TBE Buffer to the tank until the agarose gel is covered. Add 4 μL of 6×DNA loading buffer to the prepared 20 μL VECTOR / siRNA solution and mix. Take 20 μL of the mixture and add it to the loading wells in turn, set the voltage to a constant 100 V, and electrophoresed for 50 minutes. Finally, the siRNA blocking situation was observed by the fully automatic gel imaging system. The results showed that the vector and the gene were completely combined at an R / P of 40, indicating the good gene-carrying capacity of the vector (see Figure 4 (a in the middle).

[0089] 2. Prepare 130 μL of nanoparticles with an R / P of 40 according to step 1, divide the nanoparticle solution into 6 portions, 20 μL each, add a certain amount of sodium heparin aqueous solution (nuclease-free, sterile) to each portion so that the 5 portions of nanoparticle solution contain 0, 0.1, 1, 2, 5, and 10 μg of sodium heparin. After mixing, place in a 37 ℃ constant temperature shaker and incubate at 70 rpm for 1 h. Then perform siRNA gel electrophoresis as described in 4a) and analyze the bands using an automatic gel imaging system. The results show that the carrier can release the bound siRNA in the presence of sufficient sodium heparin (see Figure 4 (middle panel b).

[0090] 3. Prepare 50 μL of nanoparticle solution with a VECTOR / siRNA mass ratio of 40 as in step 1. Divide the nanoparticle solution into 2 portions, 20 μL each, add 2 μL of ultrapure water (nuclease-free, sterile) and 220 mM GSH to each portion of the nanoparticle solution, mix well, and place in a 37 ℃ constant temperature shaker, incubate at 70 rpm for 4 h. Then perform siRNA gel electrophoresis as described in step 1 and analyze the bands using an automatic gel imaging system. The results show that the VECTOR vector can break and release the bound gene in the presence of GSH (see Figure 4 (Fig. c).

[0091] 4. Prepare nanoparticles with siRNA concentration of 100 nM and R / P values ​​of 50 and 100 according to step 1, and make the final volume 200 μL. After preparation, the nanoparticle size and potential were measured using a Malvern nanometer. The results showed that the size of the prepared nanoparticles was about 160 nm. As the VECTOR ratio increased, the corresponding zeta potential also increased accordingly (see Figure 4 (d~f in the middle).

[0092] Example 5 Effect of GalNAz-AA on Vector@Cy5-siNC Uptake 1. Explore the efficiency of HSC uptake of nanoparticles at different R / P values Plate the cells in the manner of step 4 of Example 1, and prepare nanoparticles with different R / P values ​​(10, 20, 30, 40, 50), 50 μL of each nanoparticle. Plate the cells as in step 1d), aspirate the culture medium after adhesion, wash three times with PBS, add 95 μL of opti-DMEM to each well, and then add 5 μL of nanoparticles to the corresponding wells to make the siRNA concentration 100 nM. Incubate in the incubator for 4 h before taking out, washing three times with Facs Buffer, adding 25 μL of mild trypsin to each well and incubating for 3 minutes, then adding 75 μL of Facs Buffer, blowing the cells down and filtering with a cell filter, the filtrate was analyzed by flow cytometry, and the FL-4 channel was selected as the channel. The results showed that when the R / P value was 40, HSC had the greatest uptake of nanoparticles, so nanoparticles with an R / P of 40 were selected for subsequent experiments ( Figure 5 (a in the middle).

[0093] 2. Study on the uptake efficiency of GalNAz-AA on Vector@Cy5-siNC After plating as described above, GalNAz-AA was added to the corresponding group to make its concentration 50 mM, incubated for 24 h, the culture medium was aspirated, PBS was washed three times, 95 μL Opti-MEM was added to each well, and then 5 μL nanoparticles were added to the corresponding wells to make the siRNA concentration 100 nM. After incubation in the incubator for 4 h, it was taken out and washed three times with Facs Buffer. After adding 25 μL of mild trypsin to each well and incubating for 3 minutes, 75 μL Facs Buffer was added, the cells were blown down and filtered with a cell filter membrane, and the filtrate was analyzed by flow cytometry, and the FL-4 channel was selected as the channel. The results showed that GalNAz-AA did not promote the uptake of nanoparticles by qHSC, presumably because of the low N3 labeling of qHSC by GalNAz-AA. However, the high N3 labeling of aHSC by GalNAz-AA greatly promoted the uptake of nanoparticles by aHSC ( Figure 5 (middle panel b).

[0094] 3. Flow cytometry to investigate the membrane penetration mechanism of vector / siRNA nanoparticles Plate the plates as described above, and add 80 μL of Opti-MEM to each well. Take a plate and add 10 μL of different transmembrane inhibitors to each well, and place at 37°C for 30 min. The inhibitors are thiol uptake inhibitor 5,5'-dithiobis(2-nitrobenzoic acid) (4.8 nM), clathrin-dependent endocytosis inhibitor chlorpromazine (30 μM), clathrin-independent endocytosis inhibitor β-cyclodextrin (25 μM), and Na + / H +The exchanger inhibitor amiloride (15 nM) was placed at 37°C for 30 min. Subsequently, 10 μL Vector / Cy5-siRNA (Cy5-siRNA final concentration was 100nM, R / P=40) and PEI / siRNA nanoparticles were added to each group of cells after different treatments, and the cells were treated for 4 h. After incubation in the incubator for 4 h, the cells were taken out and washed three times with Facs Buffer. After adding 25 μL of mild trypsin to each well and incubating for 3 minutes, 75 μL Facs Buffer was added, the cells were blown down and filtered with a cell filter membrane, and the filtrate was analyzed by flow cytometry, and the FL-4 channel was selected as the channel. The use of the endocytosis inhibitor CPZ significantly reduced the uptake efficiency of PEI, while the addition of DTNB greatly inhibited the uptake of Vector nanoparticles but had no obvious inhibitory effect on the uptake of PEI nanoparticles, indicating that VECTOR mainly enters the cell through the thiol-mediated pathway ( Figure 5 (Fig. c).

[0095] Example 6 siGARP knockout function detection 1. Use a 12-well plate to plate the cells as described above; add GalNAz-AA to the corresponding group in advance so that its concentration in the culture medium is 50 mM, and culture for 24 h; aspirate the culture medium, wash three times with PBS, add 950 μL Opti-MEM, and add 50 μL Vector@ siGARP to the corresponding group so that the concentration in the culture medium is 100 mM. After 4 h of culture, add 100 μL fetal bovine serum, and then add 1000 μL complete culture medium and culture for 24 h. Wash the cells once with sterile PBS, and then use the Steady Pure rapid RNA extraction kit to extract RNA, synthesize cDNA, and amplify by qt-PCR. Take the control group as 1, and calculate the CT value of each sample. The results show that siGARP can significantly knock down the expression of mGARP in activated HSCs, and the knockout efficiency is the highest when GalNAz-AA is used to mark the cells in advance ( Figure 6 (a in the middle).

[0096] Table 1 Primer sequences Forward Reverse siGARP GUACUAGACUUGAGCUGCA UGCAGCUCAAGUCUAGUACCT mLrrc32mCOL1α1mGAPDH CTGTAGGACGGTGAACAAGGACATGTTCAGCTTTGTGGACCCCAAGGTCAACCATGACAAC GGACAAGTAGAGAGCTTGGATGCTGTAACATGGAAACTGGGGAAATCCACAGTCTTCTGAGTGG 2. Use confocal microplates to plate the cells as described above; add GalNAz-AA to the corresponding group in advance to make the concentration in the culture medium 50 mM, and culture for 24 h; aspirate the culture medium, wash three times with PBS, add 950 μL Opti-MEM, add 50 μL Vector@ siGARP to the corresponding group to make the concentration in the culture medium 100 mM, culture for 4 h, add 100 μL fetal bovine serum, and then add 1000 μL complete culture medium and culture for 48 h. The cells were washed once with sterile PBS, fixed with paraformaldehyde for 15 min, washed with sterile PBS 3 times, 5 min each time, and then permeabilized with 0.5% triton-X-100 solution prepared in PBS for 10 min. After permeabilization, they were washed with PBS 3 times, 5 min each time, and blocked with an appropriate volume of serum for 30 min. They were incubated with HSP47 primary antibody solution diluted in PBS at 4°C overnight, washed with PBS 3 times, 5 min each time, and then incubated with fluorescent secondary antibody solution diluted in PBS at room temperature in the dark for 1 h. After washing with PBS 3 times and distilled water once, the cell slides were fixed on the slides with DAPI-containing mounting medium, and then examined with a laser confocal microscope. The results showed that siGARP can effectively knock out the expression of GARP protein in activated HSCs, and the knockout efficiency was the highest when GalNAz-AA was used to mark the cells in advance ( Figure 6 (middle panel b).

[0097] 3. siGARP inhibits extracellular matrix production After the in vitro liver fibrosis model was constructed in the 12-well plate as described above, GalNAz-AA was added to the corresponding wells of the 12-well plate to make the concentration in the culture medium 50 mM. After incubation in the incubator for 24 h, the culture medium was aspirated, washed with PBS three times, 950 μL Opti-MEM was added, and 50 μL Vector@siGARP was added to each well of the transwell to make the siGARP concentration in the culture medium 100 nM. After incubation for 4 h, 100 μL fetal bovine serum and 1 mL complete culture medium were added to the well plate, and then incubated for another 44 h; taken out, washed with PBS three times, each well was fixed with paraformaldehyde for 15 min, aspirated, and washed three times with PBS; 0.5% Trton-X-100 PBS solution was added for permeabilization for 10 min, aspirated, and washed three times with PBS; after incubation with hematoxylin and eosin for 1 h, washed three times with PBS, and photographed under a microscope. The results showed that when HSC is activated, it will develop into fibroblasts, and aHSC will secrete a large amount of extracellular matrix, which is the direct cause of fibrosis. Collagen1 is an important component of it. Hematoxylin can stain Collagen1. By studying the content of Collagen1, we can know that siGARP can silence aHSC and inhibit the secretion of aHSC extracellular matrix ( Figure 7 ).

[0098] 4. Inhibitory effect of siGARP on aHSC proliferation (1) The effects of GalNAz-AA, vectors and nanoparticles on the viability of HUVEC, L02 and L929 cells were investigated and divided into the following four groups: a) different concentrations of GalNAz-AA were set to study its cytotoxicity; b) different concentrations of vector alone were set to study its cytotoxicity; c) the siRNA concentration was 100 nM, and nanoparticles with different molar ratios of gene to vector were set to study its cytotoxicity; d) the siRNA concentration was 100 nM, the GalNAz-AA concentration was 50 nM, and nanoparticles with different molar ratios of gene to vector were set to study its cytotoxicity.

[0099] After preparation, add cells seeded in a 96-well plate 24 hours in advance with a density of about 60% and containing 90 μL of opti-MEM medium. After incubation for 4 hours, add 100 μL of complete DMEM medium containing 10% FBS and 10 μL of FBS, and culture for 44 hours. Aspirate the medium, add 100 μL of medium and 10 μL of CCK-8 solution to each well, incubate at 37°C for 30 min until the solution in the well plate turns into orange-yellow water-soluble formazan, and measure the OD value at 450 nm with a microplate reader. The cell viability calculation formula is as follows: Cell viability = (OD (drug addition) - OD (blank)) / (OD (0 drug addition) - OD (blank)) × 100% The results showed that GalNAz-AA, carriers and nanoparticles have high biosafety ( Figure 8 (a~d in the middle).

[0100] (2) To investigate the effect of nanoparticles on the cells, live-dead staining was used for evaluation. siRNA was replaced with the therapeutic siHSP47 sequence or the non-therapeutic siNC sequence, and the final concentration was set to 100 nM. Plates were prepared according to the grouping, and the killing effects of single nanoparticles, GalNAz-AA and nanoparticles on aHSC-T6 cells and qHSC-T6 cells activated by LPS for 24 hours were investigated after 4 hours of culture in reduced serum medium and then in complete culture medium. Live-dead staining was used to visually investigate the killing effect of nanoparticles. After the nanoparticles acted on the activated HSC-T6 cells for 48 hours, they were stained with Calcein-AM working solution and propidium iodide (PI) staining solution, and imaged using a fluorescence microscope ( Figure 8 (Fig. e).

[0101] Example 7 Effect of GalNAz-AA on the therapeutic effect of Vector@ siGARP 1. Cell scratch test Use 96-well plates to plate in the above manner; add GalNAz-AA to the corresponding group in advance so that its concentration in the culture medium is 50 mM, and culture for 24 hours; aspirate the culture medium, wash three times with PBS, add 95 μL Opti-MEM, and add 5 μL Vector@ siGARP to the corresponding group so that the concentration in the culture medium is 100 mM. After 4 hours of culture, add 10 μL fetal bovine serum, and then add 100 μL complete culture medium and culture for 44 hours. Take out the cell well plate and use a 200 μL pipette tip to gently scratch the cells in the well plate, wash three times with PBS, and take pictures; add serum-free culture medium containing 10 ng / mL TGF-β and culture for 12 hours, then take out and take pictures. Quantitative analysis using imageJ showed that after HSC was activated, its proliferation ability became stronger, and the siGARP gene could reverse the activation of HSC and reduce the proliferation ability of HSC, and the treatment effect of Vector@ siGARP was better after being labeled with GalNAz-AA in advance ( Fig. 9 ).

[0102] 2. Experiment on inhibition of TGF-β production (1) Use 96-well plates to plate in the above manner; add GalNAz-AA to the corresponding group in advance so that its concentration in the culture medium is 50 mM, and culture for 24 hours; aspirate the culture medium, wash three times with PBS, add 95 μL Opti-MEM, and add 5 μL Vector@ siGARP to the corresponding group so that the concentration in the culture medium is 100 mM. After 4 hours of culture, add 10 μL fetal bovine serum, and then add 100 μL complete culture medium and culture for 44 hours. Aspirate and collect the culture medium, centrifuge at 10000 rpm for 5 minutes, and use the TGF-β Elisa kit to measure the TGF-β content in the culture medium in the supernatant. The results show that TGF-β secretion will be greatly increased after HSC activation, while Vector@siGARP can inhibit HSC activation, thereby reducing HSC secretion of TGF-β, and the treatment effect of Vector@siGARP is better after being labeled with GalNAz-AA in advance ( Fig.10 (a in the middle).

[0103] (2) Use 12-well plates to plate the cells as described above; add GalNAz-AA to the corresponding group in advance so that its concentration in the culture medium is 50 mM, and culture for 24 h; aspirate the culture medium, wash three times with PBS, add 950 μL Opti-MEM, and add 50 μL Vector@ siGARP to the corresponding group so that the concentration in the culture medium is 100 mM. After 4 h of culture, add 100 μL fetal bovine serum, and then add 1000 μL complete culture medium and culture for 24 h. Wash the cells once with sterile PBS, and then use the Steady Pure Rapid RNA Extraction Kit to extract RNA, synthesize cDNA, and amplify by qt-PCR. The control group was taken as 1, and the CT value of each sample was calculated. The results show that siGARP can significantly knock down the expression of mGARP in activated HSCs, and the knockdown efficiency is the highest when GalNAz-AA is used to mark the cells in advance ( Fig.10 (middle panel b).

[0104] 3. In vitro liver fibrosis microenvironment (1) Constructing a fibrotic barrier in vitro The modeling method is as follows: HSCs are plated in the 24-well plate in advance according to 1d), and 10 ng / mL TGF-β is used to activate the corresponding group of HSCs. A transwell dish is placed on the well plate, and the matrix gel is diluted by 1:1 with DMEM basal medium and centrifuged to mix the matrix gel and medium. 100ul of matrix gel is added to each well of the 24-well transwell plate, and the gel is evenly distributed by shaking, and placed in a cell culture incubator for 60 minutes to solidify. HUVEC cells are digested according to 1d), and 250μL of the cell suspension is added to the transwell and incubated in the incubator for 6h ( Fig.11 (a in the middle).

[0105] (2) After constructing the in vitro liver fibrosis model, GalNAz-AA was added to the corresponding wells to make the concentration in the culture medium reach 50 mM. After culturing in the incubator for 24 h, the culture medium was aspirated, the cells were washed three times with PBS, 180 μL Opti-MEM was added, and 20 μL Vector@Cy5-siNC was added to each transwell well to make the Cy5-siNC concentration in the culture medium reach 100 nM. After culturing for 4 h, the culture medium was aspirated, the cells were washed three times with Facus Buffer, the HSC cells in the well plate were digested and collected, and the fluorescence intensity was analyzed using a flow cytometer.

[0106] like Fig.11As shown in Figure b, the addition of GalNAz-AA to qHSC does not improve the cell uptake efficiency, while the activated aHSC does not increase the nanoparticle uptake efficiency. After incubation with the addition of GalNAz-AA, the aHSC uptake of nanoparticles has increased significantly. This indicates that GalNAz-AA can significantly improve the nanoparticle uptake efficiency of aHSC, which is attributed to the good N3 labeling efficiency of GalNAz-AA for aHSC, which enables aHSC to have excellent uptake efficiency for nanoparticles at low concentrations.

[0107] (3) After adding a cell slide to the 12-well plate in advance, after constructing an in vitro liver fibrosis model, GalNAz-AA was added to the corresponding wells of the 12-well plate to make the concentration in the culture medium 50 mM. After culturing in the incubator for 24 hours, the culture medium was aspirated, washed with PBS three times, and 950 μL Opti-MEM was added. Then 50 μL Vector@siGARP was added to each well of the transwell to make the siGARP concentration in the culture medium 100 nM. After culturing for 4 hours, 100 μL fetal bovine serum and 1 mL complete culture medium were added to the well plate and cultured for another 44 hours; taken out, washed with PBS three times, each well was fixed with paraformaldehyde for 15 minutes, aspirated, and washed three times with PBS; 0.5% Trton-X-100 PBS solution was added to permeabilize for 10 minutes, aspirated, and washed three times with PBS; after incubating with phalloidin solution for 1 hour, washed three times with PBS, the slide was taken out and sealed with DAPI-containing sealing medium, and photographed using laser confocal microscopy. The results are shown in Fig.11 As shown in Figure c, when HSC is activated, it will develop towards fibroblasts. α-SMA is a marker of fibroblasts, and phalloidin can specifically label α-SMA (F-actin). Vector@siGARP can slow down the activation of aHSC, while administration of aHSC labeled in advance with GalNAz-AA can reverse the activation of aHSC, indicating that GalNAz-AA can also improve the therapeutic effect of Vector@siGARP in the fibrotic barrier.

[0108] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A small molecule compound targeting hepatic stellate cells, characterized in that: It includes an N3 releasing group and an R group targeting hepatic stellate cells, and its structural formula is as follows: ； Wherein, R is a halobenzamide or formamide group containing hemithioacetal.

2. The small molecule compound according to claim 1, characterized in that In the structural formula, C2 is in R or S configuration.

3. The small molecule compound according to claim 1 or 2, characterized in that: The R group targets the sigma-1 receptor on hepatic stellate cells.

4. The small molecule compound according to claim 3, characterized in that: The R structure is as follows: , , , , , , , , , or .

5. Use of the small molecule compound according to any one of claims 1 to 4 in the preparation of a hepatic stellate cell targeting drug.

6. Use of the small molecule compound according to any one of claims 1 to 4 in the preparation of a targeted drug for detecting or treating liver fibrosis.

7. A targeted drug for treating liver fibrosis, characterized in that: The invention comprises the small molecule compound according to any one of claims 1 to 4 and a drug for treating liver fibrosis which targets and recognizes the N3 group released by the small molecule compound.

8. The targeted drug for treating liver fibrosis according to claim 7, characterized in that: The liver fibrosis treatment drug targets and recognizes the N3 group released by a small molecule compound through a modified DBCO gene.

9. The targeted drug for treating liver fibrosis according to claim 8, characterized in that: The liver fibrosis treatment drug also includes a vector loaded with a siGARP sequence, and the vector is modified with a DBCO gene.

10. The targeted drug for treating liver fibrosis according to claim 8, characterized in that: The siGARP sequence is as follows: siGARP-F: 5'-GUACUAGACUUGAGCCUGCA-3'; siGARP-R: 5'-UGCAGCUCAAGUCUAGUACCT-3'.

Images