Coniothyrium brazilianum HMA1 and application thereof

Abstract

The invention discloses a coniothyrium brazilianum HMA1 strain and application thereof, and belongs to the technical field of microbial engineering and molecular biology. The pseudoconiothyrium brasiliense HMA1 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the preservation date is October 16, 2024, and the preservation number is CGMCC No.41574. The pseudoconiothyrium brasiliense HMA1 disclosed by the invention has the advantages that the pseudoconiothyrium brasiliense HMA1 can be used for preparing the pseudoconiothyrium brasiliense HMA1; the invention also provides an application of the coniothyrium brazilianum HMA1 or the fermentation product of the coniothyrium brazilianum HMA1 in degradation of bisphenol compounds. The invention for degrading the bisphenol compound by using the coniothyrium brazilianum for the first time aims to lay a solid theoretical foundation for wide application of a fungus bioremediation technology in the aspect of reducing the ecological risk of the bisphenol compound.

Description

Technical Field

[0001] The invention relates to the technical field of microbial engineering and molecular biology, in particular to a strain of Pseudomonas brasiliensis HMA1 and application thereof. Background Art

[0002] Bisphenol A (2,2-bis(4-hydroxyphenyl)propane, BPA) is a widely used synthetic chemical. The manufacture of synthetic polymers, including epoxy resins, polycarbonate plastics, many food and beverage containers, and the linings of metal food cans, often uses BPA as a plasticizer or flame retardant. In addition, it is used as an antioxidant in the food industry and as a cheaper cosmetic. Due to its widespread use and growing demand, BPA has become a common emerging organic contaminant (EOC) that can easily penetrate into the environment. BPA has been detected in various environmental media, including air, water, soil, and sediment. BPA is classified as a chemical that is harmful to reproductive and developmental health. The chemical formula of BPA is similar to that of estrogen, which can antagonize estrogen receptors in organisms and cause serious interference with the endocrine system. In addition, BPA is associated with carcinogenicity, immunotoxicity, and cross-species transgenerational phenomena. Even at very low doses, it can cause early puberty in females, reduce sperm count, and cause prostate hyperplasia. In general, when BPA is released into the environment, it poses a serious risk to the health of humans and animals. Therefore, countries including the United States and Canada passed an international agreement against the use of BPA, banning the sale of baby bottles containing BPA to protect the health of newborns from the effects of BPA leakage.

[0003] At present, most of the solutions people are looking for to degrade this toxic compound are photodegradation, photoelectrocatalytic oxidation, adsorption and biodegradation, but the efficiency is low. Compared with chemical or physical methods, the degradation of endocrine disruptor bisphenol A by microbial methods usually has lower operating costs. This is mainly because the acquisition, cultivation and utilization of microorganisms are relatively simple, and the proliferation and metabolic activities of microorganisms can be carried out under mild conditions without the need for complex equipment and a large amount of energy. At the same time, the by-products produced during microbial degradation are mostly non-toxic or low-toxic substances, and the risk of secondary pollution to the environment is small. In addition, microorganisms are widely present in nature. Using microorganisms to degrade BPA can achieve resource recycling and sustainable development. Most importantly, under suitable conditions, microorganisms can degrade BPA quickly and efficiently. These advantages make microbial degradation technology have broad application prospects and important practical significance in dealing with environmental pollution problems containing BPA.

[0004] Therefore, it is of great significance to find new and effective solutions to eliminate such toxic compounds. However, there are few studies on the use of microbial methods and strains to degrade and remove bisphenol compounds. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Pseudomonas brasiliensis HMA1 and its application to solve the problems existing in the above-mentioned prior art. The present invention verifies that Pseudomonas brasiliensis HMA1 can be used to degrade bisphenol A, bisphenol B and bisphenol F, as well as to degrade organophosphorus flame retardants TCrP and EHDPP. In addition, the laccase produced by Pseudomonas brasiliensis HMA1 can also be used to degrade bisphenol A.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical Solution 1: A strain of Paraconiothyrium brasiliense HMA1 is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 16, 2024, and the deposit number is CGMCC No.41574.

[0008] The strain originated from the campus of Shandong University of Technology.

[0009] Technical solution 2: A fermentation method of the Pseudomonas brasiliensis HMA1, comprising the step of inoculating the mycelium of the Pseudomonas brasiliensis HMA1 into a PDY gravy medium for fermentation.

[0010] Technical solution three: A fermentation product obtained by fermentation according to the fermentation method.

[0011] Furthermore, the fermentation product includes laccase.

[0012] The laccase is produced by inoculating HMA1 mycelium in PDY broth medium. The laccase produced by Pseudomonas brasiliensis HMA1 can be used to degrade bisphenol A.

[0013] Technical solution 4: An application of the aforementioned Pseudomonas aeruginosa HMA1 or the aforementioned fermentation product in the degradation of bisphenol compounds.

[0014] Furthermore, the bisphenol compounds include BPB and BPF.

[0015] BPB (Bisphenol B): bisphenol B; BPF (Bisphenol F): bisphenol F.

[0016] Technical solution 5: An application of the aforementioned Pseudomonas aeruginosa HMA1 or the aforementioned fermentation product in the degradation of bisphenol A.

[0017] Technical solution six: An application of the aforementioned Pseudomonas aeruginosa HMA1 or the aforementioned fermentation product in the degradation of organophosphorus flame retardants.

[0018] Furthermore, the organophosphorus flame retardant includes TCrP and EHDPP.

[0019] TCrP (Tricresyl Phosphate): Tricresyl phosphate; EHDPP (Ethylhexyl Diphenyl Phosphate): Ethylhexyl diphenyl phosphate.

[0020] Technical Solution 7: A microbial agent for degrading bisphenol compounds, comprising the Pseudomonas aeruginosa HMA1 or the fermentation product; the bisphenol compounds include bisphenol A, bisphenol B and bisphenol F.

[0021] The strain or the fermentation product is used as the main component of the microbial agent, and the microbial agent also includes auxiliary materials commonly used in microbial agents. The auxiliary materials include organic carriers, inorganic carriers, carbon sources, nitrogen sources, minerals, antifreeze agents, drying protective agents, adhesives, natural adhesives, synthetic adhesives, phosphate buffers, antioxidants, surfactants and preservatives.

[0022] The present invention discloses the following technical effects:

[0023] The present invention isolates strain HMA1 from soil samples and optimizes the environmental conditions of its degradation process. On the basis of clarifying the intermediate metabolites, the strain or its fermentation product is used to further propose a pathway for fungal strains to degrade BPA, and the mechanism of its degradation of BPA is studied by producing laccase and detecting the potential of extracellular laccase to eliminate BPA. The Paraconiothyrium brasiliense HMA1 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, a deposit date of October 16, 2024, and a deposit number of CGMCC No. 41574.

[0024] The present invention confirms that Pseudomonas brasiliensis HMA1 can be used to degrade bisphenol compounds and degrade organophosphorus flame retardants TCrP and EHDPP. In addition, the laccase produced by Pseudomonas brasiliensis HMA1 can also be used to degrade bisphenol A. The present invention is the first invention of using Pseudomonas brasiliensis to degrade bisphenol compounds, and lays a solid theoretical foundation for the wide application of fungal bioremediation technology in reducing the ecological risk of BPA. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 For identification of strain HMA1, A is the growth morphology and color of strain HMA1 on PDA medium; B is the growth of strain HMA1 on the back of PDA plate; C is the phylogenetic tree of strain HMA1;

[0027] Figure 2 The effects of environmental and nutritional factors on the degradation of BPA by Paraconiothyrium brasiliense HMA1 strain, where A is temperature; B is pH; C is nitrogen source; and D is NaCl concentration.

[0028] Figure 3 The efficiency of HMA1 strain in degrading low BPA concentration (A) and high BPA concentration (B) after 5 and 10 days of incubation;

[0029] Figure 4 is the biodegradation rate of different bisphenols and organophosphorus flame retardants (100 mg / L) by HMA1 strain after 2 and 4 days of incubation;

[0030] Figure 5 The pathway for degradation of BPA by HMA1 strain included 1,2-bis(4-hydroxyphenyl)-2-propanol (I), 4,4-dihydroxy-α-methylstilbene (II), 2,2-bis(4-hydroxyphenyl)-1-propanol (III), 2,3-bis(4-hydroxyphenyl)-1,2-propanediol (IV), 4-hydroxybenzoyl alcohol (V), and hydroquinone (HQ) (VI);

[0031] Figure 6 The degradation and mineralization of BPA by HMA1 strain, the initial concentration of BPA was 150 mg / L;

[0032] Figure 7 Figure 1 shows the positive (A) and negative (B) plate method for fungal culture using ABTS as substrate to detect the production of laccase by HMA1 strain; C shows the removal of BPA at different concentrations by laccase. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Example 1

[0039] 1. Sample Collection

[0040] Soil samples were collected from Shandong University of Technology.

[0041] 2. Isolation of strains

[0042] The collected soil samples were suspended in sterile saline solution, and 100 μL of the suspended soil after ten-fold dilution was spread on the agar surface of the PDA plate and incubated at 28°C for 7 days. The different strains obtained were re-cultured and purified in PDA. All the isolates obtained were examined under a light microscope to confirm the purity and identify the morphological shape. The obtained fungal strains were stored in glycerol as spore suspensions and stored at -80°C for future use.

[0043] 3. Preparation and detection of inoculum of bisphenol A-degrading fungi

[0044] All the screened isolates were cultured on PDB at 28°C in a rotary shaker (150 rpm) for 5 days, and then centrifuged at 4500 rpm for 10 min to collect the mycelium of each isolate. The collected mycelium was resuspended and washed twice in physiological saline, and the washed mycelium was collected again by centrifugation. In order to detect the degradation ability of the screened isolates on bisphenol A (BPA), 3 g of each wet mycelium was inoculated into a 250 mL Erlenmeyer flask containing 70 mL of sterilized MSM and supplemented with 100 mg / L BPA as the sole carbon source. The inoculated flasks were incubated in a rotary shaker (150 rpm) at 28°C for 5 days, and 1 mL of each culture was filtered with a 0.22-μm nylon membrane, and the BPA residual concentration was measured by HPLC to detect the degradation rate. The degradation efficiency of BPA is calculated as follows: Degradation efficiency (%) = (C i— C f ) / C i ×100, where C i and C f represent the initial and final concentrations of BPA, respectively.

[0045] The degradation capacity of each culture for BPA was tested by HPLC, and it was found that the isolate named HMA1 had a degradation rate of 100% for BPA (100 mg / L). HMA1 was identified by 18S rRNA gene sequencing. The 18S rRNA gene sequence of HMA1 was compared with BLAST to obtain the sequence of related strains, and the phylogenetic tree of HMA1 was constructed ( Figure 1 C), the closest strain is strain SM1, with a similarity of 98.7% and a query coverage of 99%. Figure 1 ) and 18S rRNA gene sequencing, the strain named HMA1 was identified as Paraconiothyrium brasiliense. Paraconiothyrium brasiliense HMA1 has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, on October 16, 2024, and the deposit number is CGMCC No.41574.

[0046] 4. Molecular identification of HMA1

[0047] 4.1 DNA extraction

[0048] The genomic DNA of HMA1 was extracted using the DNA Rapid Plant System Isolation Kit.

[0049] 4.2 PCR amplification

[0050] The total volume of the PCR reaction mixture was 25 μL, including 50 ng of template DNA, 12.5 μL of PCR Master Mix, 0.5 μL each of universal fungal primers ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID NO.1) and ITS4: TCCTCCGCTTATTGATATGC (SEQ ID NO.2), and the remaining volume was filled with 11.5 μL of DNA-free water. The reaction mixture was thermally cycled in a master cycler from Eppendorf, Germany, following the program PCR conditions: 35 cycles of denaturation at 95°C for 10 min, annealing at 56°C for 30 s, extension at 72°C for 1.45 min, and finally extension at 72°C for 3.30 min to complete chain synthesis. The PCR products were analyzed by electrophoresis on 1% agarose tbe gel and visualized using a gel documentation system from Syngene, USA. The PCR products were then purified.

[0051] 4.3 Sequencing and phylogenetic analysis

[0052] PCR products were sequenced and the resulting sequences were deposited into GenBak, and similar sequences were obtained by BLAST alignment. Phylogenetic analysis inferred from the data was constructed using MEGA-X software version 11, and alignments were performed using Clustal Omega. Phylogenetic construction of the prepared sequences was performed using the neighbor-joining (NJ) method; the stability of phylogenetic tree branches was estimated using the p-distance substitution model and 1000 replicates of bootstrapping.

[0053] 5. Effects of environmental and nutritional factors on BPA degradation by HMA1

[0054] In order to study the effects of environmental and nutritional factors on the degradation of BPA by HMA1, four different parameters were studied in the present invention. Batch experiments were conducted for initial pH (5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 and 9), culture temperature (15°C, 20°C, 25°C, 30°C, 35°C and 40°C), nitrogen source (1% ammonium sulfate, sodium nitrite, ammonium citrate, ammonium tartrate, sodium nitrate and ammonium acetate and ammonium chloride) and NaCl concentration (0%, 0.2%, 0.4%, 0.6%, 0.8%, 1%, 1.2% and 1.4%). After the inoculant was prepared, 70 mL MSM and 100 mg / L BPA were filled in 250 mL conical flasks and inoculated with 3 g of HMA1 mycelium wet weight respectively. The inoculated flasks were incubated in a rotary shaker (150 rpm) for 3 days and the BPA degradation rate was detected by HPLC. All experiments were performed on 3 individuals with 3 replicates per group.

[0055] The results are as follows Figure 2As shown in A, HMA1 can degrade BPA (100 mg / L) at different rates at all tested temperatures. The degradation efficiency of HMA1 for BPA increases as the temperature increases from 15°C to the optimal value at 30°C, while at 35°C and 40°C, the degradation efficiency drops sharply again with the increase in temperature. The degradation rates were 49%, 53%, 95%, 100%, 32% and 12% at temperatures of 15, 20, 25, 30, 30, 35 and 40°C, respectively. The effect of pH on the degradation of BPA by HMA1 was evaluated over a wide pH range (5-9) with an increment of 0.5. The results showed that HMA1 showed a high tolerance for the degradation of BPA. The overall pH value was tested, and the degradation exceeded 62 and 67% ( Figure 2 B). When pH 7.5 is the optimal value, the BPA degradation rate is the highest (100% is 100 mg / L). When the pH value is higher than the optimal value, the degradation rate decreases. The influence of nitrogen source in the degradation medium is tested by using organic nitrogen source and inorganic nitrogen source. Figure 2 The results of C showed that HMA1 was able to use all detected nitrogen sources, with degradation rates of citric acid, sodium nitrate, acetic acid, tartaric acid and sodium nitrite of 82%, 88%, 93%, 90% and 76%, respectively, while the best degradation rates of chloride and sulfate were 97% and 98%, respectively. The present invention also studied the effect of salt stress on the degradation of BPA by HMA1 under different NaCl concentrations. The results showed that the degradation rate of the strain decreased significantly with the increase of NaCl concentration, such as Figure 2 As shown in D, the degradation efficiency of HMA1 under 0.6% NaCl treatment was maintained at 52% compared with the control (without NaCl), and the degradation rate under 1.4% NaCl treatment was reduced to 30%, while the degradation rate was highest in the culture medium without NaCl.

[0056] 6. Degradation efficiency of BPA by HMA1 at maximum and minimum concentrations

[0057] The degradation ability of HMA1 on high and low concentrations of BPA was tested. Different concentrations of BPA were added to MSM medium (low concentrations included 0.5 mg / L, 1 mg / L, 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L and 12 mg / L, and high concentrations of BPA included 50 mg / L, 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L, 900 mg / L and 1000 mg / L). All flasks were inoculated with 3 g wet weight of fresh mycelium of HMA1 and incubated in a rotary shaker (160 rpm) at 28°C. After 5 and 10 days of culture, the degradation efficiency was tested by measuring the residual BPA concentration in each flask.

[0058] 7. Substrate Utilization Test

[0059] In order to study the ability of HMA1 to degrade pollutants other than BPA, the present invention tested 6 BPA-related pollutants (BPB, BPF and BPS) and organophosphorus flame retardants (TPP, TCrP and EHDPP). BPB (Bisphenol B): Bisphenol B, BPF (Bisphenol F): Bisphenol F, BPS (Bisphenol S): Bisphenol S, TPP (Triphenyl Phosphate): Triphenyl phosphate, TCrP (Tricresyl Phosphate): Tricresyl phosphate, EHDPP (Ethylhexyl Diphenyl Phosphate): Ethylhexyl diphenyl phosphate.

[0060] MSM (50 mL in a 250 mL flask) was added with 100 mg / L of each substrate, inoculated with 3 g of HMA1 wet weight mycelium, and incubated at 150 rpm in a rotary shaker at 28 °C. HPLC was used to detect the residual concentration of the substrate after the second and fourth days to monitor the degradation rate. BPB, PBF, and BPS were filtered through a 0.22 μm nylon membrane and then subjected to HPLC. TPP, TCrP, and EHDPP were mixed with an equal volume of acetonitrile, and a sample (1 mL) was taken and filtered before HPLC. The results are shown in Figure 4 As shown, HMA1 showed excellent degradation rates for the four substrates, while the other two could not be degraded. In summary, the degradation rates of BPB, BPF, TCrP and EHDPP by strain HMA1 were 85%, 87%, 89% and 90% respectively after 2 days of culture, and they could be completely degraded after 4 days of culture.

[0061] 8. Analysis of intermediates in BPA degradation

[0062] To determine the intermediates released during the degradation of BPA, 11 g of mycelium wet weight of HMA1 was inoculated into 300 mL of MSM, supplemented with 100 mg / L of BPA, and incubated in a rotary shaker (130 rpm) at 28 °C. The time intervals were 0 h, 24 h, 48 h, 96 h, and 136 h at the following specific incubations. 50 mL of samples were taken from the culture and filtered through a filter membrane. The mycelium-free filtrate was acidified with HCl (pH: 2-3), extracted twice with an equal volume of ethyl acetate, and the organic layer was separated and dried using a rotary evaporator and resuspended in 1 mL of methanol (HPLC grade). All suspensions were filtered through a 0.22 μm nylon membrane. The intermediates were detected by high performance liquid chromatography-mass spectrometry (HPLC-MS, QTOF). Data acquisition and processing were performed by Agilent Mss Hunter Qualitative Analysis B.06 software.

[0063] 9.Total organic carbon (TOC) and mineralization rate detection

[0064] To test the ability of HMA1 to mineralize BPA and assimilate degradation intermediates, the total TOC in the degradation medium was estimated. HMA1 (wet mycelium) was inoculated in sterilized TEM (400 mL, 1L conical flask) and 150 mg / L BPA was added as the sole carbon source. The inoculated medium was incubated in a rotary shaker (150 rpm) at 28°C for 10 days. 20 mL samples were taken every day under sterile conditions, the mycelium was filtered out, and the filtrate was stored at -20°C for further determination of TOC and BPA losses.

[0065] 10. Analytical methods

[0066] Agilent EC-C18 column (C 18 ,4.6×150mm×4μm) and diode array detector (DAD) HPLC (Agilent 1260, USA) were used to detect BPA, BPB, BPF and BPS. The mobile system was 85% acetonitrile and 15% water (0.1% acetic acid), the flow rate was 1mL / min, and the detection wavelength was 220nm. The injection volume was 2μL. For the detection of TPP, TCrP and EHDPP, the same HPLC conditions were used, and the ratio of the mobile phase was changed to 95% acetonitrile and 5% water. Metabolites were detected using Agilent1290HPLC-Agilent 6530QTOF, equipped with a Waters ACQUITY UPLC HSS T3 column (2.1×100mm, 1.8μm). The mobile system was acetonitrile (A) and 0.1% formic acid aqueous solution (B), and the gradient operation mode was: 0-5min, 30% A; 5-6min, 30-50% A; 6-11min, 50% A; 11-12min, 50-70% A; 12-13min70-90% A; 13-18min, 90% A; 18-20min, 90-50% A; 20-22min, 50-30% A; 22-25min, 30% a, flow rate 0.5mL / min, injection volume 2μL. The column box temperature was maintained at 30℃. The ESI ion source worked in negative mode, and negative ions with a mass range of 50-500m / z were used in the scan mode, and the capillary voltage was 3.5kV.

[0067] The BPA degradation metabolites of HMA1 were identified by HPLC-OTOF method. The results are shown in Table 1. The intermediates of BPA degradation include 6 intermediate metabolites, including 1,2-bis(4-hydroxyphenyl)-2-propanol, 2,2-bis(4-hydroxyphenyl)-2-propanol, 2,3-bis(4-hydroxyphenyl)-1,2-propanediol, 4-hydroxybenzaldehyde, 4-hydroxyacetophenone and 4-hydroxybenzoic acid. The molecular formula and structure of each metabolite are shown in Table 1.

[0068] Table 1

[0069]

[0070] Degradation pathways such as Figure 5 As shown, BPA is hydroxylated to 1,2-bis(4-hydroxyphenyl)-2-propanol and 2,2-bis(4-hydroxyphenyl)-1-propanol in pathway (I) and pathway (II), respectively. In pathway (I), 1,2-bis(4-hydroxyphenyl)-2-propanol is converted to 4,4-dihydroxy-α-methylstyrene and further oxidized to form p-hydroxybenzaldehyde (p-HBAL) and p-hydroxyacetophenone (p-HAP). p-HBAL is converted to p-hydroxybenzoic acid (p-HBA), p-HAP is oxidized to hydroquinone (HQ), and both p-HBA and HQ are mineralized to CO2 and fungal biomass through the benzoate degradation pathway. Another degradation pathway (II), in which 2,2-bis(4-hydroxyphenyl)-1-propanol is converted to 2,3-bis(4-hydroxyphenyl)-1,2-propanediol.

[0071] After 2, 3, 4, 5, and 6 days of incubation, the TOC mineralization rate of HMA1 decreased from 115 mg / L to 95 mg / L, 80 mg / L, 40 mg / L, 25 mg / L, and 20 mg / L, respectively (e.g. Figure 6 As shown in Figure 3 ), it can be obtained that HMA1 mineralized more than 78% of BPA in only 5 days, and with the increase of incubation time, TOC did not decrease significantly, reaching 80% consumption, and 150 mg / L BPA was completely degraded after 4 days of incubation.

[0072] 11. Detection, production and purification of laccase

[0073] Detection of laccase production by HMA1: HMA1 was grown on PDA agar plates with a final concentration of 3 mM 2,2'-amino-bis3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and incubated at 28°C for 5 days. A positive result indicated the formation of a green ( Figure 7A in Figure 1). For the production of laccase, mycelium of HMA1 was inoculated in PDY broth medium (800 mL) and incubated in a rotary shaker at 28°C. After 5 days of incubation, sterilized CuSO4 was added to the medium to induce laccase production, and the incubation was continued for 10 days. After filtering the fungal culture, NH4SO4 (80%) was added to the mycelium-free culture medium and stored at 4°C overnight to precipitate the protein. The precipitated protein was centrifuged at 15,000 rpm for 20 min under cooling (4°C), and the pellet was dissolved in sodium acetate buffer (100 mM, pH 5) and dialyzed in the same buffer.

[0074] 12. Laccase Activity Assay

[0075] Laccase activity assay: The reaction mixture was 250 μL ABTS (1 mM), sodium acetate buffer (100 mM, pH: 5), enzyme 50 μL, and the same buffer was used to make up to 700 μL. The OD value at 420 nm and 30° C. was monitored using a UV-2600 spectrophotometer (SHIMADZU, Japan). The enzyme activity unit was the amount of enzyme required to produce 1 μmol ABTS (ε420 = 36,000 M -1 cm -1 ).

[0076] 13. Laccase degradation of BPA

[0077] Different concentrations of BPA (50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, 250 mg / L, 300 mg / L, 350 mg / L, 400 mg / L, 450 mg / L, 500 mg / L and 600 mg / L) were added to 0.1 M sodium acetate buffer and inoculated with 10 units of laccase. The reaction mixture (10 mL) was incubated at 40 ° C and 185 rpm for 24 h. Samples were taken at intervals (0 min, 3 min, 6 min, 9 min, 12 min, 15 min, 18 min, 21 min and 24 min) to monitor the degradation rate of BPA at each concentration and analyze it by HPLC.

[0078] like Figure 7 As shown in Figure B, due to the production of laccase by HMA1, a blue-purple oxidation zone was observed behind and around the fungal colony. The activity of partially purified laccase in removing BPA was investigated under the condition of BPA concentration of 50-500 μg. Figure 7 As shown in Figure C, the BPA removal rate gradually increased with the extension of enzyme incubation time. Laccase can completely degrade 50 μg of BPA within 6 h. As the BPA concentration increases, the removal time for 200 μg, 300 μg and 500 μg of BPA increases to 12 h, 18 h and 24 h, respectively, while 55% of BPA (600 μg) requires 24 h of incubation.

[0079] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Paraconiothyrium brasiliense HMA1, characterized in that: It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is October 16, 2024, and the deposit number is CGMCC No.41574.

2. A fermentation method of Pseudomonas brasiliensis HMA1 according to claim 1, characterized in that: The method comprises the steps of inoculating the mycelium of Pseudomonas brasiliensis HMA1 into PDY gravy medium for fermentation.

3. A fermentation product obtained by fermentation according to the fermentation method according to claim 2.

4. The fermentation product according to claim 3, characterized in that The fermentation product includes laccase.

5. Use of the Pseudomonas brasiliensis HMA1 according to claim 1 or the fermentation product according to claim 3 in degrading bisphenol compounds.

6. The use according to claim 5, characterized in that: The bisphenol compounds include bisphenol B and bisphenol F.

7. Use of the Pseudomonas brasiliensis HMA1 according to claim 1 or the fermentation product according to claim 3 in degrading bisphenol A.

8. Use of the Pseudomonas brasiliensis HMA1 according to claim 1 or the fermentation product according to claim 3 in degrading organophosphorus flame retardants.

9. The use according to claim 8, characterized in that: The organic phosphorus flame retardant includes tritolyl phosphate and ethylhexyl diphenyl phosphate.

10. A microbial agent for degrading bisphenol compounds, characterized in that: The invention comprises the Pseudomonas brasiliensis HMA1 as described in claim 1 or the fermentation product as described in claim 3; the bisphenol compounds comprise bisphenol A, bisphenol B and bisphenol F.

Images