Rice booting stage cold resistance related protein OsCIP1 and coding gene and application thereof

Abstract

The invention relates to the technical field of biology, and discloses a rice booting stage cold resistance related protein OsCIP1 and a coding gene and application thereof. The OsCIP1 protein is as shown in F1, F2 or F3 as follows: F1) a protein with an amino acid sequence as shown in SEQ ID NO.2; f2) protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the protein of F1), has 75% or more of identity with the protein shown in F1) and has the activity of regulating and controlling the cold tolerance of rice in the seedling stage; and F3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of F1) or F2). The OsCIP1 protein provided by the invention can improve the cold resistance of rice at the booting stage, is of great significance to new variety cultivation, environmental sanitation and grain safety, and has great application and popularization values.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a rice cold tolerance-related protein OsCIP1 at the booting stage, a coding gene and an application thereof. Background Art

[0002] Rice is one of the three major food crops in the world, and more than half of the world's population relies on rice for food. Rice is a crop that originated in tropical and subtropical areas and is very sensitive to temperature throughout its growth stage. In recent years, the frequency of global climate anomalies has increased, and rice production reduction events caused by low temperatures have been increasing. Low temperatures have become one of the unfavorable factors restricting rice production.

[0003] Rice chilling injury refers to the phenomenon that rice encounters continuous or short-term low temperatures below the critical temperature, causing the growth of rice to be delayed. In severe cases, it can also cause damage to the nutritional or reproductive organs, resulting in the failure of rice to develop normally and reduce production. According to the period of occurrence of chilling injury, rice chilling injury can be divided into chilling injury in the bud stage, chilling injury in the seedling stage, and chilling injury in the reproductive growth period (booting stage and flowering stage). Reproductive growth period chilling injury refers to the phenomenon that rice is subjected to low temperature stress from the beginning of reproductive growth to flowering, which eventually leads to abnormal pollen development, anthers cannot normally crack and scatter pollen, and pollen scattered on the stigma cannot germinate and fertilize normally, which then affects normal flowering and pollination and forms empty grains. Since the occurrence period of chilling injury in the booting stage and flowering stage is very close, it is sometimes difficult to strictly separate the two in actual production. The two are often collectively referred to as chilling injury in the booting and flowering stages. Among them, the chilling injury encountered during the booting stage is particularly important because it will cause irreversible losses to yield.

[0004] Therefore, cold damage at the booting stage is the most serious period affecting rice yield, and research on cold tolerance at the booting stage of rice is of great significance. However, the use of traditional breeding methods to cultivate cold-tolerant rice varieties takes a long time and progress is relatively slow. The use of genetic engineering technology can directly transform the genetic background of plants at the gene level and transform the genetic traits of plants in a targeted manner. Discovering cold-tolerant genes at the booting stage of rice is of great theoretical and practical significance for breeding new cold-tolerant rice varieties. Summary of the invention

[0005] In view of this, the present invention provides a rice cold tolerance related protein OsCIP1 at the booting stage and its encoding gene and application. In order to solve the problem that the traditional breeding method for cultivating cold-tolerant rice varieties in the prior art has a long cycle and slow progress, in order to achieve the above purpose, the present invention adopts the following technical solutions:

[0006] One object of the present invention is to provide a rice cold tolerance related protein OsCIP1 at the booting stage and a coding gene.

[0007] The protein provided by the present invention, named OsCIP1, is as follows 1), 2) or 3):

[0008] 1) having the amino acid sequence shown in SEQ ID NO: 2;

[0009] 2) A protein derived from the amino acid sequence shown in 1) by substitution and / or deletion and / or addition of one or more amino acid residues and having the same function as 1);

[0010] 3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of 1) or 2).

[0011] The above-mentioned substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0012] In the above application, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc. The amino acid sequences of some of the available tags are shown in Table 1.

[0013] Table 1 Tag sequences

[0014] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tagII 8 WSHQ c-myc 10 EQKLISEEDL

[0015] The nucleic acid molecules encoding the above proteins are also within the scope of protection of the present invention.

[0016] The nucleic acid molecule is any one of the following 1) to 3):

[0017] 1) The coding region is the nucleotide sequence as described in SEQ ID NO: 1;

[0018] 2) a nucleic acid molecule that hybridizes with the nucleotide sequence defined in 1) under stringent conditions and encodes a protein having the same function;

[0019] 3) A nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the nucleotide sequence defined in 1) or 2) and encodes a protein with the same function.

[0020] The above stringent conditions may be hybridization at 65°C in a solution of 6×SSC, 0.5% SDS, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0021] The recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the above nucleic acid molecule are also within the scope of protection of the present invention.

[0022] The above recombinant vector is a fragment between the SpeI and KpnI restriction sites on the expression vector pCM1307-FLAG replaced by the genomic DNA of the OsCIP1 gene as shown in SEQ ID NO: 3 to obtain the recombinant vector Ubi::OsCIP1 (ie, the OsCIP1 overexpression recombinant vector).

[0023] Primer pairs for amplifying the full length of the above-mentioned nucleic acid molecule or any fragment thereof are also within the scope of protection of the present invention.

[0024] The use of the above protein, the above nucleic acid molecule or the above recombinant vector, expression cassette, transgenic cell line or recombinant bacteria in regulating plant stress resistance is also within the scope of protection of the present invention;

[0025] Or the use of the above-mentioned protein, the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacteria in cultivating transgenic plants with improved stress resistance is also within the scope of protection of the present invention.

[0026] In the above application, the stress resistance is resistance to low temperature; the low temperature is specifically 16-17°C;

[0027] The plant is a monocot or a dicot;

[0028] The monocotyledonous plant is specifically rice.

[0029] Another object of the present invention is to provide a method for cultivating transgenic plants with improved stress resistance.

[0030] The method provided by the present invention comprises the following steps: introducing the nucleic acid molecule encoding the above protein into the target plant to obtain a transgenic plant, wherein the stress resistance of the transgenic plant is higher than that of the target plant.

[0031] In the above method, the stress resistance is resistance to low temperature.

[0032] In the above method, the stress resistance of the transgenic plant is higher than that of the target plant, which is reflected in that the fruit setting rate of the transgenic plant is higher than that of the target plant under low temperature stress at the booting stage;

[0033] The low temperature is specifically 16-17°C;

[0034] The plant is a monocot or a dicot;

[0035] The monocotyledonous plant is specifically rice.

[0036] Compared with the prior art, the beneficial effects of the present invention are: improving the cold tolerance of rice at the booting stage, shortening the period of cultivating cold-tolerant rice at the booting stage, and providing new gene resources for cultivating new cold-tolerant rice varieties.

[0037] The present invention provides an application of OsCIP1 protein in regulating the cold tolerance of rice at the booting stage. The present invention improves the cold tolerance of rice at the booting stage, has important significance for new variety breeding, environmental sanitation and food safety, and has great application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0039] Figure 1 This is a schematic diagram of the screening process of OsCIP1 in Example 1 of the present invention;

[0040] Figure 2 The expression pattern of OsCIP1 in different tissues of the rice variety Kunming Xiaobaigu in Example 1 of the present invention, the internal reference is the OsActin1 gene, and spikelets 1, 3, 5, 7, 10, and 15 represent spikelets with lengths of 1 cm, 3 cm, 5 cm, 7 cm, 10 cm, and 15 cm, respectively;

[0041] Figure 3 This is an analysis diagram of the expression pattern of OsCIP1 under cold stress conditions in the ear of the rice variety Kunming Xiaobai in Example 1 of the present invention, and the internal reference is the OsActin1 gene;

[0042] Figure 4 The results of real-time fluorescence quantitative PCR detection of different transgenic lines of OsCIP1 overexpressing plants, with the internal reference being the OsActin1 gene;

[0043] Figure 5 Schematic diagram of different cold treatment methods;

[0044] Figure 6 This is the ear phenotype of OsCIP1 overexpressing plants after cold treatment at the booting stage;

[0045] Figure 7 This is a statistical chart of the fruiting rate of OsCIP1 overexpressing plants and control plants after cold water irrigation at the booting stage;

[0046] Figure 8 This is a statistical chart of the fruiting rate of OsCIP1 overexpressing plants and control plants after cold treatment in an artificial climate chamber at the booting stage;

[0047] Fig. 9 This is a statistical chart of the fruit set rate of OsCIP1 overexpressing plants and control plants planted in high altitude areas. DETAILED DESCRIPTION

[0048] The invention discloses a rice cold tolerance-related protein OsCIP1 at the booting stage, a coding gene and an application thereof.

[0049] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0050] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0051] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0052] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0053] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0054] The rice variety Kunming Xiaobaigu (KMXBG) in the following examples is recorded in the non-patent document "Dai Luyuan et al. Genetic analysis of cold tolerance index traits of Yunnan rice variety Kunming Xiaobaigu. Chinese Rice Science, 1999, 13(2): 73-76." The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiments of this application.

[0055] The rice variety Towada in the following examples is named WT or wild type below, which is recorded in the non-patent document "Dai Luyuan et al. Genetic analysis of cold tolerance index traits of Yunnan rice variety Kunming Xiaobaigu. Chinese Rice Science, 1999, 13(2): 73-76." The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiment of this application.

[0056] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0057] The vector pCM1307-3FLAG in the following example is recorded in the non-patent document "J Li, B Tang, YLi, C Li, Z Li, et al. (2021) Rice SPL10 positively regulates trichome development throughexpression of HL6 and auxin-related genes. J. Integr. Plant Biol. 63(8): 1521-1537.". The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiments of this application and cannot be used for other purposes.

[0058] The vectors pMDC32-CTB4a and pGEX-4T-1-CTB4a in the following examples KD Recorded in the non-patent document "Z Zhang, J Li, Y Pan, J Li, Z Li, et al. (2017) Natural variation in CTB4a enhances rice adaptation to cold habitats. Nat Commun. 8: 14788.", the public can obtain it from China Agricultural University (i.e. the applicant) to repeat the experiments of this application, and cannot be used for other purposes.

[0059] The Agrobacterium tumefaciens EHA105 strain in the following examples is recorded in the non-patent document "Gao Shiwu et al. Study on factors affecting transformation efficiency of Agrobacterium tumefaciens EHA105 competent cells. Journal of Tropical Biology. Vol. 3, No. 1, March 2012", which can be obtained by the public from China Agricultural University (i.e., the applicant) to repeat the experiments of this application.

[0060] The following examples used Excel statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Duncant's test was used, and different letters indicated significant differences (P < 0.05).

[0061] Light alternating culture means alternating light culture and dark culture, the conditions are: 28℃; 14 hours of light culture / 10 hours of dark culture; the light intensity during light culture is 90μE / m 2 / s.

[0062] YEP liquid culture medium: Dissolve 10 g yeast extract, 5 g NaCl and 10 g tryptone in distilled water, then dilute to 1 L with distilled water and sterilize by high pressure at 121°C for 15 min.

[0063] YEP solid culture medium: Dissolve 10 g yeast extract, 5 g NaCl and 10 g tryptone in distilled water, then dilute to 1 L with distilled water, and finally add 15 g agar powder and sterilize at 121°C for 15 min.

[0064] AAM liquid culture medium: dissolve 50 ml of AAM macro (20×), 5 mL of MS micro (200×), 10 mL of AAM organic (100×), 10 mL of iron salt (100×), 500 mg of hydrolyzed casein, 68.5 g of sucrose, 36 g of glucose, 75 mg of glycine, 877 mg of glutamine, 266 mg of aspartic acid and 228 mg of arginine in appropriate amount of deionized water, then make up to 1 L with deionized water, adjust the pH to 5.5, and sterilize at 115°C for 15 min; finally, add 1 ml of 20 mg / ml acetosyringone solution and mix well.

[0065] AAM bulk (20×): Dissolve 6.645 g CaCl2, 58.8 g KCI, 3.4 g KH2PO4 and 7.4 g MgSO4.7H2O in an appropriate amount of distilled water, and then dilute to 1 L with distilled water.

[0066] MS trace (200×): Dissolve 166 mg KI, 3.38 g MnSO4.H2O, 1.24 g H3BO3, 50 mg Na2MoO4.2H2O, 1.72 g ZnSO4.7H2O, 5 g CoCl2.6H2O and 5 g CuSO4.5H2O in appropriate amount of distilled water, and then make up to 1 L with distilled water.

[0067] AAM organic (100×): Dissolve 50 mg of vitamin B1, 50 mg of vitamin B5 and 10 mg of vitamin B6 in an appropriate amount of distilled water, and then make up to 1 L with distilled water.

[0068] Iron salt (100×): Dissolve 3.73 g Na2EDTA.2H2O and 2.78 g FeSO4.7H2O in an appropriate amount of distilled water, and then dilute to 1 L with distilled water.

[0069] NB solid culture medium: Dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose and 3 g of plant gel in 1 L of distilled water, then adjust the pH to 5.8 and sterilize under high temperature and high pressure for 20 min.

[0070] Co-culture medium: dissolve 20 mL of 50×N6 macro-mother liquor, 10 mL of 100×B5 micro-mother liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.4, sterilize at 121°C for 15 min, and add 10 g of 0.22 μM filtered sterilized glucose and 20 mg of acetosyringone when cooled to 50-60°C.

[0071] Delayed screening medium: Dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 500 mg of cephalosporin sterilized by 0.22 μM filtration when cooled to 50-60°C.

[0072] The first round of screening culture medium: dissolve 20 mL of 50×N6 macromolecular liquor, 10 mL of 100×B5 micromolecular liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gelatin and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 500 mg of cephalosporin and 50 mg of hygromycin sterilized by 0.22 μM filtration when cooled to 50-60°C.

[0073] Second round screening culture medium: dissolve 20 mL of 50×N6 macromolecular liquor, 10 mL of 100×B5 micromolecular liquor, 1 mL of 1000×B5 organic mother liquor, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0074] Predifferentiation medium: dissolve 20 mL of 50×N6 macromolecular solution, 10 mL of 100×B5 micromolecular solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of phytogels, 1 mg of 6-BA, 2 mg of NAA and 5 mg of ABA in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0075] Differentiation medium: Dissolve 20 mL of 50×N6 macro-mother solution, 10 mL of 100×B5 micro-mother solution, 1 mL of 1000×B5 organic mother solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of phytogenin, 2 mg of 6-BA, 1 mg of NAA and 1 mg of KT in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121°C for 15 min, and add 50 mg of 0.22 μM filtered sterilized hygromycin when cooled to 50-60°C.

[0076] Seedling culture medium: dissolve 25 mL of 20×MS macro-mother solution, 2.5 mL of 200×MS micro-mother solution, 2.5 mL of 200×MS iron salt mother solution, 2.5 mL of 200×MS organic mother solution, 3 g of plant gel, 0.5 mg of NAA and 0.25 mg of paclobutrazol in 1 L of distilled water, adjust the pH to 5.8, and sterilize at 121°C for 15 min.

[0077] The solutes and their concentrations of the 20×MS bulk mother liquor were 38.00 g / L KNO3, 8.80 g / L CaCl2·2H2O, 7.40 g / LMgSO4·7H2O, 3.40 g / L KH2PO4 and 33.00 g / L NH4NO3, the solvent was water, and the pH was natural.

[0078] The solutes and their concentrations of the 200×MS trace mother solution were 4.46 g / L MnSO4·4H2O, 0.166 g / L KI, 1.24 g / L H3BO3, 1.72 g / L ZnSO4·7H2O, 0.050 g / L Na2MoO4·2H2O, 0.005 g / L CuSO4·5H2O and 0.005 g / L CoCl2·6H2O, the solvent was water, and the pH was natural.

[0079] The solutes and their concentrations of the 200×MS iron salt mother solution are 5.56 g / L FeSO4·7H2O and 7.46 g / L Na2·EDTA·2H2O, the solvent is water, and the pH is natural.

[0080] The solutes and their concentrations of the 200×MS organic mother solution are 20 g / L inositol, 100 mg / L nicotinic acid, 100 mg / L pyridoxine hydrochloride, 100 mg / L thiamine hydrochloride and 400 mg / L glycine, the solvent is water, and the pH is natural.

[0081] The solutes and their concentrations of 50×N6 bulk mother liquor are 141.50 g / L KNO3, 20 g / L KH2PO4, 23.15 g / L (NH4)2SO4, 9.25 g / LMgSO4·7H2O and 8.30 g / L CaCl2·2H2O, the solvent is water, and the pH is natural.

[0082] The solutes and their concentrations of 100×B5 trace mother liquor are 0.3g / LH3BO3, 1g / LMnSO4·4H2O, 0.0025g / LCoCl2·6H2O, 0.0025g / LCuSO4·5H2O, 0.2g / LZnSO4·7H2O, 0.025g / LNa2MoO4·2H2O and 0.075g / LKI, the solvent is water, and the pH is natural.

[0083] The solutes and their concentrations of 1000×B5 organic mother liquor are 2 g / L glycine, 100 g / L inositol, 1 g / L nicotinic acid, 1 g / L pyridoxine hydrochloride and 10 g / L thiamine hydrochloride, the solvent is water, and the pH is natural.

[0084] In Examples 1 and 2 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0085] The present invention will be further described below in conjunction with embodiments:

[0086] Example 1 Obtaining OsCIP1 gene

[0087] 1. Acquisition of OsCIP1 gene

[0088] The present invention screens the interacting proteins of the protein CTB4a that has been reported to regulate the cold tolerance of rice by two methods, and identifies the gene encoding the CIP1 protein.

[0089] First, the coding sequence of CTB4a was amplified from the pMDC32-CTB4a vector, and the CTB4a sequence was connected to the pBT3-SUC vector using the Sfi site to construct the Bait strain. Subsequently, the vector and the empty Prey vector were simultaneously introduced into the yeast strain NMY51 using the chemical transformation method, and positive clones were screened using the SD-Leu-Trp defective medium. After self-activation verification, it was found that the Bait vector had no self-activation and could be used for the next step of the experiment.

[0090] Kunming Xiaobaigu materials were sown in the field at Beijing Shangzhuang Experimental Station. After growing for one month under normal conditions, the seedlings were transplanted to paddy fields and normal water and fertilizer management was carried out. When the plants grew to the booting stage, they were cold treated in an artificial climate chamber. The conditions were alternating light culture, i.e., alternating light culture and dark culture, with a temperature of 16°C, 14 hours of light culture / 10 hours of dark culture, and a light intensity of 90μE / m during light culture. 2 / s. Treat for 7 days. Then extract total RNA from the treated young spikelet material, reverse transcribe the RNA into cDNA using reverse transcriptase, and clone the cDNA library into the Prey vector using chemical transformation. Use Escherichia coli to amplify and extract the recombinant Prey vector library to ensure its diversity and capacity. The Prey vector containing the cDNA library is massively transformed into a yeast strain containing the Bait vector.

[0091] Positive clones were screened using defective culture medium containing SD-Leu-Trp-His-Ade and 50 mM 3-AT. The plasmids of the positive clones were extracted and verified one-to-one, and finally 38 proteins that interacted with CTB4a were obtained.

[0092] The present invention uses the second method, i.e., pull-down technology combined with mass spectrometry analysis, to screen the interacting proteins of CTB4a. First, pGEX-4T-1-CTB4a KD The vector was introduced into E. coli by chemical transformation for expression and purification of GST-CTB4a KD Protein was purified, and empty GST protein was used as a control. Then, the Kunming Xiaobai rice spikelets that had been cold treated for 3 days were taken and the total protein was extracted using protein extraction solution. The plant culture conditions were the same as above. The extracted rice total protein was respectively mixed with GST-CTB4a KD The protein and GST protein were incubated for 2 hours, GST magnetic beads were added and incubated for another 2 hours, and then the magnetic beads were removed and the protein was eluted with elution buffer for mass spectrometry analysis. The mass spectrometry results were compared with the UniProt database (http: / / www.uniprot.org / ), and a total of 17 proteins with scores higher than 100 were obtained.

[0093] By comparing the candidate proteins screened by the two methods, it was found that only one gene, Os08g0126300, encoded a protein that appeared in both screening results. Figure 1 As shown, we named this protein CIP1 and carried out subsequent analysis as the most likely interacting protein of CTB4a.

[0094]

[0095] The protein encoded by the OsCIP1 gene is OsCIP1, and the amino acid sequence of the protein is shown in SEQ ID NO: 2: Met Gly Lys Ile Lys Ile Gly Ile Asn GlyPhe GlyArg Ile Gly Arg Leu Val Ala ArgVal Ala Leu Gln Ser Glu Asp Val Glu Leu Val Ala Val Asn Asp ProPhe Ile ThrThr Asp Tyr Met Thr Tyr Met Phe Lys Tyr Asp Thr Val His Gly GlnTrp Lys HisSer Asp Ile Lys Ile Lys Asp Ser Lys Thr Leu Leu Leu Gly Glu LysPro Val ThrVal Phe Gly Ile Arg Asn Pro Asp Glu Ile Pro Trp Ala Glu Ala GlyAla Glu TyrVal Val Glu Ser Thr Gly Val Phe Thr Asp Lys Glu Lys Ala Ala AlaHis Leu LysGly Gly Ala Lys Lys Val Val Ile Ser Ala Pro Ser Lys Asp Ala ProMet Phe ValCys Gly Val Asn Glu Asp Lys Tyr Thr Ser Asp Ile Asp Ile Val SerAsn Ala SerCys Thr Thr Asn Cys Leu Ala Pro Leu Ala Lys Val Ile His Asp AsnPhe Gly IleIle Glu Gly Leu Met Thr Thr Val His Ala Ile Thr Ala Thr Gln Lys ThrVal AspGly Pro Ser Ser Lys Asp Trp Arg Gly Gly Arg Ala Ala Ser Phe Asn IleIle ProSer Ser Thr Gly Ala Ala Lys Ala Val Gly Lys Val Leu Pro Asp Leu AsnGly Ly sLeu Thr Gly Met SerPhe Arg Val Pro ThrVal Asp Val Ser Val ValAspLeu Thr ValArg Ile Glu Lys Ala Ala Ser Tyr Asp Ala Ile Lys Ser Ala Ile Lys SerAla SerGlu Gly Lys Leu Lys Gly Ile Ile Gly Tyr Val Glu Glu Asp Leu Val SerThr AspPhe Val Gly Asp Ser Arg Ser Ser Ile Phe Asp Ala Lys Ala Gly Ile AlaLeu AsnAsp Asn Phe Val Lys Leu Val Ala Trp TyrAsp Asn Glu Trp Gly Tyr SerAsnArg ValIle Asp Leu Ile Arg His MetAlaLys Thr Gln.

[0096] 2. Expression pattern of OsCIP1 gene

[0097] Kunming Xiaobaigu materials were sown in the field at Beijing Shangzhuang Experimental Station. After growing for one month under normal conditions, the seedlings were transplanted to paddy fields and carried out normal water and fertilizer management.

[0098] Normal treatment: Take samples of different tissues of Kunming Xiaobaigu materials under normal planting conditions, including roots, stems, mature leaves, leaf sheaths, and 1cm, 3cm, 5cm, 7cm, 10cm, and 15cm ears. After sampling, they were quickly frozen with liquid nitrogen and stored at -80℃ for later use.

[0099] Low temperature stress treatment: The Kunming Xiaobaigu materials grown to the booting stage under normal conditions were transplanted into an artificial climate room at 18 degrees, and leaf and ear samples were taken at 1h, 2h, 4h, 8h, 12h, 16h, 24h, 1d, 2d, 3d, 4d, 5d, 6d, and 7d of treatment, quick-frozen in liquid nitrogen, and stored at -80℃ for later use.

[0100] Total RNA from all tissue samples was extracted using a total RNA extraction kit (Adlai, Beijing) according to the operating procedures. The first-chain cDNA was synthesized by reverse transcription using reverse transcriptase M-MLV. The first-chain cDNA was used as a template and primers were used for real-time quantitative analysis. OsActin1 was used as an internal reference gene and 2- ΔΔc(t) Methods The relative expression of genes was calculated. The primer set for OsCIP1 amplification consisted of qRT-OsCIP1-F and qRT-OsCIP1-R, and the primer set for OsActin1 amplification consisted of Actin1-F and Actin1-R. The sequences are as follows:

[0101] OsCIP1 amplification primers:

[0102] The sequence of qRT-OsCIP1-F is shown in SEQ ID NO: 3: 5′-TGACAAGGAGAAGG CTGCTG-3′;

[0103] The sequence of qRT-OsCIP1-R is shown in SEQ ID NO: 4: 5'-GAGCAAGGCAGTTT GTGGTG-3'.

[0104] OsActin1 amplification primers:

[0105] The sequence of Actin1-F is shown in SEQ ID NO: 5: 5′-CACAGGTATTGTGTTGGAC TCTG-3′;

[0106] The sequence of Actin1-R is shown in SEQ ID NO:6: 5'-AGTAACCACGCTCCGTCA GG-3'.

[0107] The amplification system was 20 μL, including 10 μL 2×SYBR Premix ExTaqBuffer; 0.4 μL F primer and R primer; 2 μL cDNA; 0.4 μL DyeII; and 6.8 μL ultrapure water.

[0108] The amplification conditions were as follows: (1) 95°C, 30 s; (2) 95°C, 5 s; (3) 95°C, 34 s; (4) steps (2) to (3) were repeated for 40 cycles.

[0109] The experiment was repeated three times.

[0110] The tissue expression pattern of OsCIP1 gene Figure 2 As shown, it can be seen that the OsCIP1 gene is a gene expressed in different tissues, and its expression abundance is higher in leaf sheaths.

[0111] Analysis of cold-induced expression of OsCIP1 Figure 3 As shown, it can be seen that it is induced by low temperature in Kunming Xiaobai Valley, indicating that the OsCIP1 gene is a gene related to low temperature stress.

[0112] Example 2 Functional verification of OsCIP1 gene

[0113] 1. Acquisition and identification of transgenic rice with OsCIP1 gene

[0114] 1. Construction of recombinant vector ubi::OsCIP1 and acquisition of recombinant Agrobacterium EHA105 / ubi::OsCIP1

[0115] (1) Using the cDNA of rice variety IRAT109 as template, F-HA-F: 5'-ATCGATAC CGTCGACGAGCTCTCTAGA ACTAG TATGGGCAAGATTAAGATCGGAAT C-3' (as shown in SEQ ID NO: 7, the underline is the recognition site of restriction endonuclease SpeI) and F-HA-R: 5'-AGACTGGTGATTTTTGCGGAGTACCCGG GTACC PCR amplification was performed using a primer pair consisting of CTACTGGGTCTTGGCCATGTGG-3' (as shown in SEQ ID NO: 8, the underline is the recognition site of the restriction endonuclease KpnI) to obtain a PCR amplification product of about 1014 bp.

[0116] (2) Sequencing the PCR amplification product obtained in step (1). The results show that the PCR amplification product contains the DNA fragment shown in SEQ ID NO: 1.

[0117] (3) The PCR amplification product obtained in step (1) and the vector pCM1307-3FLAG are homologously recombined to obtain the recombinant vector ubi::OsCIP1.

[0118] The recombinant vector ubi::OsCIP1 was sequenced. The sequencing results showed that the recombinant vector ubi::OsCIP1 was a recombinant plasmid obtained by replacing the small DNA fragment between the restriction endonucleases SpeI and KpnI of the vector pCM1307-3FLAG with the DNA molecule shown in SEQ ID NO:1.

[0119] In the recombinant vector ubi::OsCIP1, the OsCIP1 gene is inserted downstream of the maize ubiquitin promoter Ubiquitin. The recombinant vector ubi::OsCIP1 expresses the OsCIP1 protein shown in SEQ ID NO:2.

[0120] (4) The recombinant vector ubi::OsCIP1 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which was named EHA105 / ubi::OsCIP1.

[0121] 2. Obtaining T3 generation homozygous transgenic OsCIP1 rice

[0122] The method in reference (MRXu, ZHXia, WXZhai, JLXu, YLZhou, ZKLi. (2008) Construction of double right-border binary vector carrying non-host gene Rxo1resistant to rice bacterial leafstreak, Rice Science, 15 (3), 243-246.) was used to transform EHA105 / ubi::OsCIP1 into Towada, and then self-pollination was performed to obtain T3 generation homozygous transgenic OsCIP1 rice. The specific steps are as follows:

[0123] (1) Obtaining callus tissue

[0124] After the mature Towada seeds were shelled, they were disinfected with alcohol, then disinfected with sodium hypochlorite, rinsed with sterile water once, and air-dried for 3 hours to obtain sterile Towada seeds. The sterile Towada seeds were inoculated into NB solid medium and cultured in the dark at 28°C for 2 weeks to obtain embryonic callus. The embryonic callus was subcultured twice to obtain callus tissue. The method of each culture was: the embryonic callus was inoculated into a new NB solid medium and cultured in the dark at 28°C for 2 weeks.

[0125] (2) Preparation of infection solution

[0126] EHA105 / ubi::OsCIP1 was spread on YEP solid medium containing kanamycin and rifampicin and cultured in the dark at 28°C for 2 days. Then, the Agrobacterium was scraped and transferred to AAM liquid medium to obtain the OD 600nm About 0.3 of the infection solution.

[0127] (3) Co-culture

[0128] Select naturally dispersed, bright yellow, and 3-5 mm in diameter granular callus tissue from the callus tissue obtained in step (1), place it in a conical flask, then add the infection solution prepared in step (2), and let it stand for infection for 10 minutes; then absorb the excess infection solution with sterile filter paper, and then place the callus tissue on a co-cultivation medium covered with a layer of filter paper, and co-cultivate at 20° C. for 2-3 days.

[0129] (4) Screening of resistant callus

[0130] ① Take the callus tissue that has completed step (3), first wash it with sterile water by rapid shaking for 5 to 6 times, then wash it with sterile water containing cephalosporin and carbenicillin for 20 minutes, then place it on sterile filter paper to drain for 3 hours, and finally transfer it to delayed selection medium and culture it in the dark at 28°C for 1 week.

[0131] ②After completing step ①, the callus tissue was transferred to the first round screening medium and cultured in the dark at 28°C for 2 weeks.

[0132] ③After completing step ②, the callus tissue was transferred to the second round screening medium and cultured in the dark at 28°C for 2 weeks to obtain resistant callus tissue.

[0133] (5) Differentiation

[0134] ① Transfer the resistant callus after step (4) to the pre-differentiation medium and culture it in the dark at 28°C for 2 weeks.

[0135] ② After completing step ①, the resistant callus is transferred to a differentiation medium and cultured under alternating light for 2 to 3 weeks to obtain transgenic seedlings.

[0136] (6) Strong seedlings

[0137] The transgenic seedlings obtained in step (5) are transferred to a seedling culture medium. After the seedlings take root, they are removed from the culture bottle, the culture medium on the roots is washed off, the seedlings are hardened for 1 to 2 weeks, and then transferred to the field for planting until they mature, thereby obtaining the T0 generation of rice with the proposed OsCIP1 gene.

[0138] (7) Screening positive seedlings of the T0 generation OsCIP1 gene-transfected rice obtained in step (6), and then self-pollinating to obtain the T1 generation OsCIP1 gene-transfected rice.

[0139] (8) Screening positive seedlings of the T1 generation OsCIP1 gene transgenic rice obtained in step (7), and then self-pollinating to obtain T2 generation OsCIP1 gene transgenic rice.

[0140] (9) Screening positive seedlings of the T2 generation OsCIP1 gene transgenic rice obtained in step (8), and then self-pollinating to obtain T3 generation homozygous OsCIP1 gene transgenic rice.

[0141] The method for screening positive seedlings is as follows: extracting genomic DNA of rice seedlings and using it as a template, performing PCR amplification using a primer pair consisting of hyg(280)-F: 5'-ACGGTGTCGTCCATCACAGTTTGCC-3' (as shown in SEQ ID NO: 9) and hyg(280)-R: 5'-TTCCGGAAGTGCTTGACATTGGGGA-3' (as shown in SEQ ID NO: 10) to obtain PCR amplification products; and then performing the following judgment: if a PCR amplification product contains a DNA fragment of about 280 bp, the rice seedling corresponding to the PCR amplification product is a positive seedling.

[0142] 3. Real-time fluorescence quantitative detection of the relative expression level of OsCIP1 gene in T3 generation homozygous transgenic OsCIP1 rice

[0143] (1) The seedlings of each T3 generation homozygous transgenic OsCIP1 gene rice grown to 10 days old were placed in liquid nitrogen for storage to obtain the corresponding test samples. Towada seeds were cultured at 28°C for 10 days in alternating light and dark conditions to obtain the test rice seedlings; the test rice seedlings were placed in liquid nitrogen for storage to obtain the corresponding test samples.

[0144] (2) The total RNA of the samples was extracted by the Trizo1 method, and then the first-strand cDNA was reverse transcribed using a reverse transcription kit (Adlai, Beijing). The cDNA was diluted 50 times with sterile water and used as a template. The relative expression level of the OsCIP1 gene was detected by real-time fluorescence quantitative PCR (with the OsActin1 gene Os03g0718100 as the internal reference gene).

[0145] The primer set for detecting the OsCIP1 gene is shown in Part 2 of Example 1.

[0146] The primer set for detecting the Actin gene is shown in Part 2 of Example 1.

[0147] Some test results are as follows Figure 4 The results showed that compared with Towada, the relative expression levels of OsCIP1 gene in each T3 generation homozygous transgenic OsCIP1 rice were significantly increased, and three T3 generation homozygous transgenic OsCIP1 rice lines were named OsCIP1-OE1 (abbreviated as OE-1), OsCIP1-OE2 (abbreviated as OE-2), and OsCIP1-OE3 (abbreviated as OE-3).

[0148] 4. Identification of cold tolerance of OsCIP1 transgenic rice

[0149] Three cold tolerance identification methods were set up to identify the cold tolerance of OsCIP1 transgenic materials. Figure 5 As shown, they are 50 cm deep cold water pool (16-17℃) for 7 days in the field at the booting stage (CS-DW), 16-17℃ treatment for 7 days in the artificial climate chamber (CS-PT) at the booting stage, and natural low temperature conditions at high altitude in Yunnan (CS-HAA).

[0150] The main ears of wild-type rice (cold-sensitive variety Towada), T3-generation OsCIP1-transgenic rice line OE-1, T3-generation OsCIP1-transgenic rice line OE-2, and T3-generation OsCIP1-transgenic rice line OE-3, which are in the booting stage, were selected and marked. After the stress ended, the test materials were replanted in the field to resume rice growth. After maturity, the fruit setting rate of the marked main ears was examined, and the fruit setting rate of normally grown plants was used as a control. The relative fruit setting rate (relative fruit setting rate = fruit setting rate after treatment / fruit setting rate under normal conditions * 100%) was calculated as an indicator for cold tolerance identification. The natural identification in Yunnan was carried out in the Heilongtan area of ​​Yunnan, which is 1,916 meters above sea level and has an annual temperature of 19-22°C. It grows under natural low temperature conditions from sowing to the booting stage, and the main ear fruit setting rate was examined after maturity. The ear phenotypes after treatment in high-altitude areas in Yunnan are as follows Figure 6 As shown, it can be seen that the agronomic traits of the test materials treated at the booting stage changed significantly. Three replicates were set for each of the above materials, with 10 plants in each replicate.

[0151] After 7 days of exposure to a 50 cm deep cold water pool (16°C) in the field at the booting stage, the growth of the T3-generation OsCIP1 transgenic rice lines OE-1, OE-2, and OE-3 was significantly better than that of the wild-type rice. The fruit set rate was statistically shown in Figure 2. Figure 7 As shown, the relative fruit setting rate of Towada was 26.31%, while the relative fruit setting rates of OE1, OE2 and OE3 were 60.13%, 72.11% and 47.07%, respectively, all significantly higher than Towada.

[0152] The results of artificial climate chamber treatment at 16℃ for 7 days at the booting stage are as follows Figure 8 As shown, the relative fruit setting rate of Towada was 17.49%, and the relative fruit setting rates of OE1, OE2 and OE3 were 39.77%, 45.39% and 28.34%, which were also significantly higher than Towada.

[0153] The results of natural low temperature treatment during the whole growth period in Yunnan are as follows Fig. 9 As shown, the relative fruit setting rate of Towada was 10.99%, and the relative fruit setting rates of OE1, OE2 and OE3 were 69.76%, 57.72% and 70.96%, which were also significantly higher than Towada.

[0154] The above results show that low temperature encountered during the booting stage mainly affects the fruit setting rate. Under different locations and treatment methods, the main ear fruit setting rate of the OsCIP1 overexpression strain was significantly higher than that of the cold-sensitive parent Towada, indicating that the gene OsCIP1 has the function of low temperature resistance during the booting stage and is a gene with a positive and long-term effect, which can reduce the effect of low temperature on the fruit setting rate under low temperature stress.

[0155] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A protein, characterized in that As follows 1), 2) or 3): 1) having the amino acid sequence shown in SEQ ID NO: 2; 2) A protein derived from the amino acid sequence shown in 1) by substitution and / or deletion and / or addition of one or more amino acid residues and having the same function as 1); 3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of 1) or 2).

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule of any one of the following 1)-3): 1) The coding region has the nucleotide sequence as described in SEQ ID NO: 1; 2) a nucleic acid molecule that hybridizes with the nucleotide sequence defined in 1) under stringent conditions and encodes a protein having the same function; 3) A nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the nucleotide sequence defined in 1) or 2) and encodes a protein with the same function.

4. A recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the nucleic acid molecule of claim 2 or 3.

5. A primer pair for amplifying the full length of the nucleic acid molecule according to claim 2 or 3 or any fragment thereof.

6. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria according to claim 4 in regulating plant stress resistance; Or use of the protein according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria according to claim 4 in cultivating transgenic plants with improved stress resistance.

7. The use according to claim 6, characterized in that: The stress resistance is low temperature resistance; the low temperature is specifically 16-17°C; The plant is a monocot or a dicot; The monocotyledonous plant is specifically rice.

8. A method for cultivating transgenic plants with improved stress resistance, comprising introducing a nucleic acid molecule encoding the protein of claim 1 into a target plant to obtain a transgenic plant, The stress resistance of the transgenic plant is higher than that of the target plant.

9. The method according to claim 8, characterized in that: The stress resistance is resistance to low temperature.

10. The method according to claim 8 or 9, characterized in that: The stress resistance of the transgenic plant is higher than that of the target plant, which is reflected in that the fruit setting rate of the transgenic plant is higher than that of the target plant under low temperature stress at the booting stage; The low temperature is specifically 16-17°C; The plant is a monocot or a dicot; The monocotyledonous plant is specifically rice.

Images