Breeding method of robust saccharomyces cerevisiae tolerant to high-concentration cane molasses and high-concentration ethanol fermentation application of robust saccharomyces cerevisiae

Abstract

The invention discloses a breeding method of high-concentration cane molasses tolerant robust saccharomyces cerevisiae and high-concentration ethanol fermentation application of the high-concentration cane molasses tolerant robust saccharomyces cerevisiae, and belongs to the technical field of biology. The Saccharomyces cerevisiae NGTM-F1 disclosed by the invention is preserved in the Guangdong Microbial Culture Collection Center on July 25, 2023, and the number of the Saccharomyces cerevisiae NGTM-F1 is GDMCC 63687. The Saccharomyces cerevisiae NGTM-F1 disclosed by the invention is named as Saccharomyces cerevisiae NGTM-F1. The saccharomyces cerevisiae is obtained by taking laboratory saccharomyces cerevisiae GJ08 as an original strain, carrying out ARTP (room temperature plasma) mutagenesis and adaptive evolution breeding and utilizing high-throughput screening, keeps a good growth state in cane molasses with the total sugar being 300 g / L, and has good fermentation performance in cane molasses with the total sugar being 250 g / L at the temperature of 30 DEG C. Under the condition of 30 DEG C in a conical flask, the total sugar consumed by fermentation is 250 g / L, the ethanol concentration can reach 102.30 g / L, and the fermentation efficiency is 80.8%; under the condition of 30 DEG C in a 5 L fermentation tank, the total sugar consumed by fermentation is 250 g / L, the ethanol concentration can reach 111.65 g / L, and the fermentation efficiency is 87.0%.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for breeding a high-concentration sugarcane molasses-tolerant yeast and its high-concentration ethanol fermentation application. Background Art

[0002] Fuel ethanol is an ideal alternative energy source. It can effectively reduce the consumption of fossil energy and protect the environment as a green energy source. Most fuel ethanol is fermented from starch crops, with corn, wheat and sorghum being the main contributors.

[0003] Corn is one of the main raw materials for fermentation and production of fuel ethanol, and is also used as a raw material for other processing industries such as feed and food processing. Sugarcane molasses is a byproduct of sugarcane juice in the production of white sugar. It contains a large amount of sucrose and invert sugar and has a low market value. It is a good raw material for the production of fuel ethanol. High-concentration sugarcane molasses fermentation is a means of effectively utilizing molasses. On the one hand, it can improve the utilization rate of substrates and equipment, and on the other hand, it can reduce the discharge of waste mash and improve the economic benefits of production enterprises. Sugarcane molasses is a byproduct of sugarcane juice sugar production. Due to the sugar production process, sugarcane harvesting and processing, and sugarcane fertilization, molasses has a large amount of ash (K, Ca, Mg, Fe, etc.), colloids, pigments and other impurities, which seriously reduce the utilization rate of sugarcane molasses. Therefore, how to improve the robustness of brewer's yeast to high-concentration sugarcane molasses is particularly important for the use of high-concentration sugarcane molasses to achieve high-concentration ethanol fermentation applications.

[0004] In recent years, some research progress has been reported on the ethanol fermentation of Saccharomyces cerevisiae under high-concentration sugarcane molasses conditions. To achieve high-concentration sugarcane molasses alcohol fermentation, it is basically necessary to start with low-concentration sugarcane molasses alcohol fermentation. Initially, Ghorbani F (The kinetics of ethanol production from cane molasses by S. cerevisiae in a batch bioreactor [J]. Energy Sources, 2013.) In a molasses environment with a total sugar concentration of 5% (w / v) and pH 4.5, the fermentation was carried out at 30°C for 36 h, and the final ethanol production peak and cell density remained at 9.31 g / L and 5.15 g / L. After that, the researchers increased the total sugar concentration and continuously optimized the molasses medium to continue to explore the fermentation of sugarcane molasses. Muhammad Arshad (Kinetics and thermodynamics of ethanol production by S. cerevisiaeMLD10 using molasses [J]. Applied Biochemistry and Biotechnology, 2014.) found that the maximum ethanol yield could reach 85 g / L in batch fermentation of molasses with a total sugar content of 180 g / L, which was significantly higher than the yield of the starting strain. Ling Changqing (Research on high-concentration alcohol fermentation of sugarcane molasses using high-yield yeast [J]. Guangxi Light Industry, 2011.) reported the alcohol fermentation characteristics of high-yield brewer's yeast sugarcane molasses. The strain was cultured in 20 °Bx molasses medium to prepare seed liquid, and then the seed liquid was mixed with 55 °Bx molasses medium in a 1:1 ratio for pilot fermentation. The alcohol content of the mash after fermentation for 48-52 h reached 13.3-13.4% (v / v). Chen Ying (Gene Recombination Construction of High-yield Saccharomyces Saccharomyces Strain of Sugarcane Molasses Alcohol [J]. Biotechnology, 2017.) reported the construction of high-yield Saccharomyces Saccharomyces Saccharomyces Saccharomyces strain of sugarcane molasses alcohol by gene recombination. The results showed that the reconstructed strain had the most obvious difference compared with the original strain in 40 °Bx molasses, with the maximum cell number increased by 58.7% and the maximum alcohol production rate increased by 4.5%. Xu Wanxia (Study on Continuous Ethanol Fermentation of Sugarcane Molasses and Its Residual Sugar Control Technology [D], Guangzhou, South China University of Technology, 2013.) explored the effect of cellulase addition on residual sugar in molasses enzymatic hydrolysis and continuous fermentation of molasses alcohol. The average residual sugar concentration and ethanol concentration of 22 °Bx molasses after cellulase enzymatic hydrolysis were 3.71 g / L and 73.45 g / L, respectively. Compared with the unenzymatic hydrolysis of 22 °Bx molasses, the residual sugar concentration decreased by 42.99% and the ethanol concentration increased by 11.6%. Huang (Enhanced ethanol production from sugarcane molasses by industriallyengineered S. cerevisiae via replacement of the PHO4 gene [J]. 2020.) Replacement of a new candidate ethanol fermentation-related regulatory gene from a fast-growing strain MC15 PHO4 The results showed that the industrial engineering strain MF01-PHO4 PHO4 It showed genome stability and the average maximum ethanol production increased to 114.71 g / L. Compared with the original strain MF01, the ethanol production increased by 5.30% and the fermentation time was shortened by 12.5%. Summary of the invention

[0005] In order to effectively solve the problem that the high-concentration sugarcane molasses environment has a stress-inhibiting effect on the ethanol fermentation process of brewer's yeast, resulting in slow cell growth and low ethanol production, the present invention provides a strain of robust brewer's yeast that tolerates high-concentration sugarcane molasses and its ethanol fermentation application. The yeast provided by the present invention has significantly improved indicators such as bacterial growth, cell morphology, ethanol synthesis capacity, and production intensity under the conditions of 30°C and 250 g / L sugarcane molasses.

[0006] The present invention provides a high-concentration sugarcane molasses tolerant yeast, which is derived from Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) GJ08 was obtained through ARTP mutagenesis breeding and high-throughput screening, and was deposited in Guangdong Microbial Culture Collection Center on July 25, 2023 (address: Guangzhou City, Guangdong Province, postal code 511356), and named Saccharomyces cerevisiae ( S. cerevisiae )NGTM-F1, the deposit number is: GDMCC No.63687.

[0007] Furthermore, Saccharomyces cerevisiae ( S. cerevisiae NGTM-F1 has good growth performance at 30℃ and 300 g / L sugarcane molasses, and has good ethanol fermentation performance at 30℃ and 250 g / L sugarcane molasses. In a conical flask at 30℃, the total sugar consumption was 250 g / L, the ethanol concentration could reach 102.30 g / L, the fermentation efficiency was 80.8%, and the ethanol production intensity during the fermentation process could reach 1.42 g / L / h; in a 5 L fermenter at 30℃, the total sugar consumption was 250 g / L, the ethanol concentration could reach 111.65 g / L, the fermentation efficiency could reach 87.0%, and the ethanol production intensity during the fermentation process could reach 1.86 g / L / h.

[0008] The present invention provides a second aspect of Saccharomyces cerevisiae ( S. cerevisiae )NGTM-F1 breeding methods, including ARTP mutagenesis and adaptive evolution breeding, and high-throughput screening methods.

[0009] Further, the ARTP mutagenesis and adaptive evolution breeding method in a high concentration sugarcane molasses environment comprises the following steps: (1) Pick up the Saccharomyces cerevisiae on the slant medium ( S. cerevisiae ) A single colony of GJ08 was inoculated into the primary seed culture medium and cultured at 30°C and 200 r / min for 12 h.

[0010] (2) Take 5 mL of the bacterial solution from step (1), collect the yeast cells by centrifugation at 12,000 rpm for 3 min, and wash twice with ice water.

[0011] (3) The yeast cells in step (2) were subjected to plasma mutagenesis at room temperature and pressure in the ARTP mutagenesis system. The parameters were set as follows: 1) The RF power input was set to 100 W and the helium flow rate was set to 10 SLM; 2) The distance between the plasma torch nozzle outlet and the slide was set to 2 mm. 3) Different mutagenesis times were selected: 80 s, 100 s, 120 s, 140 s, 160 s, 180 s, and 200 s. After mutagenesis, the slide was rinsed with ice water to generate the ARTP mutant library.

[0012] (4) The mutant library in step (3) was transferred to 250 g / L sugarcane molasses and cultured at 30°C and 150 rpm for 24 h. The cells were subcultured every 24 h by inoculating 10% of the inoculum into fresh culture medium and observing the changes in cell number under a microscope.

[0013] (5) After the cell number in step (4) stabilizes, perform mutagenesis and subculture again according to the methods of steps (2), (3) and (4), gradually increasing the total sugar concentration (270 g / L, 300 g / L) of sugarcane molasses to obtain the final mutagenic bacterial library.

[0014] Furthermore, the high throughput screening method comprises the following steps: (1) Dilute the final mutagenic bacteria library prepared in step 1 with sterile water to an appropriate multiple, spread evenly on the TTC bottom culture medium, and culture in a constant temperature incubator at 30°C for 36 h.

[0015] (2) Slowly pour the TTC upper layer of culture medium into the plate described in step (1) until the single colony is covered. Incubate in a 30°C constant temperature incubator for 5-10 min, paying attention to the color development of the plate.

[0016] (3) Select 500 mutant strains with faster color development and darker color development described in step (2) to form a primary screening bacterial library.

[0017] (4) The yeast cells in the primary screening bacterial library described in step (3) were selected in order into a 48-deep-well culture plate, and 1 mL of 300 g / L total sugar simulated molasses medium was added to the culture plate, and cultured at 30°C and 200 r / min for 72 h.

[0018] (5) The deep-well culture plate in step (4) was left to stand for 30 min to allow the Saccharomyces cerevisiae strain to sink automatically. The supernatant was used to determine the pyruvate content. First, 120 L of the fermentation supernatant (five-fold dilution) was transferred to a 96-well ELISA plate, and then 80 L of 0.1 mol / L ferric nitrate was added. The reaction was allowed to react at room temperature for 10 min and the absorbance of the reaction system was measured at OD520 nm. Eight Saccharomyces cerevisiae mutant strains with smaller absorbance values ​​were selected to form a double screening library.

[0019] (6) Pick out the eight yeast strains from the rescreened bacterial library in step (5) and inoculate them into 100 mL of primary seed culture medium, and culture them at 30°C and 200 r / min for 12-14 h. Centrifuge and add sterile water to obtain a 10-fold concentrated primary seed solution, inoculate it into a secondary seed culture medium at a 10% (v / v) inoculation rate, and culture it at 30°C and 200 r / min for 8-10 h to obtain a secondary seed solution.

[0020] (7) The secondary seed solution described in step (6) was centrifuged and added with sterile water to obtain a 10-fold concentrated seed solution, which was inoculated into a 250 g / L sugarcane molasses medium at a 10% (v / v) inoculation rate and fermented at 30°C and 150 r / min. Finally, the Saccharomyces cerevisiae strain with the highest ethanol concentration and fermentation efficiency was obtained and named Saccharomyces cerevisiae ( S. cerevisiae )NGTM-F1.

[0021] gene protein name mutation site YAL005C Hsp70 family ATPase SSA1 NC_001133.9:140865:140865:T:C; YAL029C myosin 4 NC_001133.9:88113:88113:G:A; YAL063C flocculin FLO9 NC_001133.9:25287:25287:G:A;NC_001133.9:25235:25264:CTGAGGAAGAAATGACTAGAGAAGAAGTGT:-;NC_001133.9:25248:25250:GAC:-;NC_001133.9:25253:25264:GAGAAGAAGTGT:-; YAL068C seripauperin PAU8 NC_001133.9:1918:1918:A:G;NC_001133.9:1927:1927:G:A; YAR050W flocculin FLO1 NC_001133.9:204275:204275:T:C;NC_001133.9:204281:204281:A:G;NC_001133.9:207128:207128:G:A;NC_001133.9:207156:207156:C:T;NC_001133.9:207173:207173:A:G;NC_001133.9:205742:205742:T:C;NC_001133.9:207176:207176:T:C;NC_001133.9:206360:206360:T:C;NC_001133.9:207179:207179:T:C;NC_001133.9:206363:206363:C:T;NC_001133.9:206757:206757:A:G;NC_001133.9:207241:207241:C:T;NC_001133.9:207257:207257:A:G;NC_001133.9:207362:207362:A:G; YAR071W acid phosphatase PHO11 NC_001133.9:225465:225465:G:C;NC_001133.9:225498:225498:T:C;NC_001133.9:226038:226038:A:C;NC_001133.9:226044:226044:G:A;NC_001133.9:226062:226062:C:T;NC_001133.9:226067:226067:C:T;NC_001133.9:226068:226068:T:C;NC_001133.9:226084:226084:C:T;NC_001133.9:226086:226086:G:A;NC_001133.9:226131:226131:T:C;NC_001133.9:226149:226149:T:C;NC_001133.9:226155:226155:C:T;NC_001133.9:226185:226185:A:G;NC_001133.9:226206:226206:G:A;NC_001133.9:226221:226221:T:C; YBL005W-B gag-polfusionprotein NC_001134.8:224681:224681:C:T;NC_001134.8:226400:226400:C:A; YBL100W-A,YBL100W-B gag protein;gag-polfusionprotein NC_001134.8:30754:30754:G:A;NC_001134.8:30210:30210:T:C; YBL100W-B gag-polfusionprotein NC_001134.8:34579:34579:A:G;NC_001134.8:33075:33075:A:G;NC_001134.8:33080:33080:G:A;NC_001134.8:33652:33652:A:G;NC_001134.8:33656:33656:A:C;NC_001134.8:33657:33657:A:G;NC_001134.8:33694:33694:T:C;NC_001134.8:33704:33704:G:A;NC_001134.8:33705:33705:A:G;NC_001134.8:33743:33743:C:T;NC_001134.8:33752:33752:A:G; YBL108C-A seripauperinPAU9 NC_001134.8:7629:7629:G:A;NC_001134.8:7632:7632:C:T;NC_001134.8:7669:7669:C:G; YBR023C chitinsynthase CHS3 NC_001134.8:287861:287861:G:C; YBR026C enoyl NC_001134.8:293140:293140:G:A; YBR078W Ecm33p NC_001134.8:393282:393282:T:C; YBR126C alpha,alpha-trehalose-phosphatesynthase(UDP-forming)TPS1 NC_001134.8:489517:489517:G:A; YBR280C SCF ubiquitinligasecomplexsubunit SAF1 NC_001134.8:763094:763094:T:C; YBR295W cation-transportingP-type ATPasePCA1 NC_001134.8:793635:793635:-:A;NC_001134.8:793652:793652:-:T;NC_001134.8:793735:793743:TAGGTTGTA:-; YBR297W transcriptionfactor MAL33 NC_001134.8:801830:801830:G:A;NC_001134.8:801758:801758:T:A;NC_001134.8:801782:801782:C:T;NC_001134.8:801785:801785:G:A;NC_001134.8:801806:801806:T:C;NC_001134.8:801822:801822:T:G;NC_001134.8:801827:801827:A:G;NC_001134.8:801869:801869:T:A;NC_001134.8:801854:801854:T:-;NC_001134.8:801859:801861:TCG:-;NC_001134.8:801864:801864:-:ACAC; YBR298C maltosepermease NC_001134.8:803038:803038:A:C;NC_001134.8:803052:803052:G:A;NC_001134.8:803064:803064:A:G;NC_001134.8:803098:803098:C:T;NC_001134.8:803988:803988:A:G;NC_001134.8:803063:803063:G:C;NC_001134.8:803133:803133:C:T;NC_001134.8:803171:803171:A:T;NC_001134.8:803180:803180:C:T;NC_001134.8:803188:803188:C:T;NC_001134.8:803189:803189:A:G;NC_001134.8:803041:803041:A:-;NC_001134.8:803058:803059:AT:-;NC_001134.8:803061:803061:-:CT;NC_001134.8:803190:803190:-:AGAGGCCAAATATAA;NC_001134.8:803195:803195:-:GTATCTTAAACTCCAATCGATTAGGGATGTTCGAAACTAGTCCGGATCTCATTAGCAGTCCTTATTGTAA; YCL019W gag-polfusionprotein NC_001135.5:88323:88323:A:G;NC_001135.5:88124:88124:G:A; YCL073C glutathioneexchanger NC_001135.5:6824:6824:C:T;NC_001135.5:6977:6977:A:G; YCR039C homeodomainmating typeproteinalpha2 NC_001135.5:199831:199831:A:G; YCR089W Fig2p NC_001135.5:269080:269080:G:A; YDL037C Bsc1p NC_001136.10:385079:385079:A:G;NC_001136.10:384920:384923:GAAG:-;NC_001136.10:384925:385025:HOLDER GGATGAAGTAGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAG:-; YDL083C ribosomal 40Ssubunitprotein S16B NC_001136.10:307028:307028:G:A; YDL112W tRNA(guanosine(18)-2\\'-O)-methyltransferase NC_001136.10:262908:262908:G:A; YDL244W 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate synthase NC_001136.10:16362:16362:A:G;NC_001136.10:16839:16839:G:A; YDL245C hexose transporterHXT15 NC_001136.10:12038:12038:G:A;NC_001136.10:12110:12110:G:A;NC_001136.10:12113:12113:T:G;NC_001136.10:1 2140:12140:A:G;NC_001136.10:12144:12144:T:G;NC_001136.10:12146:12146:T:C;NC_001136.10:12158:12158:T:C; YDL248W Cos7p NC_001136.10:1944:1944:C:T;NC_001136.10:1970:1970:C:G;NC_001136.10:1997:1997:T:G;NC_001136.10:2338:2338:T:C;NC_001136.10:2341:2341:C:T;NC_001136.10:2347:2347:T:C;NC_001136.10:1810:1810:G:C;NC_001136.10:1822:1822:A:G;NC_001136.10:1843:1843:G:A;NC_001136.10:1847:1847:T:C;NC_001136.10:1849:1849:C:T;NC_001136.10:1850:1850:T:G;NC_001136.10:1860:1860:T:A;NC_001136.10:1815:1819:AAGTC:-;NC_001136.10:1822:1822:-:TTGGG;NC_001136.10:1856:1856:C:-;NC_001136.10:1858:1858:-:T; YDR034C-D gag-polfusionprotein NC_001136.10:516534:516534:T:G;NC_001136.10:516467:516467:C:G;NC_001136.10:516469:516469:T:G;NC_001136.10:516488:516488:T:C; YDR150W Num1p NC_001136.10:757857:757857:T:C;NC_001136.10:757859:757859:A:G;NC_001136.10:759248:759248:C:A;NC_001136.10:759578:759578:T:C;NC_001136.10:759593:759593:C:T;NC_001136.10:759594:759594:A:G;NC_001136.10:759597:759597:A:G;NC_001136.10:759692:759692:G:A; YDR170W-A gag protein NC_001136.10:803293:803293:A:G;NC_001136.10:803352:803352:A:G;NC_001136.10:803361:803361:C:T;NC_001136.10:803626:803626:G:A;NC_001136.10:803638:803638:A:T;NC_001136.10:803651:803651:C:A;NC_001136.10:803880:803880:T:C;NC_001136.10:804088:804088:A:C;NC_001136.10:804260:804260:A:C;NC_001136.10:804373:804373:A:G; YDR210W-B gag-polfusionprotein NC_001136.10:875274:875274:A:C;NC_001136.10:876180:876180:T:C;NC_001136.10:876231:876231:A:G;NC_001136.10:876273:876273:T:C; YDR343C hexosetransporterHXT6 NC_001136.10:1159797:1159797:A:G;NC_001136.10:1159803:1159803:G:A;NC_001136.10:1159804:1159804:A:T;NC_001136.10:1159899:1159899:C:G;NC_001136.10:1159901:1159901:A:T;NC_001136.10:1159905:1159905:A:G;NC_001136.10:1159909:1159909:G:C;NC_001136.10:1159910:1159910:C:A;NC_001136.10:1159920:1159920:A:G;NC_001136.10:1159930:1159930:G:C;NC_001136.10:1159931:1159931:C:A;NC_001136.10:1159975:1159975:T:A;NC_001136.10:1160022:1160022:G:T;NC_001136.10:1161053:1161053:T:C;NC_001136.10:1159914:1159914:-:TG;NC_001136.10:1159916:1159917:TA:-; YDR375C bifunctionalAAA familyATPasechaperone / translocaseBCS1 NC_001136.10:1226534:1226534:C:T; YDR534C Fit1p NC_001136.10:1504406:1504406:C:T; YEL069C hexosetransporterHXT13 NC_001137.3:21759:21759:G:A;NC_001137.3:21951:21951:A:G; YFL058W 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphatesynthase NC_001138.5:13477:13477:A:G;NC_001138.5:13792:13792:C:T;NC_001138.5:13793:13793:T:C;NC_001138.5:13252:13252:T:C;NC_001138.5:13342:13342:C:T; YFL059W pyridoxinebiosynthesisprotein SNZ3 NC_001138.5:11716:11716:C:T;NC_001138.5:11722:11722:G:C;NC_001138.5:11747:11747:C:T;NC_001138.5:11749:11749:A:G;NC_001138.5:11758:11758:T:A;NC_001138.5:11883:11883:A:C;NC_001138.5:11896:11896:A:G;NC_001138.5:11899:11899:C:G;NC_001138.5:11908:11908:A:T;NC_001138.5:11911:11911:T:A;NC_001138.5:11914:11914:G:A;NC_001138.5:11918:11918:A:G;NC_001138.5:11922:11922:A:G;NC_001138.5:12124:12124:G:A;NC_001138.5:12138:12138:A:C;NC_001138.5:12144:12144:C:A;NC_001138.5:12154:12154:G:A;NC_001138.5:12155:12155:C:A;NC_001138.5:12160:12160:T:G;NC_001138.5:12139:12139:-:T; YFL062W Cos4p NC_001138.5:6699:6699:A:G;NC_001138.5:6700:6700:G:A;NC_001138.5:6703:6703:T:C;NC_001138.5:6713:6713:A:G;NC_001138.5:6716:6716:T:C;NC_001138.5:6719:6719:C:T;NC_001138.5:7110:7110:T:G;NC_001138.5:6467:6467:A:G;NC_001138.5:6474:6474:T:G;NC_001138.5:6885:6885:G:A;NC_001138.5:6886:6886:C:T;NC_001138.5:6664:6664:-:A;NC_001138.5:6670:6670:G:-; YFR016C Aip5p NC_001138.5:178043:178043:T:C;NC_001138.5:178052:178052:T:C;NC_001138.5:178054:178054:A:T;NC_001138.5:178063:178063:G:A;NC_001138.5:178069:178069:T:C;NC_001138.5:178083:178083:A:G;NC_001138.5:178096:178096:C:T;NC_001138.5:178120:178120:A:C; YFR051C coatomersubunit delta NC_001138.5:251519:251519:C:T; YGL259W Yps5p NC_001139.9:8574:8574:T:G; YGR027W-B gag-polfusionprotein NC_001139.9:540263:540263:A:G;NC_001139.9:540443:540443:G:A; YGR094W valine--tRNAligase NC_001139.9:673253:673253:T:C; YGR109W-B gag-polfusionprotein NC_001139.9:711063:711063:C:T;NC_001139.9:711066:711066:A:T;NC_001139.9:709566:709566:C:T; YGR134W CCR4-NOT coresubunitCAF130 NC_001139.9:760606:760606:A:G; YGR138C sperminetransporter NC_001139.9:764971:764971:A:G; YGR161C-D gag-polfusionprotein NC_001139.9:819784:819784:A:G;NC_001139.9:819911:819911:T:A;NC_001139.9:819945:819945:T:C;NC_001139.9:819950:819950:T:C;NC_001139.9:820117:820117:A:G; YGR203W phosphataseYCH1 NC_001139.9:905349:905349:T:C; YGR287C oligo-1,6-glucosidaseIMA1 NC_001139.9:1067366:1067366:G:A;NC_001139.9:1067375:1067375:C:A;NC_001139.9:1067396:1067396:G:A;NC_001139.9:1067411:1067411:G:A;NC_001139.9:1067414:1067414:A:G;NC_001139.9:1067417:1067417:C:T;NC_001139.9:1067419:1067419:A:G;NC_001139.9:1067423:1067423:C:T;NC_001139.9:1067426:1067426:A:G;NC_001139.9:1067429:1067429:G:A;NC_001139.9:1067432:1067432:T:C;NC_001139.9:1067435:1067435:A:G;NC_001139.9:1068831:1068831:G:A; YGR288W transcriptionfactor MAL13 NC_001139.9:1071251:1071251:C:T;NC_001139.9:1071252:1071252:G:A;NC_001139.9:1071264:1071264:A:G;NC_001139.9:1071271:1071271:A:T; YGR292W alpha-glucosidaseMAL12 NC_001139.9:1077997:1077997:C:T;NC_001139.9:1076820:1076820:C:T; YGR294W seripauperinPAU12 NC_001139.9:1080521:1080521:C:T;NC_001139.9:1080584:1080584:C:T; YGR295C Cos6p NC_001139.9:1082043:1082043:A:T;NC_001139.9:1082456:1082456:T:C;NC_001139.9:1082513:1082513:G:A;NC_001139.9:1082599:1082599:T:G;NC_001139.9:1082601:1082601:A:C;NC_001139.9:1082613:1082613:A:C;NC_001139.9:1082614:1082614:A:T;NC_001139.9:1082615:1082615:A:C;NC_001139.9:1082639:1082639:G:T;NC_001139.9:1082471:1082471:C:G;NC_001139.9:1082477:1082477:C:T;NC_001139.9:1082485:1082485:C:A;NC_001139.9:1082495:1082495:C:A;NC_001139.9:1082514:1082514:C:T;NC_001139.9:1082625:1082626:GC:-;NC_001139.9:1082627:1082627:-:TC; YHL048W Cos8p NC_001140.6:6421:6421:A:G;NC_001140.6:6448:6448:C:T;NC_001140.6:6449:6449:T:G;NC_001140.6:6686:6686:A:G;NC_001140.6:7164:7164:C:T;NC_001140.6:7218:7218:G:A;NC_001140.6:7220:7220:G:A;NC_001140.6:7222:7222:T:A;NC_001140.6:7227:7227:A:G;NC_001140.6:7228:7228:A:G;NC_001140.6:7411:7411:C:T;NC_001140.6:6523:6523:T:C;NC_001140.6:6421:6421:-:TTGGG;NC_001140.6:6457:6457:-:T; YHR044C 2-deoxyglucose-6-phosphatase NC_001140.6:194125:194125:A:G; YHR211W flocculinFLO5 NC_001140.6:525628:525628:T:A;NC_001140.6:525628:525628:T:C;NC_001140.6:525733:525733:T:C;NC_0011240 :525744:G:C;NC_001140.6:525747:525747:T:G;NC_001140.6:525748:525748:T:C;NC_001140.6:525751:52571;005_NC1:A 40.6:525761:525761:A:T;NC_001140.6:525763:525763:T:A;NC_001140.6:525766:525766:T:C;NC_001140.6:525767:6:525767 T:C;NC_001140.6:527225:527225:A:G;NC_001140.6:525556:525556:G:T;NC_001140.6:527492:527492:A:5140;NC_001: 577:525577:T:C;NC_001140.6:527517:527517:C:A;NC_001140.6:525578:525578:G:C;NC_001140.6:527567_NC:5275;5275; 001140.6:525579:525579:G:A;NC_001140.6:527578:527578:G:A;NC_001140.6:525700:525700:A:T;NC_00152540.6. 703:C:T;NC_001140.6:527286:527286:C:G;NC_001140.6:525585:525587:CCT:-;NC_001140.6:525717:5251140_:0;0;T .6:527288:527288:-:AGGGTTTGATTACAA;NC_001140.6:525657:525659:GTT:-;NC_001140.6:525661:525661:-:ACC;NC_0011406:527035:527169:AACTACCGAACCATGGACCGGAACTTTCACCTCTACATCCACTGAGATGACTACTGTGACCGGTACCAACGGTCAACCAACTGACGAAACTGTTATTGTCATTAGAACTCCAACTAGTGAGGGTTTGATTACTAG:-;. YHR216W IMPdehydrogenaseIMD2 NC_001140.6:555421:555421:T:C;NC_001140.6:555445:555445:C:G;NC_001140.6:554632:554632:G:C;NC_001140.6:555325:555325:C:T; YIL169C Css1p NC_001141.2:23677:23677:T:G;NC_001141.2:23764:23764:G:A;NC_001141.2:23767:23767:G:A;NC_001141.2:23813:23813:A:G;NC_001141.2:23824:23824:T:C;NC_001141.2:25569:25569:T:C;NC_001141.2:23765:23872:GTGACAGTCTTGGTGTTACAGCCATTGTCGTCACAGTGGGTTACGGTGACAGTGGTGTATGATTTTGGAGAAGCAGTTGTTGCTGATGTTTCTTTGGAACATTCAGAA:-; YIR019C Flo11p NC_001141.2:391255:391255:T:A;NC_001141.2:391258:391258:T:A;NC_001141.2:391259:391259:A:G;NC_001141.2:391260:391260:C:A;NC_001141.2:391282:391282:T:G;NC_001141.2:391288:391288:G:A;NC_001141.2:391294:391294:T:A;NC_001141.2:391295:391295:A:G;NC_001141.2:391300:391300:A:T;NC_001141.2:391786:391786:G:A; YJL113W gag-polfusionprotein NC_001142.9:198867:198867:C:T;NC_001142.9:199055:199055:A:G;NC_001142.9:199063:199063:C:A; YJL219W hexosetransporterHXT9 NC_001142.9:20666:20666:T:A;NC_001142.9:20688:20688:G:A; YJR151C Dan4p NC_001142.9:712920:712920:G:A;NC_001142.9:712932:712932:T:C;NC_001142.9:712948:712948:A:G;NC_001142.9:712951:712951:T:A;NC_001142.9:712983:712983:C:T; YJR156C 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphatesynthase NC_001142.9:728604:728604:A:G;NC_001142.9:728612:728612:G:T;NC_001142.9:728829:728829:C:T;NC_001142.9:729029:729029:A:G;NC_001142.9:729042:729042:C:T;NC_001142.9:729048:729048:T:C; YJR161C Cos5p NC_001142.9:743551:743551:C:A;NC_001142.9:743565:743565:G:A;NC_001142.9:743575:743575:C:T;NC_001142.9:743587:743587:G:A;NC_001142.9:743589:743589:C:G;NC_001142.9:743741:743741:C:G;NC_001142.9:743756:743756:G:A;NC_001142.9:743926:743926:A:G; YKL005C Bye1p NC_001143.9:434737:434737:A:G; YKL100C asparticendopeptidase NC_001143.9:255366:255366:G:A; YKL163W beta-1,3-glucan linkedprotein NC_001143.9:144742:144742:C:T;NC_001143.9:144829:144829:G:A; YKL164C beta-1,3-glucan linkedprotein NC_001143.9:142559:142559:A:G;NC_001143.9:142562:142562:A:G;NC_001143.9:142565:142565:A:G; YKL201C Mnn4p NC_001143.9:64059:64059:C:T;NC_001143.9:64062:64062:T:C;NC_001143.9:64068:64068:G:C; NC_001143.9:64070:64070:T:G;NC_001143.9:64254:64254:C:T;NC_001143.9:64272:64272:T:C; YKL224C semiuperinPAU16 NC_001143.9:2080:2080:A:G; YKR055W Rho familyGTPase RHO4 NC_001143.9:548809:548809:G:A; YKR102W Flo10p NC_001143.9:646994:646994:C:T; YKR106W glutathioneexchanger NC_001143.9:662123:662123:A:G;NC_001143.9:662944:662944:G:A; YLL021W Spa2p <h2 style=";text-align:left;direction:ltr">NC_001144.5:103650:103650:C:A;NC_001144.5:103655:103655:A:G;NC_001144.5:103660:1 03660:A:C;NC_001144.5:103664:103664:T:C;NC_001144.5:103682:103682:C:T;NC_001144. 5:103697:103697:T:C;NC_001144.5:103700:103700:A:G;NC_001144.5:103706:103706:G:A; NC_001144.5:103707:103707:A:G;NC_001144.5:103713:103713:G:A;NC_001144.5:103723:1 03723:T:C;NC_001144.5:103729:103729:G:A;NC_001144.5:103737:103737:G:T;NC_001144. 5:103751:103751:C:T;NC_001144.5:103778:103778:T:C;NC_001144.5:103614:103614:-:TC AAGTCTTTGGGTATGACAGGAAAGGCTGTAGGCACAGAGTCAGCTAGCAGGGTCGAATCTCCGGGTATGACAGGACAGATCAAGTCTTTAGATATGACAGGAAAAGCTGTAGACCCAGAATCAGATAGTAGGGTTGAATCTCCGGGCATGAAAGAGCAGA; <h2 style=";text-align:left;direction:ltr"> YLL027W <h2 style=";text-align:left;direction:ltr"> Fe-bindingFe / S cluster assemblyprotein ISA1 <h2 style=";text-align:left;direction:ltr"> NC_001144.5:87994:87994:G:T; <h2 style=";text-align:left;direction:ltr"> YMR045C,YMR046C <h2 style=";text-align:left;direction:ltr"> gag-polfusionprotein;gagprotein <h2 style=";text-align:left;direction:ltr"> NC_001145.3:362524:362524:A:T;NC_001145.3:362082:362082:G:T; <h2 style=";text-align:left;direction:ltr"> YMR070W <h2 style=";text-align:left;direction:ltr"> Mot3p <h2 style=";text-align:left;direction:ltr"> NC_001145.3:409252:409252:G:A;NC_001145.3:409255:409255:G:A; <h2 style=";text-align:left;direction:ltr"> YMR173W <h2 style=";text-align:left;direction:ltr"> DNA damage-responsive protein 48 NC_001145.3:609063:609063:G:A;NC_001145.3:609084:609084:T:C;NC_001145.3:609090:609090:T:C;NC_001145.3:609093:609093:C:T;NC_001145.3:609099:609099:G:A;NC_001145.3:609372:609372:T:C;NC_001145.3:609378:609378:A:C;NC_001145.3:609381:609381:T:C;NC_001145.3:609738:609738:C:T;NC_001145.3:609741:609741:T:C;NC_001145.3:609747:609747:C:A;NC_001145.3:609765:609765:A:C;NC_001145.3:609753:609755:TTC:-; YMR283C tRNA A64-2\\'-O-ribosylphosphatetransferase NC_001145.3:835508:835508:C:A; YNL054W-B gag-polfusionprotein NC_001146.8:524504:524504:C:T; YNL284C-A,YNL284C-B gag protein;gag-polfusionprotein NC_001146.8:101210:101210:T:C;NC_001146.8:101211:101211:G:A;NC_001146.8:101218:101218:G:A;NC_001146.8:101236:101236:G:T;NC_001146.8:101238:101238:A:G;NC_001146.8:101242:101242:A:C;NC_001146.8:101248:101248:G:A;NC_001146.8:101251:101251:G:A; YNL284C-B gag-polfusionprotein NC_001146.8:100678:100678:G:A;NC_001146.8:100753:100753:A:G; YNL332W 4-amino-5-hydroxymethyl-2-methylpyrimidine phosphatesynthase NC_001146.8:15245:15245:A:C;NC_001146.8:15155:15155:T:C;NC_001146.8:15245:15245:A:T; YNL336W Cos1p NC_001146.8:8536:8536:T:G;NC_001146.8:8545:8545:A:G;NC_001146.8:8551:8551:A:G; YNR069C Bsc5p NC_001146.8:761609:761609:-:GG; YNR072W hexosetransporterHXT17 NC_001146.8:774018:774018:A:G; YNR076W seripauperinPAU6 NC_001146.8:782151:782151:C:T;NC_001146.8:781974:781974:C:T; YOL103W-A,YOL103W-B gag protein;gag-polfusionprotein NC_001147.6:118071:118071:G:A; YOL155C mannoprotein NC_001147.6:29966:29966:A:G;NC_001147.6:29969:29969:A:G;NC_001147.6:29970:29970:G:C;NC_001147.6:29237:29237:A:T;NC_001147.6:29257:29257:A:T;NC_001147.6:29259:29259:T:C;NC_001147.6:29266:29266:A:G;NC_001147.6:29267:29267:A:C;NC_001147.6:29269:29269:T:C;NC_001147.6:29270:29270:A:G;NC_001147.6:29279:29279:T:C;NC_001147.6:29282:29282:A:G;NC_001147.6:30182:30182:C:T;NC_001147.6:30191:30191:G:A;NC_001147.6:30194:30194:G:A;NC_001147.6:30203:30203:A:G;NC_001147.6:30206:30206:G:A;NC_001147.6:30208:30208:G:T;NC_001147.6:30284:30284:T:C;NC_001147.6:30287:30287:A:G; YOL156W hexosetransporterHXT11 NC_001147.6:25542:25542:T:C;NC_001147.6:25614:25614:C:T;NC_001147.6:25746:25746:T:C;NC_001147.6:26625:26625:A:G;NC_001147.6:26775:26775:T:A;NC_001147.6:26895:26895:G:A;NC_001147.6:26898:26898:G:A;NC_001147.6:26907:26907:C:T; YOL157C oligo-1,6-glucosidaseIMA2 NC_001147.6:23189:23189:A:G;NC_001147.6:24010:24010:T:C;NC_001147.6:24145:24145:T:C; YOR192C-A,YOR192C-B gag protein;gag-polfusionprotein NC_001147.6:708722:708722:A:C;NC_001147.6:709324:709324:G:A;NC_0011 47.6:709325:709325:C:T;NC_001147.6:709391:709391:A:G;NC_001147.6:709 394:709394:T:A;NC_001147.6:709398:709398:C:T;NC_001147.6:709409:709 409:A:C;NC_001147.6:709416:709416:T:C;NC_001147.6:708594:708594:G:C; YOR343W-B gag-pol fusion protein NC_001147.6:973721:973721:T:G;NC_001147.6:973194:973194:C:A;NC_001147.6:973 616:973616:C:A;NC_001147.6:973659:973659:G:C;NC_001147.6:974266:974266:T:C; YPL057C mannosylinositolphosphorylceramidesynthasecatalyticsubunit SUR1 NC_001148.4:452179:452179:G:T; YPL155C Kip2p NC_001148.4:257967:257967:G:A; YPR042C Puf2p NC_001148.4:651658:651658:C:A; YPR143W Rrp15p NC_001148.4:818550:818550:-:GAAGAAGAAGAAGAAGATGATGATGATGATGATGAA; YPR156C sperminetransporter NC_001148.4:838274:838274:A:G;NC_001148.4:838970:838970:T:A;NC_001148.4:838977:838977:A:G; The above-mentioned Saccharomyces cerevisiae NGTM-F1 high-concentration ethanol fermentation application used fermentation conditions of 250 g / L total sugar cane molasses in shake flasks and 5 L tanks.

[0022] The third aspect of the present invention provides a method for applying (S. cerevisiae) NGTM-F1 high-concentration ethanol fermentation, comprising the following steps: (1) Under sterile conditions, pick a single colony of Saccharomyces cerevisiae NGTM from the slant medium and inoculate it into the primary seed medium. Cultivate it at 30°C and 200 rpm for 12 h. (2) Under sterile conditions, centrifuge the culture medium in step (1) and add sterile water to prepare a 10-fold concentrated primary seed solution, inoculate the secondary seed culture medium at a 10% (v / v) inoculation rate, and culture at 30°C and 200 r / min for 8-10 h; (3) Under sterile conditions, the culture medium of step (2) was centrifuged and sterile water was added to prepare a 10-fold concentrated primary seed solution, which was inoculated into a sugarcane molasses culture medium at a 10% (v / v) inoculation rate, and shake flask fermentation was performed at 30°C and 150 r / min.

[0023] (4) Under sterile conditions, the culture medium of step (2) was centrifuged and sterile water was added to prepare a 10-fold concentrated primary seed solution, which was inoculated into a sugarcane molasses culture medium at an inoculum amount of 17.5% (v / v), and fermented in a 5 L fermenter at 30°C and 150 r / min.

[0024] Furthermore, the formula of the culture medium used is as follows: (1) Slant culture medium (g / L): yeast powder 10, peptone 20, glucose 20, agar powder 20, natural pH; (2) Primary seed culture medium (g / L): 10% yeast powder, 20% peptone, 20% glucose, natural pH; (3) Secondary seed culture medium (g / L): yeast powder 10, peptone 20, glucose 50, natural pH; (4) Sugarcane molasses medium (g / L): total sugar concentration 250, 270, 300, urea 2.2, pH 4.5-5.0 (total sugar in molasses was determined by HPLC); (5) Simulated molasses medium (g / L): sucrose 285.7, yeast powder 10, peptone 20, calcium ion 8, potassium ion 15, magnesium ion 2.5, sodium ion 0.5, phosphorus ion 0.25, sulfur ion 0.8, manganese ion 0.035, if solid, add agar 20, pH 4.5-5.0; (6) TTC base medium (g / L): glucose 20, yeast extract powder 10, peptone 20, agar powder 20, natural pH; (7) TTC upper culture medium (g / L): 5% glucose, 20% agar powder, 0.5% 2,3,5-triphenyltetrazolium chloride (sterilize and cool to about 55°C, then add and mix well).

[0025] Furthermore, the pretreatment of the used sugarcane molasses comprises the following steps: (1) Measure 1000 mL of sugarcane molasses and dilute it with 1000 mL of distilled water; (2) Heat and boil for 30 minutes (molasses tends to produce a lot of foam when heated, so control the heating temperature and stir continuously to prevent violent boiling); (3) After the cold water is cooled to room temperature, add concentrated sulfuric acid to adjust the pH to 1.0-2.0 and let it stand overnight; (4) Maintain the mixture in a water bath at 90 °C for 30 min, during which time activated carbon powder (1% by weight) is continuously added and stirred; (5) After cooling to room temperature, centrifuge (4000 r / min, 10 min) to collect the supernatant. Adjust the pH of the supernatant to 4.5-5.0 with calcium hydroxide and centrifuge again (4000 r / min, 10 min). Collect the supernatant for fermentation.

[0026] Beneficial effects of the present invention: The present invention provides a high-concentration sugarcane molasses-tolerant yeast and a breeding method thereof, which are based on the brewer's yeast (S. cerevisiae) GJ08 preserved in this laboratory, obtained through ARTP mutagenesis breeding and high-throughput screening methods. This strain has significant stress resistance and high-concentration ethanol fermentation characteristics in a high-concentration sugarcane molasses environment, and is named as brewer's yeast (S. cerevisiae) NGTM-F1. The high-concentration ethanol fermentation application of the brewer's yeast NGTM-F1 provided by the present invention under the conditions of 30°C and 250 g / L total sugar cane molasses, in a conical flask at 30°C, the fermentation consumes 250 g / L of total sugar, the ethanol concentration can reach 102.30 g / L, the fermentation efficiency reaches 80.8%, and the ethanol production intensity during the fermentation process can reach 1.42 g / L / h; in a 5 L fermenter at 30°C, the fermentation consumes 250 g / L of total sugar, the ethanol concentration can reach 111.65 g / L, the fermentation efficiency reaches 87.0%, and the ethanol production intensity during the fermentation process can reach 1.86 g / L / h. In summary, the present invention enriches the resources and types of excellent strains for ethanol production, effectively solves the dilemma of high-concentration ethanol fermentation that is difficult to achieve using high-concentration sugar cane molasses, significantly improves the indicators such as bacterial growth, cell morphology, ethanol synthesis ability and production intensity during the fermentation process, and has important practical significance for the efficient use of sugar cane molasses for ethanol production. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the effect of different total sugar concentrations of sugarcane molasses on the growth of Saccharomyces cerevisiae GJ08; Figure 2 (a) to Figure 2 (d) show the number of breeding cells induced by ARTP and adaptive evolution in high-concentration sugarcane molasses; Figure 3 It is the cell morphological changes induced by ARTP mutagenesis and adaptive evolution breeding in high concentration of sugarcane molasses; Figure 4 This is a schematic diagram of the initial screening of TTC plates in a simulated molasses environment; Figures 5(a) to 5(e) are schematic diagrams of the rescreening of the reaction between pyruvate and ferric nitrate in the fermentation broth of a mutant strain tolerant to high concentrations of sugarcane molasses; Figure 6 It is the mutant strain that best tolerates high concentration of sugarcane molasses and produces alcohol; Figure 7 In a shake flask, the mutant strain NGTM-F1 and the starting strain GJ08 were compared in their ethanol synthesis ability using 250 g / L sugarcane molasses in a high-concentration sugarcane molasses environment; Figure 8The total sugar consumption capacity of the mutant strain NGTM-F1 and the starting strain GJ08 in a shake flask under a high-concentration sugarcane molasses environment was compared with that of the original strain GJ08. Fig. 9 The cell growth ability of mutant strain NGTM-F1 and starting strain GJ08 using 250 g / L total sugar cane molasses in a shake flask under high concentration of sugar cane molasses was compared. Fig.10 The ethanol synthesis ability of the mutant strain NGTM-F1 and the starting strain GJ08 using 250 g / L total sugar cane molasses was compared in a 5 L fermenter under a high concentration of sugar cane molasses. Implementation

[0028] The following is a further description of the present invention in conjunction with specific implementations, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0029] Example 1: Effects of different total sugar concentrations of sugarcane molasses on the growth of Saccharomyces cerevisiae GJ08 In order to understand the effect of sugarcane molasses with different total sugar concentrations on the growth of brewer's yeast, the starting strain GJ08 was first inoculated into sugarcane molasses with different total sugar concentrations and cultured for 24 h before the number of yeast cells was determined. The specific operating steps are as follows: (1) Pick a single colony of Saccharomyces cerevisiae GJ08 from the slant medium and inoculate it into the primary seed medium; (2) Incubate the culture in a shaking incubator at 30°C and 200 rpm for 12 h, then centrifuge at 12,000 rpm for 3 min to remove the supernatant; (3) Add sterile water to resuspend the cells and prepare 10-fold concentrated seed solution; (4) inoculated at 10% (v / v) into sugarcane molasses with total sugar concentrations of 50, 100, 150, 200, 250, and 300 g / L; (5) After culturing in a shaking incubator at 30°C and 150 rpm for 24 h, take 1 mL of the fermentation broth and dilute it to an appropriate multiple for cell counting under a microscope.

[0030] The above results are Figure 1As shown in the figure, when the sugar concentration is 50-150 g / L, the number of yeast cells increases with the increase of sugar concentration, indicating that within this sugar concentration range, the living environment of sugarcane molasses is more suitable for the growth and reproduction of yeast; when the sugar concentration exceeds 150 g / L, the number of yeast cells decreases significantly, and the more the sugar concentration increases, the more the yeast cell number decreases, which indicates that high-concentration sugarcane molasses is no longer suitable for the growth and reproduction of yeast. The reason may be that with the increase of sugar concentration, the concentration of harmful substances in sugarcane molasses also increases, which has a toxic effect on the growth and reproduction of yeast and inhibits its growth and reproduction.

[0031] Example 2: Application of high-concentration ethanol fermentation of Saccharomyces cerevisiae NGTM-F1, the fermentation conditions used are shake flask fermentation of 250 g / L total sugar cane molasses and 5 L tank fermentation, the specific operation steps are as follows: (1) Under sterile conditions, pick a single colony of Saccharomyces cerevisiae NGTM from the slant medium and inoculate it into the primary seed medium. Cultivate it at 30°C and 200 rpm for 12 h. (2) Under sterile conditions, centrifuge the culture medium in step (1) and add sterile water to prepare a 10-fold concentrated primary seed solution, inoculate the secondary seed culture medium at a 10% (v / v) inoculation rate, and culture at 30°C and 200 r / min for 8-10 h; (3) Under sterile conditions, the culture medium of step (2) was centrifuged and sterile water was added to prepare a 10-fold concentrated primary seed solution, which was inoculated into a sugarcane molasses culture medium at a 10% (v / v) inoculation rate, and shake flask fermentation was performed at 30°C and 150 r / min.

[0032] (4) Under sterile conditions, the culture medium of step (2) was centrifuged and sterile water was added to prepare a 10-fold concentrated primary seed solution, which was inoculated into a sugarcane molasses culture medium at an inoculum amount of 17.5% (v / v), and fermented in a 5 L fermenter at 30°C and 150 r / min.

[0033] The above shake flask fermentation results are as follows Figure 7~Figure 9As shown in the figure, the mutant strain NGTM-F1 is stronger than the starting strain GJ08 in terms of ethanol synthesis, total sugar consumption, and cell growth in a high-concentration sugarcane molasses environment. Analysis of the entire fermentation process shows that as the gap between the biomass of the mutant strain NGTM-F1 and the starting strain GJ08 gradually widens, the difference in ethanol production and total sugar consumption between the two also gradually increases. This phenomenon shows that cells are the basis of material metabolism. The more cells there are, the more vigorous the material metabolism is. After 96 h of fermentation in high-concentration sugarcane molasses, the fermentation efficiency of the mutant strain NGTM-F1 reached 80.08%, while the fermentation efficiency of the starting strain GJ08 was only 71.19%, and the fermentation efficiency increased by 8.89 percentage points. The above analysis shows that the mutant strain NGTM-F1 has good robustness to the high-concentration sugarcane molasses environment. Through ARTP mutagenesis and adaptive evolution, the mutant strain NGTM-F1 has significantly improved its tolerance to the molasses environment, and can efficiently convert sugar into ethanol during the fermentation process.

[0034] The above 5L tank fermentation results are as follows Fig.10 As shown in the figure, the mutant strain NGTM-F1 produced the highest ethanol at 60 h, with an ethanol concentration of 111.65 g / L and a fermentation efficiency of 87%. Figure 7 Compared with the shake flask fermentation shown in the figure, the ethanol synthesis in the 5 L tank fermentation increased by 9.35 g / L, and the ethanol production time was advanced by 12 h; the ethanol production intensity increased from 1.42 g / L / h in the shake flask fermentation to 1.86 g / L / h in the 5 L tank, and the ethanol production intensity increased by 30.99%. In summary, the mutant strain NGTM-F1 has excellent cell performance and can efficiently utilize sugarcane molasses for ethanol fermentation.

Claims

1. A brewer's yeast that tolerates high-concentration sugarcane molasses and achieves high-concentration ethanol fermentation was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 25, 2023, and was named Saccharomyces cerevisiae (S.cerevisiae) NGTM-F1, with the deposit number: GDMCC 63687.

2. The method for breeding high-concentration sugarcane molasses-tolerant yeast according to claim 1, characterized in that: The laboratory Saccharomyces cerevisiae GJ08 was used as the starting strain. After ARTP mutagenesis, it was subjected to adaptive evolution in a high-concentration sugarcane molasses environment and then subjected to high-throughput screening.

3. The method for breeding high-concentration sugarcane molasses-tolerant yeast according to claim 2, characterized in that: The method for breeding yeast tolerant to high concentration of sugarcane molasses comprises the following steps: (1) A single colony of Saccharomyces cerevisiae GJ08 was selected from the slant medium and inoculated into the primary seed medium, and cultured at 30°C and 200 r / min for 12 h. (2) Take 5 mL of the bacterial solution from step (1), collect yeast cells by centrifugation at 12000 rpm for 3 min, and wash twice with ice water. (3) The yeast cells in step (2) were subjected to plasma mutagenesis at room temperature and pressure in the ARTP mutagenesis system. The parameters were set as follows: 1) The RF power input was set to 100 W, and the helium flow rate was set to 10 SLM; 2) The distance between the plasma torch nozzle outlet and the slide was set to 2 mm. 3) Different mutagenesis times were selected: 80 s, 100 s, 120 s, 140 s, 160 s, 180 s, and 200 s. After mutagenesis, the slide was rinsed with ice water to generate the ARTP mutant library. (4) The mutant library in step (3) was transferred to 250 g / L sugarcane molasses and cultured at 30°C and 150 r / min for 24 h. The cells were subcultured every 24 h by inoculating 10% of the inoculum into fresh culture medium, and the cell number was observed under a microscope. (5) After the cell number in step (4) is stabilized, mutagenesis and subculture are performed again according to the methods of steps (2), (3) and (4), and the total sugar concentration is gradually increased to higher (270 g / L, 300 g / L) sugarcane molasses to obtain the final mutagenesis bacterial library.

4. The method for breeding high-concentration sugarcane molasses-tolerant yeast according to claim 2, characterized in that: High-throughput screening includes the following steps: (6) Dilute the final mutagenic bacteria library in step (5) with sterile water to an appropriate multiple, spread evenly on the TTC bottom culture medium, and culture in a constant temperature incubator at 30°C for 36 hours. (7) Slowly pour the TTC upper layer culture medium into the plate described in step (6) to cover the single colony. Incubate in a 30°C constant temperature incubator for 5-10 minutes, and pay attention to the color development of the plate during this period. (8) Select 500 mutant strains with faster color development and darker color development described in step (7) to form a primary screening bacterial library. (9) The yeast cells in the primary screening bacterial library described in step (8) were sequentially selected and placed in a 48-deep well culture plate, 1 mL of a total sugar 300 g / L simulated molasses medium was added to the culture plate, and cultured at 30° C. and 200 r / min for 72 h. (10) The deep-well culture plate in step (9) was left to stand for 30 min to allow the Saccharomyces cerevisiae strain to automatically sink, and the supernatant was used to determine the pyruvic acid content. First, 120 μL of the fermentation supernatant (five-fold dilution) was transferred to a 96-well ELISA plate, and then 80 μL of 0.1 mol / L ferric nitrate was added. The reaction was allowed to react at room temperature for 10 min, and the absorbance of the reaction system was determined at OD520 nm. Eight Saccharomyces cerevisiae mutant strains with smaller absorbance values ​​were selected to form a double screening bacterial library. (11) Pick out 8 yeast strains from the rescreened bacterial library in step (10) and inoculate them into 100 mL of primary seed culture medium, and culture them at 30° C. and 200 r / min for 12-14 h. Centrifuge and add sterile water to obtain a 10-fold concentrated primary seed solution, inoculate it into a secondary seed culture medium at a 10% (v / v) inoculation amount, and culture it at 30° C. and 200 r / min for 8-10 h to obtain a secondary seed solution. (12) The secondary seed solution described in step (11) was centrifuged and added with sterile water to obtain a 10-fold concentrated seed solution, which was inoculated into a 250 g / L total sugar cane molasses medium at a 10% (v / v) inoculation amount, and fermented at 30° C. and 150 r / min. Finally, a cerevisiae strain with the highest ethanol concentration and the highest fermentation efficiency was obtained, which was named cerevisiae NGTM-F1.

5. The method for breeding high-concentration sugarcane molasses-tolerant yeast according to claim 3 or 4, characterized in that: The culture medium formula used is as follows: (1) Slant culture medium (g / L): yeast powder 10, peptone 20, glucose 20, agar powder 20, natural pH; (2) Primary seed culture medium (g / L): yeast powder 10, peptone 20, glucose 20, natural pH; (3) Secondary seed culture medium (g / L): yeast powder 10, peptone 20, glucose 50, natural pH; (4) Sugarcane molasses medium (g / L): total sugar concentration 250, 270, 300, urea 2.2, pH 4.5-5.0 (total sugar in molasses was determined by high performance liquid chromatography); (5) Simulated molasses medium (g / L): sucrose 285.7, yeast powder 10, peptone 20, calcium ion 8, potassium ion 15, magnesium ion 2.5, sodium ion 0.5, phosphorus ion 0.25, sulfur ion 0.8, manganese ion 0.035, if solid, add agar 20, pH 4.5-5.0; (6) TTC base medium (g / L): glucose 20, yeast extract powder 10, peptone 20, agar powder 20, natural pH; (7) TTC upper culture medium (g / L): 5% glucose, 20% agar powder, 0.5% 2,3,5-triphenyltetrazolium chloride (sterilized and cooled to about 55°C, then added and mixed).

6. The method for breeding high-concentration sugarcane molasses-tolerant yeast according to claim 3 or 4, characterized in that: Sugarcane molasses pretreatment includes the following steps: (1) Measure 1000 mL of sugarcane molasses and add 1000 mL of distilled water to dilute; (2) Heat and boil for 30 minutes (molasses tends to produce a lot of foam when heated, so control the heating temperature and stir continuously to prevent violent boiling); (3) After cooling to room temperature, add concentrated sulfuric acid to adjust the pH to 1.0-2.0 and let stand overnight; (4) Maintain the mixture in a water bath at 90 °C for 30 min, during which time activated carbon powder (1% by total weight) is continuously added and stirred; (5) After cooling to room temperature, centrifuge (4000 r / min, 10 min) to collect the supernatant. Adjust the pH of the supernatant to 4.5-5.0 with calcium hydroxide and centrifuge again (4000 r / min, 10 min). Collect the supernatant for fermentation.

7. The high-concentration sugarcane molasses tolerant yeast according to claim 1 is used in high-concentration ethanol fermentation.

8. The use of the high-concentration sugarcane molasses tolerant yeast in high-concentration ethanol fermentation according to claim 7, characterized in that: The fermentation condition is shake flask fermentation in 250g / L total sugar cane molasses.

9. Use of the high-concentration sugarcane molasses tolerant yeast according to claim 7 or 8 in high-concentration ethanol fermentation, characterized in that: The following steps are involved: (1) Under sterile conditions, a single colony of Saccharomyces cerevisiae NGTM on the slant medium was inoculated into the primary seed medium and cultured at 30°C and 200 r / min for 12 h; (2) Under sterile conditions, centrifuge the culture medium in step (1) and add sterile water to prepare a 10-fold concentrated primary seed solution, inoculate the secondary seed culture medium at a 10% (v / v) inoculation amount, and culture at 30° C. and 200 r / min for 8-10 h; (3) Under sterile conditions, the culture medium of step (2) is centrifuged and sterile water is added to prepare a 10-fold concentrated primary seed solution, which is inoculated into a sugarcane molasses culture medium at a 10% (v / v) inoculation rate, and shake flask fermentation is performed at 30° C. and 150 r / min. (4) Under sterile conditions, the culture medium of step (2) was centrifuged and sterile water was added to prepare a 10-fold concentrated primary seed solution, which was inoculated into a sugarcane molasses culture medium at an inoculum amount of 17.5% (v / v), and fermented in a 5 L fermenter at 30° C. and 150 r / min.

Images