Double-stranded ribonucleic acid for inhibiting expression of SMAD2 transcription factor as well as modifier, conjugate and application of double-stranded ribonucleic acid

Abstract

The present disclosure relates to a double-stranded ribonucleic acid for inhibiting SMAD2 gene expression, and modifiers, conjugates, prodrugs and uses thereof. Specifically, the disclosure relates to a double-stranded ribonucleic acid for inhibiting SMAD2 gene expression, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and use thereof, and a method for inhibiting intracellular SMAD2 gene expression. The double-stranded ribonucleic acid as well as the modifier, the conjugate and the prodrug thereof provided by the invention can be combined in cells to form an RNA induced silence complex (RISC), cut mRNA transcribed by the SMAD2 gene, efficiently and specifically inhibit the expression of the SMAD2 gene, are used for treating SMAD2 gene mediated diseases, and have important application prospects in clinical disease treatment.

Description

Technical Field

[0001] The present disclosure belongs to the field of biomedicine. Specifically, the present disclosure relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and use capable of inhibiting SMAD2 gene expression, and a method for inhibiting SMAD2 gene expression in a cell. Background Art

[0003] In studies of Drosophila and Caenorhabditis elegans, it was found that Mad and Sma proteins act downstream of serine / threonine kinase receptors, so Mad and Sma proteins and their analogs are collectively referred to as Smad (Sma-Mad) family proteins. The vertebrate SMAD family includes at least 9 members, of which Smad2 has been shown to mediate signal transduction through activin and TGF-β2, 3, 4, 5. Transforming growth factor β (TGF-β) is a potent natural antiproliferative agent that plays an important role in inhibiting tumorigenesis. Mutations in TGF-β members are common in many tumors, which can lead to a variety of tumor diseases including colorectal cancer. The loss of TGF-β responsiveness is associated with inactivating mutations in components of the signaling pathway, such as the tumor suppressor Smad2. Experiments have shown that trans-heterozygous mice with Smad2 and nodule mutations have a series of phenotypes, including gastrulation defects, complex craniofacial malformations such as cyclopia, and left-right pattern defects, indicating that Smad2 may mediate nodule signals in these developmental processes. These findings suggest that Smad2 function is essential for early development and some patterning processes in mice. The results of various studies have implicated Smad2 in fibrosis of the liver, kidney, and lung, osteoarthritis, cancer, inflammatory diseases, parasitic diseases, and autoimmune leukoproliferative diseases.

[0004] In summary, by inhibiting the expression of SMAD2 gene in patients, non-alcoholic fatty liver disease, alcohol-related fatty liver disease, non-alcoholic fatty hepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases and autoimmune leukoproliferative diseases and colorectal cancer can be prevented and treated. Currently, there are no drugs targeting only the expression of such genes on the market, so the development of drugs targeting SMAD2 is of great value. Summary of the invention

[0005] Problem that the invention aims to solve

[0006] In view of the problems existing in the prior art, for example, more SMAD2 inhibitors need to be developed for the treatment of SMAD2-related diseases including fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases and autoimmune leukoproliferative diseases and colorectal cancer. The present disclosure aims to provide a series of double-stranded RNAs, double-stranded RNA modifiers, double-stranded RNA conjugates, prodrugs and pharmaceutical compositions for inhibiting SMAD2 gene expression, which can be effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of SMAD2 genes, thereby selectively and effectively inhibiting SMAD2 gene expression, achieving the purpose of disease treatment, and having important application prospects in clinical disease treatment.

[0007] Solutions for solving problems

[0008] [1] A double-stranded RNA, comprising a sense strand and an antisense strand, wherein the sense strand is reverse complementary to the antisense strand and / or substantially reverse complementary to form a double-stranded region of the double-stranded RNA;

[0009] The sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence;

[0010] The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 20.

[0011] [2] The double-stranded RNA according to [1], wherein the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731.

[0012] [3] The double-stranded RNA according to [1] or [2], wherein the sense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.

[0013] [4] The double-stranded RNA according to [3], wherein the nucleotide sequence of the sense strand is / comprises a sequence A that differs by no more than 1 nucleotide from 15 to 28 consecutive nucleotides in the nucleotide sequence of any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides;

[0014] Alternatively, the nucleotide sequence of the positive strand is / comprises a sequence A consisting of 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731, preferably 18-25 consecutive nucleotides, more preferably 18-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides.

[0015] [5] The double-stranded ribonucleic acid according to any one of [1] to [4], wherein the antisense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.

[0016] [6]. The double-stranded RNA according to [5], wherein the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide compared to the reverse complement and / or substantially reverse complement of a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, and more preferably 19, 21 or 23 nucleotides.

[0017] [7]. The double-stranded ribonucleic acid according to any one of [1] to [6], wherein the length of the double-stranded region is 15-25 nucleotides, preferably 18-23 nucleotides, more preferably 18-21 nucleotides, and more preferably 19, 21 or 23 nucleotides.

[0018] [8] The double-stranded RNA according to any one of [1] to [7], wherein

[0019] The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or,

[0020] The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or,

[0021] The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,

[0022] The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.

[0023] [9] The double-stranded RNA according to any one of [1] to [8], wherein the sense strand comprises any one selected from SEQ ID NOs: 44 to 149, 256 to 273, 475 to 485, 600 to 612 and 650 shown in Table 1 and Table 1-1, and the antisense strand comprises any one selected from SEQ ID NOs: 150 to 255, 289 to 306, 486 to 496, 613 to 625 shown in Table 1 and Table 1-1;

[0024] The sense strand and antisense strand are selected from the sense strand and antisense strand of any one siRNA shown in Table 1 or Table 1-1;

[0025] Preferably, the sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA1 to siRNA106, siRNA359 to siRNA382, and siRNA421 to siRNA422 shown in Table 1, or the combination of the sense strand and the antisense strand of siRNA107 to siRNA124 shown in Table 1-1;

[0026] Preferably, the sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA20, siRNA22 or siRNA370 shown in Table 1;

[0027] Alternatively, the sense strand of the double-stranded ribonucleic acid comprises a sequence selected from any one of SEQ ID NOs: 63, 65 and 600, and the antisense strand of the double-stranded ribonucleic acid comprises a sequence selected from any one of SEQ ID NOs: 169, 171 and 613.

[0028]

[10] . The double-stranded RNA according to any one of [1] to [8], wherein the sense strand comprises a sequence selected from any one of SEQ ID NOs: 65 and 650 shown in Table 1-2, and the antisense strand of the double-stranded RNA comprises a sequence selected from any one of SEQ ID NOs: 171 and 618.

[0029]

[11] . The double-stranded ribonucleic acid according to any one of [1] to

[10] , wherein each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0030]

[12] . The double-stranded RNA according to any one of [1] to

[11] , wherein any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond, and / or any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.

[0031]

[13] The double-stranded RNA according to any one of [1] to

[12] , wherein the ribose group of the 5' terminal nucleotide of the antisense strand has a group selected from the following: a 5'-hydroxyl group, a 5' phosphate group or a 5' phosphate derivative group.

[0032]

[14] The double-stranded RNA according to any one of [1] to

[13] , wherein the double-stranded RNA is siRNA for inhibiting SMAD2 gene expression.

[0033]

[15] A modified double-stranded RNA, which is a modified double-stranded RNA as described in any one of [1] to

[14] , wherein the modified double-stranded RNA comprises at least one of the following chemical modifications:

[0034] (1) modification of at least one nucleotide in the sense strand,

[0035] (2) modification of the phosphodiester bond at at least one position in the sense strand,

[0036] (3) modification of at least one nucleotide in the antisense strand,

[0037] (4) modification of the phosphodiester bond at at least one position in the antisense strand;

[0038] Optionally, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A and sequence D, wherein the 3' end of sequence A in the sense strand is connected to sequence D consisting of 1-2 nucleotides, preferably sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded RNA modification comprises sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E consisting of 1-2 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A', which is formed by excluding 1-2 nucleotides from the 3' end of sequence A in the sense strand;

[0039] Optionally, the nucleotide sequences of the sense strand and the antisense strand of the double-stranded RNA modification are selected from the following sequence combinations:

[0040] The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0041] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E;

[0042] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0043] Alternatively, the nucleotide sequence of the sense strand is the sequence shown by sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown by sequence B connected to sequence E;

[0044] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0045] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0046]

[16] . The double-stranded RNA modified substance according to

[15] , wherein the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.

[0047]

[17] . The double-stranded RNA modified substance according to

[15] or

[16] , wherein the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.

[0048]

[18] . The double-stranded RNA modification according to

[16] or

[17] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from one or more of isonucleotides, LNA, ENA, cET, UNA or GNA.

[0049]

[19] . The double-stranded RNA modified substance according to any one of

[15] to

[18] , wherein, in the direction from the 5' end to the 3' end, 3 to 5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in the sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0050] Preferably, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0051] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8 and 9 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0052] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0053] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 8, 9 and 10 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0054] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 8, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0055] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0056] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0057] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0058] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0059] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0060] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0061] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0062] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 11, 12 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0063] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0064] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0065] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11, 16 and 17 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0066] Alternatively, along the 5' end to the 3' end, the 9th, 11th, 12th and 13th ribonucleotides in sequence A of the sense strand are 2'-F modified ribonucleotides, and the remaining ribonucleotides in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0067] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0068] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0069] Preferably,

[0070] When the length of sequence A is 21, along the direction from the 5' end to the 3' end, the 9th, 11th, 12th and 13th ribonucleotides in the sequence A of the sense chain are 2'-F modified ribonucleotides, and the remaining ribonucleotides in the sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides, or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the 7th, 9th, 10th and 11th ribonucleotides in the sequence A of the sense chain are 2'-F modified ribonucleotides, and the remaining ribonucleotides in the sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides;

[0071] Alternatively, when the length of sequence A is 21, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides, or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides;

[0072] Alternatively, when the sequence length is 21, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides, or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0073]

[20] The double-stranded RNA modified substance according to any one of

[15] to

[19] , wherein the sense strand comprises a phosphorothioate diester bond located at the following position along the 5' end to the 3' end:

[0074] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0075] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0076] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; and / or

[0077] Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0078] or,

[0079] The sense strand contains phosphorothioate diester bonds located at the positions shown below:

[0080] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; and / or

[0081] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand,

[0082] Optionally, in the direction from the 5' end to the 3' end, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group.

[0083]

[21] The double-stranded RNA modified substance according to any one of

[15] to

[20] , wherein, from the 5' end to the 3' end, the ribonucleotides at any odd positions in the sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides, and the ribonucleotides at any even positions in the sequence B of the antisense strand are 2'-F modified ribonucleotides;

[0084] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0085] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0086] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0087] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0088] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0089] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0090] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0091] Alternatively, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides;

[0092] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense chain are 2'-O-CH3 modified ribonucleotides.

[0093]

[22] The double-stranded RNA modification according to any one of

[15] to

[21] , wherein the ribose group of the 5' terminal nucleotide of the antisense strand has any one selected from the following: a 5' hydroxyl group, a 5' phosphate group or a 5' phosphate derivative group, in the direction from the 5' end to the 3' end.

[0094]

[23] The double-stranded RNA modification product according to any one of

[15] to

[22] , wherein the antisense strand comprises a phosphorothioate diester bond located at the following position:

[0095] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0096] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0097] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; and / or

[0098] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0099]

[24] The double-stranded RNA modified substance according to any one of

[15] to

[23] , wherein the sense strand of the double-stranded RNA modified substance has the following characteristics: 38 ) any structure shown in:

[0100] (a1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3';

[0101] (a2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3';

[0102] (a3)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0103] <h2 style=";text-align:left;direction:ltr"> (a4)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0104] <h2 style=";text-align:left;direction:ltr"> (a5)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0105] <h2 style=";text-align:left;direction:ltr"> (a6)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0106] <h2 style=";text-align:left;direction:ltr"> (a7)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0107] <h2 style=";text-align:left;direction:ltr"> (a8)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0108] <h2 style=";text-align:left;direction:ltr"> (a9)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0109] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0110] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 11<h2 style=";text-align:left;direction:ltr">)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0111] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0112] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0113] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0114] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0115] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0116] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0117] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13<h2 style=";text-align:left;direction:ltr">f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0118] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0119] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0120] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0121] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 22)5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’;

[0122] (a 23 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’;

[0123] (a 24 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’;

[0124] (a 25 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0125] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0126] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0127] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0128] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 29 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15-mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’;

[0129] (a 30 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -3’;

[0130] (a 31 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’;

[0131] (a 32 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -3’;

[0132] (a 33 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0133] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 34 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0134] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 35 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0135] <h2 style=";text-align:left;direction:ltr"> (a<h2 style=";text-align:left;direction:ltr"> 36 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3';

[0136] (a 37 )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0137] (a 38 )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0138] Among them, N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G,

[0139] The letter combination dT represents a deoxyribonucleotide whose base is thymine.

[0140] The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide.

[0141] The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide.

[0142] -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond.

[0143] Optionally, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group.

[0144]

[25] . The double-stranded RNA modified substance according to any one of

[15] to

[24] , wherein the antisense strand of the double-stranded RNA modified substance has the following characteristics: 37 ) any structure shown in:

[0145] (b1)5'-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-dT-(s)-dT-3',

[0146] (b2)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0147] (b3)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0148] (b4)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0149] (b5)5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0150] (b6)5’-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’,

[0151] (b7)5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0152] <h2 style=";text-align:left;direction:ltr">(b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0153] <h2 style=";text-align:left;direction:ltr"> (b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0154] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0155] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-N<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> f-(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0156] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0157] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0158] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0159] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0160] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0161] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19<h2 style=";text-align:left;direction:ltr">-(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0162] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0163] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0164] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0165] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13<h2 style=";text-align:left;direction:ltr">-N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0166] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0167] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0168] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 24 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0169] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 25 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0170] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0171] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0172] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0173] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 29 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0174] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 30 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0175] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 31 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0176] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 32 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0177] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 33 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0178] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 34 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0179] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 35 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0180] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 36 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0181] <h2 style=";text-align:left;direction:ltr"> (b<h2 style=";text-align:left;direction:ltr"> 37 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22-(s)-mN 23 -3'; where N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G,

[0182] The letter combination dT represents a deoxyribonucleotide whose base is thymine.

[0183] The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide.

[0184] The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide.

[0185] P1 means that the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide.

[0186] EVP means that the nucleotide adjacent to the right of the letter combination is a 5'-trans vinylphosphonate nucleotide.

[0187] -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond.

[0188] [GNA] indicates that the adjacent ribonucleotide on the right is a ribonucleotide with GNA modification.

[0189] Optionally, the 5' terminal nucleotide of the antisense strand does not have P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

[0190]

[26] The double-stranded RNA modified substance according to any one of

[15] to

[25] , wherein the double-stranded RNA modified substance is a siRNA modified substance.

[0191]

[27] . The double-stranded RNA modified substance according to any one of

[15] to

[26] , wherein the double-stranded RNA modified substance is a siRNA modified substance for inhibiting SMAD2 gene expression.

[0192]

[28] The double-stranded RNA modified substance according to any one of

[15] to

[27] , wherein the sense strand comprises any one selected from SEQ ID NOs: 322 to 364, 427 to 440, 497 to 512, 626 and 651 to 684 shown in Table 2, and the sense strand comprises any one selected from SEQ ID NOs: 365 to 426, 441 to 474, 513 to 575, 627 to 646, 649 and 685 to 694 shown in Table 2;

[0193] Alternatively, the double-stranded RNA modification is a modification of a double-stranded RNA comprising the following: the sense strand of the double-stranded RNA comprises a sequence selected from any one of SEQ ID NO: 63, 65 and 600, and the antisense strand of the double-stranded RNA comprises a sequence selected from SEQ ID NO:

[0194] The sequence of any one of ID NOs: 169, 171 and 613;

[0195] Preferably, the sense strand and antisense strand are selected from the sense strand and antisense strand of any one siRNA shown in Table 2;

[0196] More preferably, the sense strand comprises the sense strand of any one of the siRNA modifications shown in Table 2, and the antisense strand comprises the antisense strand of the corresponding siRNA modification;

[0197] Further preferably, the sense strand of the double-stranded RNA modification comprises the sequence shown in SEQ ID NO:331, 332, 429, 626 or 651-684, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: the sequence shown in SEQ ID NO:378-381, 447-448, 524-526, 627-642 or 685-694.

[0198]

[29] . A double-stranded RNA modification, wherein the 3' end of the sense strand of the double-stranded RNA modification described in any one of

[15] -

[28] is modified to be a blunt end, and optionally, the protruding nucleotides extending out of the double-stranded region from the 3' end of the sense strand of the double-stranded RNA modification described in any one of

[15] -

[28] are excluded.

[0199]

[30] A conjugate, wherein the conjugate comprises the double-stranded RNA as described in any one of [1]-

[14] , or the double-stranded RNA modification as described in any one of

[15] -

[29] ; and a conjugated group conjugated to the double-stranded RNA or the double-stranded RNA modification.

[0200]

[31] . The conjugate according to

[30] , wherein the conjugated group has the structure shown below:

[0201]

[0202]

[0203]

[0204]

[32] The conjugate according to

[30] or

[31] , wherein the conjugated group is linked to the 3' end of the sense strand.

[0205]

[33] The conjugate according to

[32] , wherein the conjugated group is conjugated to the 3' end of the sense strand via a phosphodiester bond;

[0206] Preferably, the sense strand and the antisense strand of the conjugate are complementary to each other to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region;

[0207] or,

[0208] The sense strand and the antisense strand of the conjugate are at least partially complementary to each other to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, while the 3' end of the antisense strand forms a blunt end.

[0209]

[34] The conjugate according to any one of

[30] to

[33] , wherein the conjugate has the structure shown below:

[0210]

[0211] The double helix structure is double-stranded RNA or a modified double-stranded RNA.

[0212]

[35] The conjugate according to any one of

[30] to

[34] , wherein the conjugate is a siRNA conjugate.

[0213]

[36] The conjugate according to any one of

[30] to

[35] , wherein the conjugate is a siRNA conjugate for inhibiting SMAD2 gene expression.

[0214]

[37] The conjugate according to any one of

[30] to

[36] , wherein the conjugate is formed by connecting any one of the siRNAs listed in Table 1 to a conjugation group, or the conjugate is formed by connecting any one of the siRNAs listed in Table 1-1 to a conjugation group, or the conjugate is formed by connecting any one of the siRNA modifications listed in Table 2 to a conjugation group;

[0215] Preferably, in the conjugate, the sense strand and the antisense strand connected to the conjugation group are selected from the combination of the sense strand and the antisense strand of the siRNA conjugate shown in Table 3;

[0216] More preferably, the conjugate is a conjugate of a double-stranded ribonucleic acid or a modification thereof comprising SEQ ID NO: 63, 65, 600, 331, 332, 429, 626 or 651-684 as a sense strand and SEQ ID NO: 169, 171, 613, 378-381, 447-448, 524-526, 627-642, 649 or 685-694 as an antisense strand;

[0217] Further preferably, the conjugate comprises a sense strand connected to a conjugated group as shown in SEQ ID NOs: 576-599, 647-648, 695-727, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate;

[0218] Still more preferably, the conjugate comprises a sense strand connected to a conjugation group as shown in SEQ ID NO: 578, 591, 695-727, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.

[0219]

[38] . A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of the following: a double-stranded RNA as described in any one of [1]-

[14] , a modified double-stranded RNA as described in any one of

[15] -

[29] , or a conjugate as described in any one of

[30] -

[37] .

[0220]

[39] . The pharmaceutical composition according to

[38] , wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.

[0221]

[40] Use of the double-stranded RNA according to any one of [1] to

[14] , the modified double-stranded RNA according to any one of

[15] to

[29] , the conjugate according to any one of

[30] to

[37] , or the pharmaceutical composition according to any one of

[38] to

[39] in at least one of the following:

[0222] (1) Inhibiting SMAD2 gene expression, or preparing a drug for inhibiting SMAD2 gene expression;

[0223] (2) for preventing or treating diseases associated with abnormal expression of the SMAD2 gene, or for preparing drugs for preventing or treating diseases associated with abnormal expression of the SMAD2 gene;

[0224] (3) Use for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression.

[0225]

[41] . The use according to

[39] , wherein the disease associated with abnormal expression of the SMAD2 gene is selected from the group consisting of the following diseases:

[0226] Fatty liver disease, nonalcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases, autoimmune leukoproliferative diseases, colorectal cancer, and other related conditions, pathologies or syndromes not yet identified.

[0227]

[42] . A method for inhibiting SMAD2 gene expression in a cell, the method comprising contacting the cell with a double-stranded RNA as described in any one of [1]-

[14] , a double-stranded RNA modification as described in any one of

[15] -

[29] , a conjugate as described in any one of

[30] -

[37] , or a pharmaceutical composition as described in any one of

[38] -

[39] .

[0228]

[43] The method according to

[42] , wherein the cells are in a subject.

[0229]

[44] The method according to

[43] , wherein the subject is a mammal, preferably a human.

[0230]

[45] The method according to

[43] or

[44] , wherein the subject has at least one of the following characteristics:

[0231] Abnormal expression of SMAD2 gene in vivo, more specifically abnormally high expression of SMAD2 gene;

[0232] Suffering from diseases related to abnormal expression of SMAD2 gene;

[0233] Having a disease that would benefit from decreased expression of the SMAD2 gene.

[0234]

[46] . A method for preventing or treating a disease associated with abnormal expression of the SMAD2 gene, the method comprising administering to a subject a therapeutically effective amount of a double-stranded RNA as described in any one of [1]-

[14] , a double-stranded RNA modification as described in any one of

[15] -

[29] , a conjugate as described in any one of

[30] -

[37] , or a pharmaceutical composition as described in any one of

[38] -

[39] .

[0235] Effects of the Invention

[0236] In some embodiments, the double-stranded ribonucleic acid provided by the present disclosure can combine to form an RNA-induced silencing complex (RISC) in cells, cut the mRNA transcribed by the SMAD2 gene, and efficiently and specifically inhibit the expression of the SMAD2 gene, and is used to treat SMAD2-related diseases including fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases and autoimmune leukoproliferative diseases, and colorectal cancer.

[0237] Furthermore, the double-stranded RNA in the present disclosure is siRNA, which targets and degrades the transcription product mRNA of the SMAD2 gene, exerts the effect of RNA interference, and inhibits the protein expression of the SMAD2 gene. It is a SMAD2 inhibitor with a high inhibition rate and good specificity.

[0238] In some embodiments, the present disclosure modifies double-stranded RNA to obtain modified double-stranded RNA, which has high stability and is suitable for use in in vivo disease treatment.

[0239] Furthermore, the double-stranded RNA modification disclosed in the present invention is a siRNA modification, which has high stability and good inhibitory activity.

[0240] In some embodiments, the present invention discloses a conjugate of double-stranded RNA or double-stranded RNA modified substance obtained by connecting a conjugation group to double-stranded RNA or double-stranded RNA modified substance, which can be used for efficient targeted delivery to tissues and cells, reducing the impact of double-stranded RNA or double-stranded RNA modified substance on non-targeted normal tissues and cells, and improving its safety in clinical disease treatment.

[0241] Furthermore, the conjugate is a siRNA conjugate, which has organ or tissue targeting while maintaining the inhibitory activity and stability of siRNA, can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs.

[0242] Furthermore, the conjugated group in the present disclosure is a group (GalNAc) with a structure shown in Formula I. GalNAc can be used for targeted delivery into liver cells and tissues to efficiently inhibit the expression of the SMAD2 gene in the liver.

[0243] In particular, in the present invention, siRNA, its modifications and conjugates comprising a sense strand selected from SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 600 and SEQ ID NO: 650 and an antisense strand selected from SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 613 and SEQ ID NO: 618 can not only provide excellent inhibitory effects on SMAD2 gene expression, but also achieve an inhibition rate of more than 90% at low concentrations under free uptake. At the same time, these siRNA, its modifications and conjugates can provide long-term inhibitory effects after administration. DETAILED DESCRIPTION

[0244] definition

[0245] For convenience, several terms used herein, in the specification, examples and appended claims are collected here. Unless otherwise specified or implied by the context, the following terms and phrases include the meanings provided below. Unless otherwise explicitly stated or obvious from the context, the following terms and phrases do not exclude the meanings that the term or phrase already has in the field to which it belongs. The definitions are provided to assist in describing specific embodiments and are not intended to limit the claimed invention, as the scope of the invention is limited only by the claims. Moreover, unless the context provides otherwise, terms in the singular shall include the plural, and terms in the plural shall include the singular.

[0246] In the claims and / or description of the present disclosure, the word “a” or “an” or “the” may mean “one”, but may also mean “one or more”, “at least one” and “one or more than one”.

[0247] As used in the claims and description, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0248] Throughout the application document, the term "about" means that a value includes the standard deviation of the error of the device or method used to determine the value. The numerical ranges and parameters used to define the present disclosure are all approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to the aforementioned test methods or devices. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in the present disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0249] The term "SMAD2" used in the context of the present disclosure refers to well-known genes and polypeptides. SMAD2 gene, SMAD2 mRNA sequence is easily obtained using, for example, GenBank, UniProt, Online Mendelian Inheritance in Man (OMIM), etc.

[0250] The term "SMAD2 gene" may be a wild-type SMAD2 gene, or a SMAD2 gene mutant with sequence variation. Many sequence variations in the SMAD2 gene have been identified and can be found in, for example, NCBIdbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0251] The terms "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues linked to each other by covalent bonds (e.g., peptide bonds), which may be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. A polypeptide may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0252] The term "target sequence" as used in the context of the present disclosure refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is a product of RNA processing of a primary transcript.

[0253] In some embodiments, the target sequence is a nucleotide sequence consisting of not less than 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 consecutively connected nucleotides. In some optional embodiments, the target sequence is a nucleotide sequence consisting of not less than 19, 20, 21, 25, 30, 35, 40, 50, 60, 70 or 100 consecutively connected nucleotides; illustratively, the target sequence is a nucleotide sequence consisting of 19, 20, 21, 25, 26, 27, 28, 29, 30, 32, 33, 37, 39, 54, 61, 62, 69, 70 or 109 consecutively connected nucleotides. In some optional embodiments, another shorter target sequence may be included in the target sequence. In some embodiments, one or more shorter target sequences may be included in the target sequence. It should be considered that two or more shorter target sequences contained in the same target sequence have the same characteristics, for example, target sequence VI includes target sequences VI-1 to VI-5 and target sequences VI-A1 to VI-A2.

[0254] In some embodiments, the target gene is a SMAD2 gene. In some embodiments, the target portion of the gene sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to serve as a substrate for iRNA-guided cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the SMAD2 gene.

[0255] In the art, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine and uracil, respectively, but it is also generally known in the art that "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively, which is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences, so in the context of the present disclosure, the meanings represented by "G", "C", "A", "T", "U" include the above-mentioned various possible situations. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as further described below) or have an alternative replacement part. Those skilled in the art can appreciate that guanine, cytosine, adenine and uracil can be replaced by other parts without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement part). For example, without limitation, a nucleotide comprising inosine as its base can be base paired with a nucleotide comprising adenine, cytosine or uracil. Therefore, a nucleotide containing uracil, guanine or adenine can be replaced by a nucleotide containing, for example, inosine in the nucleotide sequence of the dsRNA characterized by the present disclosure. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced by guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA. Sequences containing this type of replacement portion are suitable for the compositions and methods characterized by the present disclosure.

[0256] In the present application, "5'-nucleotide" refers to a nucleotide in which a phosphate group is linked to the 5' carbon of a pentose, which is the main type of nucleotide that exists freely in an organism. "3'-nucleotide" refers to a nucleotide in which a phosphate group is linked to the 3' carbon of a pentose, for example, it may include adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-thiophosphate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-thiophosphate, 2'-O-methylguanosine-3'- ... guanosine-3'-phosphorothioate, 2'-fluoroguanosine-3'-phosphorothioate, 2'-O-methylcytidine-3'-phosphorothioate, 2'-fluorocytidine-3'-phosphorothioate, 2'-fluorocytidine-3'-phosphorothioate, 2'-O-methyluridine-3'-phosphorothioate, 2'-O-methyluridine-3'-phosphorothioate, 2'-fluorouridine-3'-phosphorothioate, 2'-fluorouridine-3'-phosphorothioate, 2'-deoxythymidine-3'-phosphorothioate. This definition can be applied to modified or unmodified nucleoside phosphoramidite monomers.

[0257] The terms "iRNA", "RNAi agent", "iRNA agent", "RNA interfering agent" used in the context of this disclosure are used interchangeably herein and refer to siRNAs as defined herein and mediate targeted cleavage of RNA transcripts through the RNA induced silencing complex (RISC) pathway. iRNAs direct sequence-specific degradation of mRNAs through a process known as RNA interference (RNAi). iRNAs modulate, e.g., inhibit, expression of a target gene in a cell, such as a cell of a subject, such as a mammalian subject.

[0258] The terms "double-stranded ribonucleic acid", "double-stranded RNA (dsRNA) molecule", and "dsRNA" used in the context of this disclosure can be used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to a target gene, such as the SMAD2 gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers degradation of a target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0259] Typically, most of the nucleotides of each strand of the dsRNA molecule are ribonucleotides, but as described in detail herein, each or both of the two strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides. In addition, as used in the present disclosure, "double-stranded RNA" may include ribonucleotides, phosphate backbones, etc., with chemical modifications. These modifications may include all types of modifications disclosed herein or known in the art.

[0260] The term "isonucleotide" used in the context of the present disclosure refers to a compound formed by a change in the position of the base on the ribose ring in a nucleotide, for example, a compound formed by the base not being attached to the 1'-position of the ribose ring but to the 2'-position or 3'-position of the ribose ring.

[0261] In some embodiments, the double-stranded ribonucleic acid of the present disclosure is siRNA, which interacts with the mRNA sequence transcribed by the target gene (e.g., the mRNA sequence transcribed by the SMAD2 gene) to guide the cutting of the target RNA. Without being bound by theory, the long double-stranded RNA introduced into the cell is decomposed into siRNA by the type III endonuclease called Dicer (Sharp et al., "Genes and Development" (Genes Dev.) 2001, 15: 485). Dicer (ribonuclease III-like enzyme) processes dsRNA into 19-23 base pairs of short interfering RNA with characteristic double base 3' overhangs (Bernstein et al., (2001) Nature (Nature) 409: 363). These siRNAs are subsequently incorporated into RNA-induced silencing complexes (RISC), in which one or more helicases unwind the siRNA duplex, which makes it possible for complementary antisense strands to guide target recognition (Nykanen et al., (2001) Cell (Cell) 107: 309). Once bound to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes Dev. 15:188).

[0262] The term "overhanging nucleotides" as used in the context of this disclosure refers to one or more unpaired nucleotides that protrude from the duplex structure of a double-stranded ribonucleic acid when a 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded ribonucleic acid, i.e., no nucleotide overhang. A "blunt-ended" double-stranded ribonucleic acid is a dsRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.

[0263] The term "antisense strand" refers to a nucleic acid strand in a double-stranded ribonucleic acid that is substantially complementary to a target sequence (e.g., derived from human SMAD2 mRNA). In the case where the complementary region is not completely complementary to the target sequence, mismatches are most tolerable in the terminal region, and if mismatches occur, they are typically within one or more regions of the terminal, such as 5' and / or 3' ends, 5, 4, 3, 2 or 1 nucleotides.

[0264] The term "sense strand" refers to the nucleic acid strand of a double-stranded RNA that contains a region that is substantially complementary to a region of the antisense strand.

[0265] The terms "complementary" or "reverse complement" are used interchangeably and have the meanings known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand are paired with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). Each base pair includes a purine and a pyrimidine. When adenine on one strand is always paired with thymine (or uracil) on the other strand, and guanine is always paired with cytosine, the two strands are considered to be complementary to each other, and the sequence of the strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0266] The term "substantially reverse complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved, that is, there are 1, 2 or 3 base mismatches between the two nucleotide sequences involved; "completely complementary" means that there are no base mismatches between the two nucleotide sequences.

[0267] The terms "complementary," "fully complementary," and "substantially complementary" may be used with respect to base pairing between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0268] In the above and below, especially when describing the preparation method of the double-stranded RNA, double-stranded RNA modification, or conjugate or pharmaceutical composition of the present disclosure, unless otherwise specified, nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer used in phosphoramidite solid phase synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

[0269] The term "inhibit" may be used interchangeably with "reduce," "silence," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0270] The term "inhibiting the expression of a SMAD2 gene" includes inhibiting the expression of any SMAD2 gene (such as, for example, a mouse SMAD2 gene, a rat SMAD2 gene, a monkey SMAD2 gene, or a human SMAD2 gene) and a variant (such as a naturally occurring variant) or mutant of a SMAD2 gene. Therefore, the SMAD2 gene can be a wild-type SMAD2 gene, a mutant SMAD2 gene, or a transgenic SMAD2 gene in the context of a genetically manipulated cell, a cell group, or an organism.

[0271] "Inhibiting SMAD2 gene expression" includes any level of inhibition of SMAD2 gene, such as at least partial inhibition of SMAD2 gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0272] The term "independently" means that at least two groups (or ring systems) with the same or similar value ranges in the structure may have the same or different meanings in specific circumstances. For example, substituent X and substituent Y are independently hydrogen, hydroxyl, alkyl or aryl. When substituent X is hydrogen, substituent Y can be either hydrogen, hydroxyl, alkyl or aryl; similarly, when substituent Y is hydrogen, substituent X can be either hydrogen, hydroxyl, alkyl or aryl.

[0273] The term "alkyl" includes straight chain, branched chain or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and the like. 1-6 The "C" in "alkyl" 1-6 ” refers to a group containing 1, 2, 3, 4, 5 or 6 carbon atoms in a straight chain, branched chain or cyclic form.

[0274] The term "alkoxy" herein refers to an alkyl group attached to the remainder of the molecule via an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy and substituted alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.

[0275] "Substituted" as used herein means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, as long as the valence of the particular atom is normal and the substituted compound is stable. When the substituent is oxo (ie, =O), it means that two hydrogen atoms are replaced.

[0276] The “substituents” described herein include all substituents mentioned herein, including but not limited to the terms “alkyl”, “alkoxy”, “heteroalkyl”, “alkenyl”, “alkynyl”, etc., and corresponding non-limiting or exemplary groups, wherein some non-limiting examples of the “substituents” include C 1-6 Alkyl, C 1-6 Alkoxy, C containing oxygen atom 1-6 Heteroalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, etc.

[0277] In this article, C m-n , means that the moiety has an integer number of carbon atoms in a given range. For example, "C 1-6 " means that the group may have 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms or 6 carbon atoms. For example, C 1-3 It means that the group may have 1 carbon atom, 2 carbon atoms, or 3 carbon atoms.

[0278] The term "treatment" means that after suffering from a disease, a subject is exposed to (e.g., administered) double-stranded RNA, a double-stranded RNA modified substance, a double-stranded RNA conjugate, or a pharmaceutical composition, thereby alleviating the symptoms of the disease compared to when the subject is not exposed to the disease, and does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means that the body has symptoms of the disease.

[0279] The term "prevention" means that before a subject develops a disease, by contacting (e.g., administering) the double-stranded RNA, double-stranded RNA modified material, double-stranded RNA conjugate, or pharmaceutical composition of the present disclosure, the symptoms after the subject develops the disease are alleviated compared to when the subject does not develop the disease. It does not mean that the disease must be completely suppressed.

[0280] The term "effective amount" refers to such an amount or dosage of the double-stranded RNA, double-stranded RNA modification, double-stranded RNA conjugate or pharmaceutical composition of the present disclosure, which produces the desired effect in a patient in need of treatment or prevention after being administered to the patient in a single or multiple doses. The effective amount can be easily determined by the attending physician who is a person skilled in the art by considering a variety of factors such as: the species of the mammal; its size, age and general health; the specific disease involved; the extent or severity of the disease; the response of the individual patient; the specific antibody administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapy. The term "therapeutically effective amount" refers to such an amount or dosage of the double-stranded RNA, double-stranded RNA modification, conjugate or pharmaceutical composition of the present invention, which produces the desired therapeutic effect in a patient in need of treatment or prevention after being administered to the patient in a single or multiple doses.

[0281] The term "disease associated with abnormal expression of the SMAD2 gene" refers to a disease or disorder associated with abnormal regulation of the TGF-β / SMAD signaling pathway. The term "disease associated with abnormal expression of the SMAD2 gene" includes diseases, disorders or conditions that will benefit from reducing SMAD2 expression (i.e., "SMAD2-related diseases"). Such diseases are typically associated with metabolic disorders, cell damage, and organ fibrosis. Non-limiting examples of diseases associated with abnormal expression of the SMAD2 gene include: fatty liver disease, non-alcoholic steatohepatitis, liver cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases, autoimmune leukoproliferative diseases, colorectal cancer, etc. (Hata, A., Lo, R., Wotton, D. et al., Mutations increasing autoinhibition inactivate tumoursuppressors Smad2 and Smad4. Nature 388, 82-87 (1997); Nomura, M., Li, E. Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature 393, 786-790 (1998); Fleming NI, Jorissen RN et al., SMAD2, SMAD3 and SMAD4 mutations in colorectal cancer. Cancer Res.2013Jan15;73(2):725-35; ChenQ, Yi J et al., TGF-β1contributes to the hepatic inflammation in animal models with nonalcoholic steatohepatitis by Smad3 / TLR2 signaling pathway. MolImmunol.2022Dec;152:129-139; Devereux TR, Anna CH et al., Smad4(homolog of humanDPC4)and Smad2(homolog of human JV18-1):candidates for murine lung tumorresistance and suppressor genes.Carcinogenesis.September 1997; 18(9): 1751-5; Pan Y, Wang J, etc., MicroRNA-34a Promotes EMT and Liver Fibrosis in Primary Biliary Cholangitis by Regulating TGF-β1 / smad Pathway. J Immunol Res. April 23, 2021; 2021: 6890423; Pang N, Zhang F, etc., TGF-β / Smad signaling pathway regulates Th17 / Treg balance during Echinococcus multilocularis infection. Int Immunopharmacol. May 2014; 20(1): 248-57; Yang Q, Ren GL, etc., Conditional knockout of TGF-βRII / Smad2 signals protects against acute renal injury by alleviating cell necroptosis, apoptosis and inflammation. Theranostics. October 21, 2019; 9(26): 8277-8293; Vishnubalaji R, Alajez NM. Epigenetic regulation of triple negative breast cancer (TNBC) by TGF-β signaling. Sci Rep. July 29, 2021; 11(1): 15410; WO2022087435A1; WO2022165000A1; WO202226091A1; CN115368386A; WO2022226091A1).

[0282] The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to auxiliary materials widely used in the field of drug production. The main purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature and / or has specific functionality, and also to provide a method so that after the drug is administered to the subject, the active ingredient can be dissolved at a desired rate, or to promote the effective absorption of the active ingredient in the subject receiving the administration. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a certain function to the pharmaceutical composition (for example, stabilizing the overall pH value of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesive agents, glidants, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.

[0283] The term "pharmaceutical composition" refers to a mixture of one or more double-stranded RNAs, double-stranded RNA modifications, or conjugates thereof disclosed herein and a pharmaceutically acceptable excipient / carrier. The purpose of the pharmaceutical composition is to facilitate administration of the double-stranded RNAs, double-stranded RNA modifications, or conjugates thereof disclosed herein to an organism.

[0284] The pharmaceutical compositions of the present disclosure can be prepared using any method known to those skilled in the art, such as conventional mixing, dissolving, granulating, emulsifying, pulverizing, encapsulating, embedding and / or lyophilizing processes.

[0285] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to meet the requirements of the properties of the drug, the convenience of the patient and the medical staff, and other relevant factors.

[0286] The terms "individual", "patient" or "subject" used in the context of this disclosure include mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0287] All patents, patent applications and other identified publications are expressly incorporated herein by reference for the purposes of description and disclosure. Any citation of these publications herein does not constitute an admission that the publication becomes part of the common general knowledge in the art.

[0288] The term "corresponding siRNA" used in the context of the present disclosure refers to the same siRNA mentioned above. For example, when referring to "the sense chain comprises the sense chain of any one siRNA shown in Table 1, Table 1-1, and Table 1-2 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA", it means that the sense chain and antisense chain contained are the sense chain and antisense chain shown under the numbering of the same siRNA shown in Table 1, Table 1-1, and Table 1-2 herein. For example, when referring to the sense chain and the corresponding antisense chain of numbered siRNA1, when the sense chain comprises 5'-GGUGUGAGAAAGCAGUGAA-3' (SEQ ID NO: 44), the antisense chain comprises 5'-UUCACUGCUUUCUCACACC-3' (SEQ ID NO: 150). Similarly, the term "corresponding siRNA modification" refers to the siRNA modification under the same siRNA number mentioned above, for example, when referring to "the sense chain comprises the sense chain of any siRNA modification shown in Table 2 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA modification", it means that the sense chain and antisense chain contained are from the siRNA modification under the same siRNA number shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the siRNA conjugate under the same siRNA number mentioned above, for example, when referring to "the sense chain comprises the sense chain of any siRNA conjugate shown in Table 3 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA conjugate", it means that the sense chain and antisense chain contained are from the siRNA conjugate under the same siRNA number shown in Table 3 herein.

[0289] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.

[0290] dsRNA

[0291] The first aspect of the present disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of SMAD2 gene. One strand of the double-stranded ribonucleic acid is an antisense strand, and the antisense strand is complementary to the mRNA sequence formed during the expression of the target gene (that is, the SMAD2 gene) and is used to guide the cutting of the targeted target mRNA (that is, the transcription product of the SMAD2 gene). Another sense strand in the double-stranded ribonucleic acid includes a sequence that is at least partially complementary (e.g., partially complementary or completely complementary) to the antisense strand, including a sequence that is substantially / completely complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid.

[0292] In some embodiments, the double-stranded RNA is cut into small fragments of dsRNA, i.e., siRNA, as a substrate for the nuclease (Dicer). In some embodiments, the double-stranded RNA is siRNA. siRNA assembles to form an RNA-induced silencing complex (RISC) RISC complex, cuts the target mRNA, and inhibits the expression of the SMAD2 gene.

[0293] According to the target sequence derived from human SMAD2 mRNA (NM_005901.6), siRNA that binds to the target mRNA is designed. In some embodiments, the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 20. In some embodiments, the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 20.

[0294] In some embodiments, the nucleotide sequence shown in SEQ ID NO:6 includes the nucleotide sequence shown in any one of SEQ ID NOs:21 to 24 or 728 to 731. In some embodiments, the nucleotide sequence shown in SEQ ID NO:7 includes the nucleotide sequence shown in SEQ ID NO:25 and SEQ ID NO:26. In some embodiments, the nucleotide sequence shown in SEQ ID NO:8 includes the nucleotide sequence shown in SEQ ID NO:27 and SEQ ID NO:28. In some embodiments, the nucleotide sequence shown in SEQ ID NO:12 includes the nucleotide sequence shown in any one of SEQ ID NOs:29 to 34. In some embodiments, the nucleotide sequence shown in SEQ ID NO:14 includes the nucleotide sequence shown in SEQ ID NO:35 and SEQ ID NO:36. In some embodiments, the nucleotide sequence shown in SEQ ID NO:15 includes the nucleotide sequence shown in SEQ ID NO:37 and SEQ ID NO:38. In some embodiments, the nucleotide sequence shown in SEQ ID NO:18 includes the nucleotide sequence shown in SEQ ID NO:39, SEQ ID NO:40 and SEQ ID NO:41. In some embodiments, the nucleotide sequence shown in SEQ ID NO:19 comprises the nucleotide sequences shown in SEQ ID NO:42 and SEQ ID NO:43.

[0295] In some more specific embodiments, the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731.

[0296] In some embodiments, the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence. Specifically, along the direction from the 5' end to the 3' end, the starting nucleotide is selected in the target sequence, and at least 15 nucleotides extending in the 3' direction including the starting nucleotide are used as the binding region of the siRNA. The antisense strand comprises the reverse complementary sequence of the nucleotide sequence corresponding to the binding region. It should be noted that the starting nucleotide can be a nucleotide at any position of the target sequence, as long as at least 15 consecutive nucleotides (including the nucleotide at the starting position) can be obtained by extending in the 3' direction of the target sequence based on the starting nucleotide.

[0297] In the present disclosure, the nucleotide sequence of the antisense strand and the target sequence can be completely complementary or substantially complementary. When the nucleotide sequence of the antisense strand and the target sequence are substantially complementary, there are no more than 3 mismatched bases in the nucleotide sequence of the antisense strand and the target sequence. For example, the mismatched bases are 1, 2 or 3. When the nucleotide sequence of the antisense strand and the target sequence are completely complementary, there are no mismatched bases in the nucleotide sequence of the antisense strand and the target sequence.

[0298] Further, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0299] Preferably, the antisense strand consists of 18-25 nucleotides, more preferably 18-23 nucleotides, most preferably 19, 21 or 23 nucleotides.

[0300] In some optional embodiments, sequence B in the antisense strand is identical to the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0301] In some specific embodiments, sequence B in the antisense strand is identical to the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably identical to the reverse complementary sequence of a sequence consisting of 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides.

[0302] In some optional embodiments, sequence B in the antisense strand differs by 1 nucleotide from the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0303] In some specific embodiments, sequence B in the antisense strand differs by 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 nucleotides, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.

[0304] In some specific embodiments, the nucleotides that are different from the target sequence are preferably located at the end of sequence B. For example, in some specific embodiments, the nucleotides that are different are located at the 3' end of sequence B. In other specific embodiments, the nucleotides that are different are located at the 5' end of sequence B.

[0305] In some embodiments, the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence. The sense strand includes a region complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the region where the antisense strand binds to the target sequence. Therefore, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand; or, the nucleotide sequence of the sense strand is compared with at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand, and there are 1, 2, or 3 different nucleotides in the nucleotide sequence of the sense strand.

[0306] Further, the sense strand is composed of at least 15 nucleotides. In some embodiments, the sense strand is composed of 15-28 nucleotides. For example, the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0307] Preferably, the sense strand consists of 18-25 nucleotides, more preferably 18-23 nucleotides, most preferably 19, 21 or 23 nucleotides.

[0308] In some alternative embodiments, the sequence A in the sense strand may be identical to a sequence consisting of at least 15 consecutive nucleotides in the target sequence.

[0309] In some specific embodiments, sequence A in the sense strand may be identical to a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.

[0310] In some optional embodiments, sequence A in the sense strand differs by 1 nucleotide from a sequence of at least 15 consecutive nucleotides in the target sequence.

[0311] In some specific embodiments, the sequence A in the sense strand differs by 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides on the target sequence. In some specific embodiments, the sequence A in the sense strand differs by 1 nucleotide from a sequence consisting of 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.

[0312] In some specific embodiments, the nucleotides that are different from the target sequence are preferably located at the end of sequence A. For example, in some specific embodiments, the nucleotides that are different are located at the 3' end of sequence A. In other specific embodiments, the nucleotides that are different are located at the 5' end of sequence A.

[0313] In the present disclosure, the length of the sense strand and the length of the antisense strand may be the same or different.

[0314] In some embodiments, the sense strand is the same length as the antisense strand, specifically, the sense strand / antisense strand length ratio is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, or 28 / 28. Preferably, the sense strand / antisense strand length ratio is 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, or 25 / 25, more preferably 19 / 19, 20 / 20, 21 / 21, 22 / 22, or 23 / 23, and most preferably 19 / 19, 21 / 21, or 23 / 23.

[0315] In some embodiments, the sense strand is different from the antisense strand in length. For example, the sense strand / antisense strand length ratio is 18 / 19, 18 / 20, 18 / 21, 18 / 22, 18 / 23, 18 / 24, 18 / 25, 18 / 26, 19 / 18, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 18, 21 / 19 , 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 18, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25 or 23 / 26 and the like; in some preferred embodiments, the length ratio of the sense strand / antisense strand is 19 / 21 or 21 / 23.

[0316] In the present disclosure, the sense strand and the antisense strand may be completely complementary or substantially complementary. When the two are substantially complementary, there are no more than 3 mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.

[0317] In some embodiments, after the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides can be 1 or more, for example, 1 or 2. In addition, the protruding 1-2 nucleotides can be located at the 5' end, 3' end, or both ends of any antisense strand or sense strand, and each protruding nucleotide can be any type of nucleotide. For example, in the case where the sense strand is composed of a sequence A+D with a length of 21 and the antisense strand is composed of a sequence B+E with a length of 21, in the direction from the 5' end to the 3' end, the 1st to 19th nucleotides of sequence A are completely reverse complementary to the 1st to 19th nucleotides of sequence B, so that sequence D and sequence E form protruding nucleotides at the 3' end of their respective chains. For example, when the sense strand consists of a sequence A with a length of 19 and the antisense strand consists of a sequence B+E with a length of 21, nucleotides 1-19 of sequence A are completely reverse complementary to nucleotides 1-19 of sequence B in the direction from the 5' end to the 3' end, thereby forming a protruding nucleotide at the 3' end of sequence E on the antisense strand.

[0318] In some embodiments, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end.

[0319] In some embodiments, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end.

[0320] In some embodiments, the sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region.

[0321] In some embodiments, the sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3′ ends of the sense strand and the antisense strand both form blunt ends.

[0322] In the present disclosure, as described above, the nucleotide sequence of the antisense strand and the target sequence may be completely complementary or substantially complementary; the sense strand and the antisense strand may be completely complementary or substantially complementary. Therefore, in the following description of the target sequences SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20-43, 728-731 and siRNAs that are complementary to these target sequences, the antisense strand of each siRNA includes the case where the target sequence (e.g., any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20-43 and 728-731) to which it is complementary is substantially complementary, that is, the nucleotide sequence of the antisense strand of each siRNA may have a base mismatch with the corresponding target sequence; the sense strand of each siRNA includes the case where the target sequence (e.g., any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20-43 and 728-731) to which it is complementary is substantially complementary, that is, the nucleotide sequence of the sense strand of each siRNA may have a base mismatch with the corresponding target sequence. In some embodiments, the base mismatch may be a mismatch that differs from the target sequence by no more than 3 bases, for example, the number of mismatched bases is 1, 2 or 3.

[0323] In some specific embodiments, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 44-149, 256-273, 475-485, 600-612 and 650, and the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 150-255, 289-306, 486-496, 613-625.

[0324] In some preferred embodiments, the sense strand of the double-stranded ribonucleic acid comprises a sequence selected from any one of SEQ ID NO:63, SEQ ID NO:65 and SEQ ID NO:600, and the antisense strand of the double-stranded ribonucleic acid comprises a sequence selected from any one of SEQ ID NO:169, SEQ ID NO:171 and SEQ ID NO:613.

[0325] In other embodiments, the length of the double-stranded region is 19, 21 or 23 nucleotides, the nucleotide sequence of the antisense chain and the target sequence have no more than 3 mismatched bases, preferably, the number of mismatched bases is 1, 2 or 3; the difference between the sense chain and the target sequence is no more than 3 nucleotides, preferably, the number of nucleotides is 1, 2 or 3; the sense chain includes a region complementary to the antisense chain, and the nucleotide sequence of the sense chain is exactly the same as the sequence of the antisense chain in the target sequence binding region.

[0326] In some specific embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO: 477, 479, 481 or 484 and a base A added to the 3' end thereof, and the nucleotide sequence of the antisense strand is a sequence B consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO: 488, 490, 492 or 495 and a base U added to the 5' end thereof, which is the reverse complement of the sequence. In addition, the 3' ends of the sense strand and the antisense strand both form blunt ends.

[0327] Exemplarily, the double-stranded RNA is any one of siRNA361, siRNA363, siRNA365, and siRNA368 shown in Table 1.

[0328] In some specific embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO: 475, 476, 478 or 480 and a base U added at the 3' end thereof, and the nucleotide sequence of the antisense strand is a sequence B consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO: 486, 487, 489 or 491 and a base A added at the 5' end thereof, which is the reverse complement of the sequence. In addition, the 3' ends of the sense strand and the antisense strand both form blunt ends.

[0329] Exemplarily, the double-stranded RNA is any one of siRNA359, siRNA360, siRNA362, and siRNA364 shown in Table 1.

[0330] Among them, G represents a guanine nucleotide, C represents a cytosine nucleotide, A represents an adenine nucleotide, and U represents a uracil nucleotide.

[0331] In some specific embodiments, the double-stranded ribonucleic acid is selected from any siRNA as shown in Table 1 or Table 1-1. The siRNA provided by the present disclosure has high specificity for binding to the target mRNA (SMAD2 mRNA), has good silencing activity of the target mRNA, can significantly inhibit SMAD2 gene expression, and is used to treat SMAD2-related diseases including fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases and autoimmune leukoproliferative diseases, and colorectal cancer.

[0332] In some embodiments, the present disclosure provides a siRNA composition comprising any one or a combination of two or more of the siRNAs shown in Table 1 or Table 1-1.

[0333] In some embodiments, each nucleotide of the sense strand is independently a modified nucleotide or an unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0334] In some embodiments, any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond. In some embodiments, any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.

[0335] In some embodiments, the ribose group of the 5' terminal nucleotide of the sense strand is a 5' hydroxyl group.

[0336] In some embodiments, the ribose group of the 5' terminal nucleotide of the antisense strand has the following: 5' hydroxyl group, 5' phosphate group or 5' phosphate derivative group. Which group the 5' position of the ribose group has depends on the preparation method used, which can be known by those skilled in the art according to the corresponding preparation method.

[0337] Exemplarily, the structure of the 5' phosphate group is: The structures of the 5' phosphate derivative group include but are not limited to: (EVP), wait.

[0338] When the ribose group of the 5' terminal nucleotide of the antisense strand has a 5' phosphate group or a 5' phosphate derivative group, the following structure is formed:

[0339] Wherein, Base represents a base, such as A, U, G, C or T. R' is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-deoxyribonucleotides.

[0340] Herein, when the ribose group of the 5' terminal nucleotide of the antisense strand does not have a 5' phosphate group or a 5' phosphate derivative group but has a hydroxyl group, the structure of the 5' terminal nucleotide is as shown below:

[0341]

[0342] Wherein, Base represents a base, such as A, U, G, C or T, R is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl,

[0343] 2'-Amino, 2'-substituted amino.

[0344] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, etc.

[0345] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3) modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, and the like.

[0346] In some embodiments, the 2'-substituted alkyl modified nucleotide is a 2'-CH2-CH2-CH=CH2 modified nucleotide, and the like.

[0347] Double-stranded RNA modification

[0348] The second aspect of the present disclosure provides a double-stranded RNA modification. Further, the double-stranded RNA modification is a siRNA modification. The siRNA modification can improve the stability of siRNA while maintaining a high SMAD2 mRNA inhibitory activity.

[0349] In some embodiments, the double-stranded RNA modifier comprises at least one modification of nucleotide. The modification of nucleotide is selected from at least one of the modification of ribose group and the modification of base. In some embodiments, "modification of nucleotide" refers to a nucleotide or nucleotide derivative formed by replacing the 2' hydroxyl group of the ribose group of the nucleotide with other groups, or a nucleotide of a modified base on the nucleotide. The modification of the nucleotide does not cause the function of siRNA to inhibit gene expression to be significantly weakened or lost. For example, JKWatts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13 (19-20): 842-55 disclosed in the modification of nucleotides can be selected. The stability of siRNA can be improved by modification of nucleotides, and its high inhibition efficiency of SMAD2 gene can be maintained.

[0350] Exemplarily, the modified nucleoside has the structure shown below:

[0351] Wherein, Base represents a base, such as A, U, G, C or T. The hydroxyl group at the 2' position of the ribose group is substituted by R. The hydroxyl group at the 2' position of these ribose groups can be substituted by various groups known to those skilled in the art, for example, R can be selected from halogen, alkyl, alkoxy, substituted alkyl and substituted alkoxy. For example, in some specific embodiments, the modified nucleotides include but are not limited to 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-deoxyribonucleotides.

[0352] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, and the like.

[0353] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3) modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, and the like.

[0354] In some embodiments, the 2'-substituted alkyl modified nucleotide is a 2'-CH2-CH2-CH=CH2 modified nucleotide and the like.

[0355] In some embodiments, the modification of the nucleotide is the modification of the base. The modification of the base can be various types of modifications known to those skilled in the art. Exemplary, the modification of the base includes but is not limited to m 6 A, Ψ, m 1 A.m 5 A.ms 2 i 6 A.i 6 A.m 3 C.m 5 C. ac 4 C.m 7 G、m 2,2 G、m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C.s 4 U.s 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t6 A or its derivatives.

[0356] In some embodiments, nucleotide derivatives refer to compounds that can replace nucleotides in nucleic acids, but have structures different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxyribonucleotides. In some embodiments, nucleotide derivatives can be isonucleotides, bridged nucleic acids (BNAs) or acyclic nucleotides. BNAs refer to constrained or inaccessible nucleotides. BNAs can contain five-membered rings, six-membered rings, or seven-membered rings with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-positions of the ribose to provide a 2', 4'-BNA nucleotide, such as LNA, ENA, cET, etc.

[0357] The nucleoside of LNA is shown in formula (1), the nucleoside of ENA is shown in formula (2), and the nucleoside of cET is shown in formula (3):

[0358]

[0359] Here, Base refers to base.

[0360] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), wherein UNA is shown in formula (4) and GNA is shown in formula (5):

[0361]

[0362] In the above formula (4) and formula (5), Base refers to a base, and R is selected from H, OH or alkoxy (—O-alkyl).

[0363] In some embodiments, the nucleotide derivative modification refers to that the nucleotide in the nucleic acid is replaced by a nucleotide derivative. Exemplarily, the nucleotide derivative is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.

[0364] In some embodiments, the nucleotides in the nucleic acid are replaced with isonucleotides, which are also referred to as isonucleoside modifications in the context of the present disclosure. In some embodiments, isonucleoside modifications include incorporating isonucleosides at one or more sites of the sense strand and / or antisense strand of the siRNA to be modified to replace natural nucleosides for coupling at the corresponding positions.

[0365] In some embodiments, the isonucleoside modification adopts D-isonucleoside modification. In other embodiments, the isonucleoside modification adopts L-isonucleoside modification. In still other embodiments, the isonucleoside modification adopts D-isonucleoside modification and L-isonucleoside modification.

[0366] In some embodiments, the double-stranded RNA modification comprises a modification of the phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to the replacement of at least one oxygen atom in the phosphodiester bond by a sulfur atom to form a thiophosphate diester bond. The thiophosphate diester bond can stabilize the double-stranded structure of the siRNA and maintain the specificity of base pairing. Exemplary, the thiophosphate diester bond structure is shown below:

[0367]

[0368] In some embodiments, the double-stranded RNA modification comprises at least one of the following chemical modifications:

[0369] (1) modification of at least one nucleotide in the sense strand,

[0370] (2) modification of the phosphodiester bond at at least one position in the sense strand,

[0371] (3) modification of at least one nucleotide in the antisense strand,

[0372] (4) Modification of the phosphodiester bond at at least one position in the antisense strand.

[0373] Furthermore, the double-stranded RNA modification product is a siRNA modification product comprising at least one chemical modification among (1) to (4).

[0374] In the present disclosure, after sequence A in the sense strand and sequence B in the antisense strand complement each other to form a double-stranded region, the 3' ends of sequence A and sequence B may be any of the following:

[0375] (1) The 3' ends of sequence A and sequence B are both blunt-ended;

[0376] (2) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B forms a blunt end;

[0377] (3) The 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence A forms a blunt end;

[0378] (4) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region.

[0379] In some embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0380] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, and there are no protruding nucleotides at the 3' ends of the sense strand and the antisense strand, the 3' end of at least one of the sense strand and the antisense strand may further include an additional 1-2 nucleotides as protruding nucleotides. For example, the sense strand comprises sequence A and sequence D, wherein sequence D is 1-2 nucleotides connected to the 3' end of the sense strand; the antisense strand comprises sequence B and sequence E, wherein sequence D is 1-2 nucleotides connected to the 3' end of the antisense strand. In some preferred embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0381] Exemplarily, two deoxyribonucleotides (TT) are added to the 3' end of sequence A of the sense strand as sequence D, and two deoxyribonucleotides (TT) are added to the 3' end of sequence B of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of sequence A of the sense strand as sequence D.

[0382] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, and there is no protruding nucleotide at the 3' end of the sense strand, a sequence D consisting of 1-2 nucleotides is added to the 3' end of the sense strand as a protruding nucleotide. Then, after the nucleotide sequence formed by connecting sequence A to sequence D is chemically modified, the sequence D consisting of 1-2 nucleotides is excluded to form a further modified product. Accordingly, in the double-stranded RNA modified product, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B. Alternatively, in the double-stranded RNA modified product, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0383] In some embodiments, when sequence A is complementary to sequence B to form a double-stranded region, the 3' end of sequence A has 1-2 nucleotides protruding out of the double-stranded region, the protruding nucleotides at the 3' end of sequence A are excluded as the nucleotide sequence of the sense strand. The sequence excluding the protruding nucleotides at the 3' end is called sequence A'. Accordingly, the nucleotide sequence of the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded RNA modified substance is the sequence shown in sequence B. Alternatively, the nucleotide sequence of the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded RNA modified substance is the sequence shown in sequence B connected to sequence E.

[0384] In some embodiments, along the 5' end to the 3' end direction, sequence A of the sense strand of the siRNA modifier includes the following modifications: the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-fluoro-modified ribonucleotides; and the ribonucleotides at other positions in the sense strand are 2'-methoxy-modified ribonucleotides.

[0385] Herein, the ribose group of the 5' terminal nucleotide of the sense strand is the 5' hydroxyl group.

[0386] Herein, the nucleotide structure having a 5' hydroxyl group of the ribose group of the 5' terminal nucleotide of the sense strand is as shown in Formula X:

[0387]

[0388] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.

[0389] In some embodiments, the sense strand of the siRNA modification includes phosphorothioate diester bonds at the following positions along the 5' end to the 3' end: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0390] In some embodiments, along the 5' end to the 3' end direction, 3-5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in the sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides;

[0391] In some embodiments, the sense strand of the siRNA modification includes phosphorothioate diester bonds at the following positions: between the first and second nucleotides starting from the 5' end, and between the second and third nucleotides starting from the 5' end, along the 5' end to the 3' end.

[0392] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8 and 9 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0393] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0394] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 8, 9 and 10 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0395] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 8, 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0396] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0397] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0398] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0399] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0400] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 9, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0401] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0402] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 7, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0403] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 7, 11, 12 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0404] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0405] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0406] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11, 16 and 17 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0407] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 9, 11, 12 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0408] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0409] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0410] In an optional embodiment, when the sequence length is 21, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 9, 11, 12 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides; or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0411] In an optional embodiment, when the sequence length is 21, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 10 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides; or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0412] In an optional embodiment, when the sequence length is 21, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 11 and 13 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides; or, when the length of sequence A is 19, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense chain are 2'-O-CH3 modified ribonucleotides.

[0413] In some specific embodiments, the sense strand of the siRNA modification has a structure as shown in any one of (a1)-(a3) above.

[0414] In some other specific embodiments, the positive strand of the siRNA modification has the above (a4)-(a 38 ) any one of the structures shown in .

[0415] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the siRNA modifier includes the following modifications: the ribonucleotide at any odd position in sequence B of the antisense strand is a 2'-methoxy-modified ribonucleotide, and the ribonucleotide at any even position in sequence B of the antisense strand is a 2'-fluoro-modified ribonucleotide.

[0416] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0417] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the siRNA modification comprises the following modifications: the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0418] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0419] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7 and 14 in sequence B of the antisense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense chain are 2'-O-CH3 modified ribonucleotides.

[0420] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense chain are 2'-O-CH3 modified ribonucleotides.

[0421] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense chain are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense chain are 2'-O-CH3 modified ribonucleotides.

[0422] In some embodiments, along the direction from the 5' end to the 3' end, the antisense strand of the siRNA modifier includes the following modifications: the ribonucleotides at positions 2, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0423] In some embodiments, along the direction from the 5' end to the 3' end, the antisense strand of the siRNA modifier includes the following modifications: the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides.

[0424] In some embodiments, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense chain are 2'-O-CH3 modified ribonucleotides.

[0425] In some embodiments, the antisense strand of the siRNA modification includes phosphorothioate diester bonds at the following positions along the 5' end to the 3' end: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0426] In an embodiment of the present invention, the ribose group of the 5' terminal nucleotide of the antisense strand may have: a 5' hydroxyl group, a 5' phosphate group, or a 5' phosphate-derived group.

[0427] In an embodiment of the present invention, the ribose group of the 5' terminal nucleotide of the antisense strand has a nucleotide structure with a 5' hydroxyl group as shown in Formula X:

[0428]

[0429] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.

[0430] In some embodiments, along the 5' end to the 3' end direction, the nucleotide at the 5' end of the antisense strand has a 5' phosphate group or a 5' phosphate derivative group. Exemplarily, the structure of the 5' phosphate group is: The structures of the 5' phosphate derivative group include but are not limited to: (EVP), wait.

[0431] In some specific embodiments, the antisense strand of the siRNA modification has the following characteristics: 37 ) any one of the structures shown in .

[0432] In some optional embodiments, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 322-364, 427-440, 497-512, 626 and 651-684, and the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 365-426, 441-474, 513-575, 627-646, 649 and 685-694.

[0433] In some preferred embodiments, the double-stranded RNA modification is a modification of double-stranded RNA comprising the following: the sense strand of the double-stranded RNA comprises a sequence selected from any one of SEQ ID NOs: 63, 65 and 600, and the antisense strand of the double-stranded RNA comprises a sequence selected from any one of SEQ ID NOs: 169, 171 and 613. Preferably, the sense strand of the double-stranded RNA modification comprises a sequence shown in SEQ ID NOs: 331, 332, 429, 626 or 651-684, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: a sequence shown in SEQ ID NOs: 378-381, 447-448, 524-526, 627-642 or 685-694.

[0434] In some embodiments, the double-stranded RNA modifications include, but are not limited to, the siRNA modifications shown in Table 2.

[0435] In some embodiments, the present invention further comprises excluding nucleotides with terminal protrusions of the above-mentioned double-stranded RNA modification to form a blunt end, thereby producing further double-stranded RNA modification, in particular, the 3' end of the sense strand of the above-mentioned double-stranded RNA modification is modified to be a blunt end, optionally, by excluding the protruding nucleotides extending out of the double-stranded region at the 3' end of the sense strand of the above-mentioned double-stranded RNA modification.

[0436] Conjugate of double-stranded RNA or double-stranded RNA modification

[0437] The third aspect of the present disclosure provides a conjugate of double-stranded RNA or double-stranded RNA modification (referred to herein as double-stranded RNA conjugate, or conjugate), which is obtained by conjugating the double-stranded RNA provided by the first aspect of the present disclosure or the double-stranded RNA modification provided by the second aspect with a conjugation group.

[0438] In the present disclosure, the sense strand and the antisense strand of the double-stranded RNA conjugate form a double-stranded region of the double-stranded RNA conjugate, and a blunt end is formed at the 3' end of the sense strand of the double-stranded RNA conjugate. In some embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate has 1-2 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate forms a blunt end.

[0439] In some preferred embodiments, the double-stranded RNA conjugate is obtained by conjugating a double-stranded RNA modification with a conjugation group, wherein the sense strand and the antisense strand of the double-stranded RNA modification are at least partially complementary to form a double-stranded region of the double-stranded RNA modification, and the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the conjugation group is conjugated with the 3' end of the sense strand having the blunt end to form a double-stranded RNA conjugate.

[0440] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. In addition, the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected to a conjugated group to form a double-stranded RNA conjugate.

[0441] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. In addition, the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected to a conjugated group to form a double-stranded RNA conjugate.

[0442] Exemplarily, the sense strand of the double-stranded RNA modification is a sequence shown by sequence A connected to sequence D, and the antisense strand is a sequence shown by sequence B connected to sequence E. In addition, the 3' end of the sense strand of the double-stranded RNA modification has a sequence D consisting of protruding 1-2 nucleotides, and after excluding the sequence D at the 3' end of the sense strand in the double-stranded RNA modification, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.

[0443] Exemplarily, the sense strand of the double-stranded RNA modification is a sequence shown by sequence A connected to sequence D, and the antisense strand is a sequence shown by sequence B. In addition, the 3' end of the sense strand of the double-stranded RNA modification has a sequence D consisting of protruding 1-2 nucleotides, and after excluding the sequence D at the 3' end of the sense strand in the double-stranded RNA modification, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.

[0444] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. Wherein, the 3' end of sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence after excluding the protruding nucleotide at the 3' end of sequence A (also known as sequence A') is used as the nucleotide sequence for connecting the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0445] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. Wherein, the 3' end of sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence after excluding the protruding nucleotide at the 3' end of sequence A (also known as sequence A') is used as the nucleotide sequence for connecting the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0446] Exemplarily, the siRNA conjugate shown as N-ER-FY026071M3L96 is a conjugate obtained by a modification of N-ER-FY026071 and a conjugation group, wherein, based on the sequence of N-ER-FY026071, the 3' end of the sense strand of the conjugate originally has a protruding nucleotide -smAsmA extending out of the double-stranded region, and before combining with the conjugation group, the protruding -smAsmA nucleotide located at the 3' end of the sense strand is excluded to form a conjugate containing mGsmAsmAmAmAmCUfmGCfGfAfmAmUmAmUmGmCmUmUmUmUmU (SEQ ID NO:651) as the nucleotide sequence for connecting the L96 conjugation group (i.e., L96 is connected by a phosphodiester bond after the sequence is synthesized to the blunt end). Therefore, the sequence forming the siRNA conjugate is: the positive strand is mGsmAsmAmAmAmCUfmGCfGfAfmAmUmAmUmGmCmUmUmUmUL96 (SEQ ID NO:591), and the antisense strand is mAsAfsmAmAmGCfmAmUmAmUmUmCmGCfmAGfmUmUmUmUmCsmAsmA (SEQ ID NO:627).

[0447] In some alternative embodiments, the sense strand of the double-stranded RNA conjugate has (d1)-(d 35 ) shows the structure:

[0448] (d1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3',

[0449] (d2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19<h2 style=";text-align:left;direction:ltr">-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0450] <h2 style=";text-align:left;direction:ltr"> (d3)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0451] <h2 style=";text-align:left;direction:ltr"> (d4)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0452] <h2 style=";text-align:left;direction:ltr"> (d5)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0453] <h2 style=";text-align:left;direction:ltr"> (d6)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0454] <h2 style=";text-align:left;direction:ltr"> (d7)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0455] <h2 style=";text-align:left;direction:ltr"> (d8)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0456] <h2 style=";text-align:left;direction:ltr"> (d9)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0457] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13<h2 style=";text-align:left;direction:ltr">-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0458] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0459] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0460] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0461] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 14<h2 style=";text-align:left;direction:ltr">)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0462] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0463] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0464] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0465] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0466] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0467] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0468] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11<h2 style=";text-align:left;direction:ltr">f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0469] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0470] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0471] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 24 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0472] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 25 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0473] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0474] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0475] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18-mN 19 -mN 20 -mN 21 -L96-3’,

[0476] (d 29 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -L96-3’,

[0477] (d 30 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -L96-3’,

[0478] (d 31 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-N 17 f-mN 18 -mN 19 -L96-3’,

[0479] (d 32 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0480] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 33 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0481] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 34 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -L96-3',<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0482] <h2 style=";text-align:left;direction:ltr"> (d<h2 style=";text-align:left;direction:ltr"> 35 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21-L96-3';

[0483] Among them, N1-N 21 The bases are independently selected from ribonucleotides whose bases are A, U, C or G. The lowercase letter m indicates that a ribonucleotide adjacent to the right of the letter m is a ribonucleotide whose ribose group has a 2'-O-CH3 modification. The lowercase letter f indicates that a ribonucleotide adjacent to the left of the letter f is a ribonucleotide whose ribose group has a 2'-F modification. -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond. L96 is the conjugate group GalNAc shown in formula I.

[0484] In some alternative embodiments, the antisense strand of the double-stranded RNA conjugate has the above (b1)-(b2) 37 ) any one of the structures shown in .

[0485] Further, the double-stranded RNA conjugate is a siRNA conjugate, wherein the siRNA molecule connected to the conjugation group in the siRNA conjugate can be an unmodified siRNA, or a siRNA modification. The siRNA molecule modified with the conjugation group has good tissue and organ targeting and the ability to promote cell endocytosis while maintaining high inhibitory activity and stability, which can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs. Optionally, any one of the siRNA molecules shown in Table 1 or Table 1-1 or Table 2 is selected to be connected to the conjugation group to obtain a double-stranded RNA conjugate.

[0486] The conjugation site of siRNA and conjugation group can be at the 3' end or 5' end of the siRNA sense strand, at the 5' end of the antisense strand, or in the internal sequence of siRNA. In some embodiments, the conjugation site of siRNA and conjugation group is at the 3' end of the siRNA sense strand.

[0487] In some embodiments, the conjugated group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugated group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by 2',5'-phosphodiester bonds. When the conjugated group is connected to the end of the siRNA chain, the conjugated group is usually connected to the phosphate group of the nucleotide; when the conjugated group is connected to the internal sequence of the siRNA, the conjugated group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharanet.al.siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencingin vivo in hepatocytes.ACS Chemical biology, 2015, 10(5): 1181-7.

[0488] In the present disclosure, the conjugated group can be a ligand conventionally used in the field of siRNA administration. In some embodiments, the conjugated group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatocytes, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0489] In some specific embodiments, the conjugated group has the following structure:

[0490]

[0491]

[0492]

[0493] The conjugated group shown in Formula I is GalNAc. GalNAc has liver targeting property and can deliver siRNA molecules to liver tissue with high specificity, thereby specifically inhibiting the high expression of SMAD2 gene in the liver.

[0494] In some specific embodiments, GalNAc is conjugated to the 3' end of the sense strand via a phosphodiester bond to obtain a siRNA conjugate having a structure shown in the following formula II:

[0495]

[0496] The double helix structure is unmodified siRNA or siRNA modification.

[0497] In some embodiments, the double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in Table 3.

[0498] Prodrug

[0499] "Prodrugs" as described herein refer to compounds that can be converted into active compounds through certain chemical or physiological processes (e.g., enzymatic processes and metabolic hydrolysis). Therefore, the term "prodrug" also refers to a precursor of a pharmaceutically acceptable biologically active compound.

[0500] In this article, considering the situation that the 5' terminal nucleotide of the antisense chain has a 5' hydroxyl group (i.e., no phosphate group), such an antisense chain will first be phosphorylated in vivo to convert the 5' terminal nucleotide into a nucleotide carrying a phosphate group, and then play a role in the body. Therefore, in the present invention, such siRNA, siRNA modifications, and siRNA conjugates are also referred to as prodrugs. For example, in this application, the siRNA modification or conjugate with M6 pattern modification is a prodrug of the siRNA modification or conjugate with M2 pattern modification, because the difference between M2 pattern modification and M6 pattern modification is whether there is P1 at the 5' end of the antisense chain. Similarly, the relationship between M7 pattern modification and M3 pattern modification is the same. Therefore, the double-stranded ribonucleic acid herein includes its corresponding prodrug.

[0501] Pharmaceutical composition

[0502] The fourth aspect of the present disclosure provides a pharmaceutical composition, comprising one or more of the double-stranded ribonucleic acid described in the first aspect, the modified double-stranded ribonucleic acid described in the second aspect, and the conjugate described in the third aspect.

[0503] In some embodiments, the pharmaceutical composition contains siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier. In the present disclosure, the purpose of using the pharmaceutical composition is to promote administration to an organism, which is conducive to the absorption of the active ingredient and thus exerts biological activity. The pharmaceutical composition of the present disclosure can be administered in any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid preparations, oral liquid preparations), rectal, inhalation, implantation, local (e.g., eye) administration, etc. Non-limiting examples of oral solid preparations include, but are not limited to, powders, capsules, lozenges, granules, tablets, etc. Non-limiting examples of liquid preparations for oral or mucosal administration include, but are not limited to, suspensions, tinctures, elixirs, solutions, etc. Non-limiting examples of topical preparations include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops, or serum preparations. Non-limiting examples of parenteral preparations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, emulsions for injection, etc. The pharmaceutical compositions of the present disclosure can also be formulated into controlled-release or delayed-release dosage forms (eg, liposomes or microspheres).

[0504] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to meet the requirements of the properties of the drug, the convenience of the patient and the medical staff, and other relevant factors.

[0505] In some embodiments, the present disclosure provides a kit, comprising: a) the double-stranded RNA, double-stranded RNA modification, conjugate, or pharmaceutical composition thereof described in the present disclosure; and b) the following instructions for use:

[0506] (1) Inhibit SMAD2 gene expression;

[0507] (2) For preventing or treating diseases related to abnormal expression of the SMAD2 gene;

[0508] (3) For use in treating a subject suffering from a disease that would benefit from decreased SMAD2 gene expression.

[0509] Medical Uses

[0510] The fifth aspect of the present disclosure provides at least one of the following uses of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications or conjugates thereof:

[0511] (1) Inhibiting SMAD2 gene expression, or preparing a drug for inhibiting SMAD2 gene expression;

[0512] (2) for preventing or treating diseases associated with abnormal expression of the SMAD2 gene, or for preparing drugs for preventing or treating diseases associated with abnormal expression of the SMAD2 gene;

[0513] (3) Use for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression.

[0514] The present disclosure further provides the use of siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions in at least one of the above (1)-(3).

[0515] In the present disclosure, abnormal expression of SMAD2 gene causes one or more of the following diseases related to abnormal expression of SMAD2 gene: fatty liver disease, non-alcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases, autoimmune leukoproliferative diseases, colorectal cancer, and other related disorders, pathologies or syndromes that have not yet been identified.

[0516] The double-stranded ribonucleic acid, double-stranded ribonucleic acid modification or its conjugate (such as siRNA molecule) causes the expression of SMAD2 gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99%, thereby achieving the treatment of diseases related to abnormal expression of SMAD2 gene.

[0517] In some embodiments, the present disclosure provides a method for inhibiting SMAD2 gene expression in a cell, comprising contacting a double-stranded RNA, a double-stranded RNA modification, or a conjugate or pharmaceutical composition thereof with the cell.

[0518] Furthermore, the method for inhibiting the expression of SMAD2 gene in cells is to introduce siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions into cells.

[0519] In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.

[0520] In some embodiments, the present disclosure provides a method for preventing or treating a disease, comprising administering a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a conjugate thereof, or a pharmaceutical composition thereof to a subject.

[0521] In some embodiments, the present disclosure provides a method for preventing or treating a disease, comprising administering to a subject an effective amount of double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a conjugate thereof, or a pharmaceutical composition thereof.

[0522] Furthermore, the method for preventing or treating a disease is to administer siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions to a subject.

[0523] In the present disclosure, "subject" includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:

[0524] (1) Abnormal expression of SMAD2 gene in vivo, more specifically abnormally high expression of SMAD2 gene;

[0525] (2) suffering from diseases related to abnormal expression of SMAD2 gene;

[0526] (3) People who suffer from diseases that would benefit from reduced SMAD2 gene expression, such as people who suffer from or are prone to diseases associated with abnormal SMAD2 gene expression.

[0527] Table 1 siRNA sequence information

[0528]

[0529]

[0530]

[0531]

[0532]

[0533]

[0534] Table 1-1 siRNA sequence information

[0535]

[0536]

[0537]

[0538] Table 1-2

[0539]

[0540] Table 2 siRNA modifications

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555] In the above table, each of the capital letters "G", "C", "A", "dT" and "U" generally represents a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base, respectively, wherein the letter combination dT represents a deoxyribonucleotide whose base is thymine; mA, mU, mC, mG: represent a nucleotide whose ribose group has a 2'-methoxy modification; Af, Gf, Cf, Uf: represent a nucleotide whose ribose group has a 2'-fluoro modification; the lowercase letter s represents that the two nucleotides adjacent to the letter s are connected by a thiophosphate diester bond; P1: represents that a nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide, EVP represents that a nucleotide adjacent to the right side thereof is a 5'-trans vinylphosphonate nucleotide, [GNA] represents that a ribonucleotide adjacent to the right side thereof is a ribonucleotide modified with GNA, and optionally, the 5' terminal nucleotides of the sense chain and the antisense chain do not carry P1 or EVP represents that the ribose group of the nucleotide has a 5' hydroxyl group.

[0556] Table 3 siRNA conjugates

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565] In the above table, the capital letters "G", "C", "A", "dT" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. The letter combination dT represents a deoxyribonucleotide whose base is thymine; mA, mU, mC, mG: represent nucleotides whose ribose group has a 2'-methoxy modification; Af, Gf, Cf, Uf: represent nucleotides whose ribose group has a 2'-fluoro modification; the lowercase letter s represents the two adjacent letters s on the left and right. The nucleotides are connected by thiophosphate diester bonds; P1: indicates that the adjacent nucleotide on the right side of P1 is a 5'-phosphate nucleotide; EVP indicates that the adjacent nucleotide on the right side is a 5'-trans vinyl phosphonate nucleotide; [GNA] indicates that the adjacent ribonucleotide on the right side is a GNA-modified ribonucleotide; L96 is the conjugate group GalNAc shown in formula I; optionally, the 5' terminal nucleotides of the sense chain and the antisense chain do not carry P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

[0566] In Table 1, Table 1-1, Table 1-2, Table 2 and Table 3, if there is no P1 or EVP on the left side of the 5' terminal nucleotide of the sense strand, the modified sense strand and the modified sense strand connected to the conjugated group, it means that the ribose group of the 5' terminal nucleotide does not have a 5' phosphate group or a 5' phosphate derivative group, but has a 5' hydroxyl group, and its structure is shown in Formula X:

[0567]

[0568] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-

[0569] Amino, 2'-substituted amino, 2'-deoxynucleotides.

[0570] For the case of siRNA modifications and conjugates, that is, in Tables 2 and 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not labeled with P1 or EVP, it means that the ribose group of the 5' terminal nucleotide does not have a 5' phosphate group or a 5' phosphate derivative group, and its structure is also shown in Formula X.

[0571] In Table 1, Table 1-1, Table 1-2, Table 2 and Table 3, the 3' position of the 3' terminal nucleotide of the sense strand and the modified sense strand, and the 3' terminal nucleotide of the antisense strand and the modified antisense strand is a hydroxyl group.

[0572] Example

[0573] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although representing specific embodiments of the present disclosure) are given for illustrative purposes only, because after reading the detailed description, various changes and modifications made within the spirit and scope of the present disclosure will become apparent to those skilled in the art.

[0574] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0575] The siRNA, siRNA modifications, and siRNA conjugates involved in the following examples were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd. The cells and reagents used in the examples are shown in Table 4:

[0576] Table 4

[0577]

[0578]

[0579] Example 1: Synthesis of siRNA

[0580] 1.1 siRNA sequence design

[0581] Based on the human SMAD2 gene mRNA sequence, multiple pairs of SMAD2 siRNAs were designed at different sites. All designed single siRNAs can target all transcripts of the target gene (as shown in Table 5). These multiple pairs of siRNAs have the lowest homology with all other non-target gene sequences after alignment by sequence similarity software.

[0582] Table 5

[0583] Target Gene Species Gene ID NM_ID SMAD2 Homo sapiens 4087 NM_005901.6

[0584] The target sequence for designing siRNA is as follows, and the target sequence is derived from the gene mRNA sequence of SMAD2 (see NM_005901.6). For the purpose of convenient comparison, the following target sequence is represented by the DNA sequence corresponding to the mRNA. In the synthesis process of the present embodiment, for the situation of adding ribonucleotides, the corresponding position of T is uracil ribonucleotide U or modified U.

[0585] Target sequence I:

[0586] GGTGTGAGAAAGCAGTGAA(SEQ ID NO:1)

[0587] Target sequence II:

[0588] GACGATTAGATGAGCTTGA(SEQ ID NO:2)

[0589] Target sequence III:

[0590] ATGTGTTACCATACCAAGCACTTGC(SEQ ID NO:3)

[0591] Target sequence IV:

[0592] CCAAATACGATAGATCAGT(SEQ ID NO:4)

[0593] Target sequence V:

[0594] AGGTCTCTTGATGGTCGTCTCCAGG(SEQ ID NO:5)

[0595] Target sequence VI:

[0596] GGCCTGATCTTCACAGTCATCATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAA(SEQ ID NO:6)

[0597] Target sequence VI-1:

[0598] GGCCTGATCTTCACAGTCAT(SEQ ID NO:21)

[0599] Target sequence VI-2:

[0600] CATCATGAACTCAAGGCAATT(SEQ ID NO:22)

[0601] Target sequence VI-3:

[0602] ATGAACTCAAGGCAATTGAAAACTGC(SEQ ID NO:23)

[0603] Target sequence VI-4:

[0604] AAGGCAATTGAAAACTGCGAATATGCTTTTAAT(SEQ ID NO:24)

[0605] Target sequence VI-5:

[0606] GGCCTGATCTTCACAGTCATCATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAAT(SEQ IDNO:728)

[0607] Target sequence VI-A: (SEQ ID NO: 729)

[0608] ACTGCGAATATGCTTTTAATCTTAAAAA

[0609] Target sequence VI-A1: (SEQ ID NO: 730)

[0610] AAACTGCGAATATGCTTTTAATCTTAAAAA

[0611] Target sequence VI-A2: (SEQ ID NO: 731)

[0612] GAAAACTGCGAATATGCTTTTAATCT

[0613] Target sequence VII:

[0614] ACCCTTACCACTATCAGAGAGTTGAGACACCAGTTTT(SEQ ID NO:7)

[0615] Target sequence VII-1:

[0616] ACCCTTACCACTATCAGAGAGTTGAGA(SEQ ID NO:25)

[0617] Target sequence VII-2:

[0618] GAGTTGAGACACCAGTTTT(SEQ ID NO:26)

[0619] Target sequence VIII:

[0620] CCCGACACACCGAGATCCTAACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCC(SEQ IDNO:8)

[0621] Target sequence VIII-1:

[0622] CCCGACACACCGAGATCCTAACAGAACTT(SEQ ID NO:27)

[0623] Target sequence VIII-2:

[0624] CTCTGGATGACTATACTCACTCCATTCC(SEQ ID NO:28)

[0625] Target sequence IX:

[0626] GCAGGAATTGAGCCACAGAGTAATTA(SEQ ID NO:9)

[0627] Target sequence X:

[0628] CTCCTGGATATATCAGTGA(SEQ ID NO:10)

[0629] Target sequence XI:

[0630] TGACCAACAGTTGAATCAAA(SEQ ID NO:11)

[0631] Target sequence XII:

[0632] CAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACT CAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAA

[0633] (SEQ ID NO:12)

[0634] Target sequence XII-1:

[0635] CAGAACTATCTCCTACTACTCTTTCC(SEQ ID NO:29)

[0636] Target sequence XII-2:

[0637] CTGTTAATCATAGCTTGGA(SEQ ID NO:30)

[0638] Target sequence XII-3:

[0639] TAGCTTGGATTTACAGCCAGTTACTTAC(SEQ ID NO:31)

[0640] Target sequence XII-4:

[0641] CAGTTACTTACTCAGAACCTGCATTTT(SEQ ID NO:32)

[0642] Target sequence XII-5:

[0643] AACCTGCATTTTGGTGTCGATAGCATA(SEQ ID NO:33)

[0644] Target sequence XII-6:

[0645] TTGGTGTTCGATAGCATATTATGAATTAAA(SEQ ID NO:34)

[0646] Target sequence XIII:

[0647] CTCACTGTAGATGGCTTTA(SEQ ID NO:13)

[0648] Target sequence XIV:

[0649] TGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAATGACAAGA (SEQ ID NO: 14) Target sequence XIV-1:

[0650] TGCTTAGGTTTACTCTCCAATGTTAACCGAAAT(SEQ ID NO:35)

[0651] Target sequence XIV-2:

[0652] CACGGTAGAAATGACAAGA(SEQ ID NO:36)

[0653] Target sequence XV:

[0654] CATAGGTGGGGAAGTTTTTGCTGAGTGCCTAAGTGATAGTGCAATCTTTGTGCAGAGCCCCAATTGTAAT(SEQ ID NO:15)

[0655] Target sequence XV-1:

[0656] CATAGGTGGGGAAGTTTTTGCTGAGTGCTAAGTGATAG(SEQ ID NO:37)

[0657] Target sequence XV-2:

[0658] GCAGAGCCCCAATTGTAAT(SEQ ID NO:38)

[0659] Target sequence XVI:

[0660] CTGCAACAGTGTGTAAAAT(SEQ ID NO:16)

[0661] Target sequence XVII:

[0662] CTTCAACAACCAGGAATTT(SEQ ID NO:17)

[0663] Target sequence XVIII:

[0664] ATCAGGGTTTTGAAGCCGTCTATCAGCTAACTAGAATGTGCACCATAAGAATGAGTTTTGT(SEQ IDNO:18)

[0665] Target sequence XVIII-1:

[0666] ATCAGGGTTTTGAAGCCGTCTATCAGC(SEQ ID NO:39)

[0667] Target sequence XVIII-2:

[0668] GTCTATCAGCTAACTAGAA(SEQ ID NO:40)

[0669] Target sequence XVIII-3:

[0670] ATGTGCACCATAAGAATGAGTTTTGT(SEQ ID NO:41)

[0671] Target sequence XIX:

[0672] AACAAGTACTCCTTGCTGGATTGAACTTCATCTGAATGGACCTCTACAGTGGTTGGACAAAGTATTAAC(SEQ ID NO:19)

[0673] Target sequence XIX-1:

[0674] AACAAGTACTCCTTGCTGGATTGAACTTCATCT(SEQ ID NO:42)

[0675] Target sequence XIX-2:

[0676] CTCTACAGTGGTTGGACAAAGTATTAAC(SEQ ID NO:43)

[0677] Target sequence XX:

[0678] TTCAGTGCGTTGCTCAAGCATGTCATAA(SEQ ID NO:20)

[0679] 1.2 Description of synthesis method:

[0680] Through the solid phase phosphoramidite method, nucleoside monomers are connected one by one from the 3'-5' direction according to the order of nucleotide arrangement. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, oxidation or sulfurization and capping. Among them, when two nucleotides are connected by phosphate ester, the connection of the next nucleoside monomer includes four steps of deprotection, coupling, oxidation and capping. When two nucleotides are connected by phosphorothioate diester bond, the connection of the next nucleoside monomer includes four steps of deprotection, coupling, sulfurization and capping.

[0681] 1.3 The synthesis conditions are given as follows:

[0682] The nucleoside monomer was provided in a 0.1 M acetonitrile solution. The conditions of the deprotection reaction in each step were the same, namely, the temperature was 25° C., the reaction time was 70 seconds, the deprotection reagent was a dichloroacetic acid solution in dichloromethane (3% V / V), and the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid phase carrier was 5:1.

[0683] The coupling reaction conditions for each step were the same, including a temperature of 25° C., a molar ratio of the nucleic acid sequence connected to the solid support to the nucleoside monomer of 1:10, a molar ratio of the nucleic acid sequence connected to the solid support to the coupling reagent of 1:65, a reaction time of 600 seconds, and a coupling reagent of 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole.

[0684] The oxidation reaction conditions in each step were the same, including a temperature of 25°C, a reaction time of 15 seconds, and an oxidizing agent of 0.05 M iodine water. The molar ratio of iodine to the nucleic acid sequence connected to the solid phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran: water: pyridine = 3:1:1.

[0685] The conditions of each step of the sulfurization reaction are the same, including a temperature of 25°C, a reaction time of 300 seconds, and a sulfurization reagent of hydrogenated xanthan. The molar ratio of the sulfurization reagent to the nucleic acid sequence connected to the solid phase support in the coupling step is 120:1. The reaction is carried out in a mixed solvent of acetonitrile:pyridine=1:1.

[0686] The capping conditions for each step were the same, including a temperature of 25°C and a reaction time of 15 seconds. The capping reagent solution was a mixed solution of CapA and CapB in a molar ratio of 1:1 (i.e., CapA: 20% (v / v) acetic anhydride acetonitrile solution, CapB: a solution of N-methylimidazole / pyridine / acetonitrile in a volume ratio of 20:30:50), and the molar ratio of the capping reagent to the nucleic acid sequence connected to the solid phase carrier was acetic anhydride: N-methylimidazole: nucleic acid sequence connected to the solid phase carrier = 1:1:1.

[0687] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and the antisense chain; finally, the two chains are heated and annealed to obtain the product, and freeze-dried to obtain freeze-dried powder.

[0688] In Example 1, modified or unmodified 3'-nucleoside phosphoramidite monomers were used for synthesis in a 3'-5' manner, so the nucleotides at the 5' ends of the obtained sense strand and antisense strand all had a hydroxyl group on the ribose group instead of a phosphate group. In addition, for the case where the nucleotide at the 5' end has a 5' phosphate group or a 5' phosphate derivative group, it can be obtained using a specific 3'-nucleoside phosphoramidite monomer according to the specific siRNA, such as the case with a 5'-phosphate group or 5' EVP.

[0689] The synthesized siRNAs are shown in Table 1, Table 1-1 and Table 1-2, and the synthesized siRNA modifications are shown in Table 2.

[0690] Example 2: Synthesis of siRNA conjugate (GalNAc-siRNA)

[0691] 2.1 The siRNA conjugate has the structure shown in the following formula II:

[0692]

[0693] 2.2 Synthesis of siRNA conjugates

[0694] In the first step, DMTr-L96 and succinic anhydride are reacted to obtain compound L96-A:

[0695]

[0696] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine and diisopropylethylamine were added to dichloromethane, stirred at 25°C for 24 hours, and then the reaction solution was washed with 0.5M triethylamine phosphate, the aqueous phase was washed three times with dichloromethane, and the organic phases were combined and evaporated to dryness under reduced pressure to obtain a crude product. Then, column chromatography was used for purification to obtain pure L96-A.

[0697] In the second step, L96-A is reacted with NH2-SPS to obtain L96-B:

[0698]

[0699] Preparation process: L96-A, O-benzotriazole-tetramethyluronium hexafluorophosphate (HBTU) and diisopropylethylamine (DIPEA) are mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to obtain a uniform solution, aminomethyl resin (NH2-SPS, 100-200 mesh) is added to the reaction liquid, and the shaking reaction is started at 25°C. After 18 hours of reaction, the filter cake is filtered and washed with dichloromethane and acetonitrile in turn to obtain a filter cake. The obtained filter cake is capped with a CapA / CapB mixed solution to obtain L96-B, which is a solid phase carrier containing a conjugate molecule, and then the nucleoside monomer is connected to the conjugate molecule under a coupling reaction, and then the siRNA sense chain connected to the conjugate molecule is synthesized according to the siRNA molecule synthesis method described above, and the siRNA antisense chain is synthesized using the siRNA molecule synthesis method described above, and annealing is performed to generate the siRNA conjugate of this application.

[0700] The synthesized siRNA conjugates are shown in Table 3.

[0701] Example 3: siRNA and siRNA modifications inhibit SMAD2 gene expression

[0702] 3.1 Experimental Materials:

[0703] HepG2 cells were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences, catalog number SCSP-510;

[0704] RNA extraction kit, catalog number QIAGEN-74106;

[0705] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;

[0706] MEM medium, purchased from Gibco, catalog number 41090036;

[0707] Reverse transcription kit ( Ⅲ1st Strand cDNA Synthesis Kit (+gDNA wiper), purchased from Vazyme, catalog number R312-02;

[0708] TaqMan TM Gene expression master mix, purchased from Applied Biosystems, catalog number 4369016;

[0709] Opti-MEM: purchased from Gibco, catalog number 31985070;

[0710] Target SMAD2 primer and probe set, purchased from Thermo, Hs00998187_m1;

[0711] TaqMan Gene Expression Assay (GAPDH), purchased from Thermo, ID-Hs99999905_m1.

[0712] 3.2 Experimental methods:

[0713] 3.2.1 HepG2 cells were plated in fresh MEM medium in a 96-well plate and cultured for 24 hours. The cultured cells were resuspended in MEM medium without PS (penicillin-streptomycin mixture) to a density of 1.11×10 5 / mL of cell suspension was plated into a 96-well plate, and 90 μL of cell suspension was added to each well, i.e., 10,000 cells / well.

[0714] 3.2.2 Dry powders of the siRNA to be tested and siRNA modifications (collectively referred to as siRNA in the experimental process of this example for ease of description) were centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0715] 3.2.3 Preparation of 2 nM siRNA diluent W and 20 nM siRNA diluent Z

[0716] (1) Preparation of 1 μM siRNA stock solution Q and 0.1 μM siRNA stock solution E:

[0717] a Take 2 μL of the 100 μM siRNA stock solution prepared in step 3.2.2 above, add 18 μL of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 10 μM;

[0718] b. Take 2 μL of the 10 μM siRNA dilution prepared in step a), add 18 μL of ultrapure distilled water to obtain a 1 μM siRNA stock solution Q;

[0719] c. Take 2 μL of the 1 μM siRNA dilution prepared in step b), add 18 μL of ultrapure distilled water to obtain a siRNA stock solution E with a final concentration of 0.1 μM;

[0720] (2) Take 2 μL of the prepared siRNA stock solution E and add 98 μL of Opti-MEM to obtain 2 nM siRNA dilution solution W; take 2 μL of the prepared siRNA stock solution Q and add 98 μL of Opti-MEM to obtain 20 nM siRNA dilution solution Z.

[0721] 3.2.4 Transfection of HepG2 cells

[0722] (1) Take 3 μL RNAiMAX transfection reagent was added to 97 μL Opti-MEM to obtain RNAiMAX transfection reagent diluent; RNAiMAX transfection reagent diluent was mixed with the 20 nM siRNA diluent Z prepared in step (2) of 3.2.3 above at a volume ratio of 1:1, allowed to stand for 5 minutes, and 10 μL of the transfection mixture was added to a 96-well plate to transfect the cultured HepG2 cells (final volume 100 μL, siRNA concentration in this system was 1 nM).

[0723] (2) Take 3 μL RNAiMAX transfection reagent was added to 97 μL Opti-MEM to obtain RNAiMAX transfection reagent diluent; The RNAiMAX transfection reagent diluent was mixed with the 2 nM siRNA diluent W prepared in step (2) of 3.2.3 above at a volume ratio of 1:1, allowed to stand for 5 minutes, and 10 μL of the transfection mixture was added to a 96-well plate to transfect the cultured HepG2 cells (final volume 100 μL, siRNA concentration in this system was 0.1 nM).

[0724] 3.2.5 Culture the cells for 24 hours after transfection, and set up 2 replicates for each concentration (0.1 nM, 1 nM).

[0725] 3.2.6 Extract total RNA using RNA extraction kit (QIAGEN-74106):

[0726] a) Aspirate the old culture medium in each well and add 100 μL PBS buffer to wash twice;

[0727] b) Aspirate the PBS buffer and add 50 μL of lysis buffer to each well;

[0728] c) incubate at room temperature with shaking at 500 rpm for 5 minutes;

[0729] d) Add 5 μL of stop solution to each well and shake at 500 rpm for 2 minutes at room temperature.

[0730] 3.2.7 Use a reverse transcription kit to reverse transcribe the extracted total RNA into cDNA, following the steps below:

[0731] a) Remove gDNA using gDNA enzyme according to the table below;

[0732] Table 6

[0733] Volume / μL 5×gDNABuffer 2 Sample(RNA) 8

[0734] 42°C, 2 min;

[0735] b) Add the following reagents to the system obtained in step a) and perform reverse transcription procedure

[0736] Table 7

[0737] Volume / μL The mixed solution obtained in step a) 10 10×RT Mix 2 HiScriptⅢEnzyme Mix 2 <![CDATA[Oligo(dT) 20 VN]]> 1 Random hexamers 1 <![CDATA[RNase-free ddH2O]]> ...

Claims

1. A double-stranded ribonucleic acid or a modified product thereof, or a conjugate thereof, wherein the double-stranded ribonucleic acid comprises a sense strand and an antisense strand, wherein the sense strand is reversely complementary to the antisense strand and / or substantially reversely complementary to form a double-stranded region of the double-stranded ribonucleic acid; in, The sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence; The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 20.

2. The double-stranded RNA or its modified product, or its conjugate according to claim 1, wherein: The target sequence is selected from the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731, the positive strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731.

3. The double-stranded RNA or a modified product thereof, or a conjugate thereof according to claim 1 or 2, wherein: The sense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides; or, the antisense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

4. The double-stranded RNA or its modified product, or its conjugate according to claim 3, wherein: The nucleotide sequence of the sense strand is / comprises a sequence A that differs by no more than 1 nucleotide compared to 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731, preferably 18-25 consecutive nucleotides, more preferably 18-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides; Preferably, the nucleotide sequence of the sense strand is / comprises a sequence A consisting of 15-28 consecutive nucleotides, preferably 18-25 consecutive nucleotides, more preferably 18-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides, of the nucleotide sequence shown in any one of SEQ ID NOs: 1-5, 9-11, 13, 16-17, 20, 21-43 or 728-731; Alternatively, the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide compared to the reverse complement and / or substantially reverse complement of a sequence consisting of 15 to 28 consecutive nucleotides, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 9 to 11, 13, 16 to 17, 20, 21 to 43 or 728 to 731.

5. The double-stranded RNA or its modified product, or its conjugate according to any one of claims 1 to 4, wherein: The length of the double-stranded region is 15-25 nucleotides, preferably 18-23 nucleotides, more preferably 18-21 nucleotides, more preferably 19, 21 or 23 nucleotides; Preferably, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or, The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or, The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.

6. The double-stranded RNA or its modified product, or its conjugate according to any one of claims 1 to 5, wherein: Along the direction from the 5' end to the 3' end, 3-5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in the sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Preferably, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8 and 9 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 8, 9 and 10 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 8, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 7, 11, 12 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 3, 7, 11, 16 and 17 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the 9th, 11th, 12th and 13th ribonucleotides in sequence A of the sense strand are 2'-F modified ribonucleotides, and the remaining ribonucleotides in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 9, 11 and 13 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotide at any odd position in the sequence B of the antisense strand is a 2'-O-CH3 modified ribonucleotide, and the ribonucleotide at any even position in the sequence B of the antisense strand is a 2'-F modified ribonucleotide; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides, Optionally, in the direction from the 5' end to the 3' end, the sense strand comprises a phosphorothioate diester bond located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; and / or Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand; or, The sense strand contains phosphorothioate diester bonds located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; and / or Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand, Optionally, in the direction from the 5' end to the 3' end, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group. Alternatively, the antisense strand comprises a phosphorothioate diester bond located at the position shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; and / or The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

7. The double-stranded RNA or its modified product, or its conjugate according to any one of claims 1 to 6, wherein: The positive strand of the double-stranded RNA modification has the following characteristics: (a1)-(a 38 ) any structure shown in: <h2 style=";text-align:left;direction:ltr">(a1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3'; <h2 style=";text-align:left;direction:ltr">(a2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a3)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a4)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a5)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a6)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a7)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a8)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a9)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 20 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’; (a 21 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 24 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’; (a 25 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 29 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 30 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -3’; (a 31 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; (a 32 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -3’; (a 33 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3’; (a 34 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-N 17 f-mN 18 -mN 19 -3’; (a 35 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3’; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 36 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 37 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 38 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; Among them, N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G, The letter combination dT represents a deoxyribonucleotide whose base is thymine. The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide. The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide. -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond. Optionally, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group; or, The antisense strand of the double-stranded RNA modification has the following characteristics: (b1)-(b 37 ) any structure shown in: (b1)5’-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-dT-(s)-dT-3’, <h2 style=";text-align:left;direction:ltr">(b2)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b3)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b4)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b5)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b6)5'-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-N<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> f-(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b7)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-N4f-mN5-N6f-mN7-N8f-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-N<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> f-(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 24 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 25 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 29 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 30 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', (b 31 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’, (b 32 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’, <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 33 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 34 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 35 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', (b 36 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’, (b 37 )5'-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3'; where N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G, The letter combination dT represents a deoxyribonucleotide whose base is thymine. The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide. The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide. P1 means that the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide. EVP means that the nucleotide adjacent to the right of the letter combination is a 5'-trans vinylphosphonate nucleotide. -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond. [GNA] indicates that the adjacent ribonucleotide on the right is a ribonucleotide modified with GNA. Optionally, the 5' terminal nucleotide of the antisense strand does not have P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

8. The double-stranded RNA or its modified product, or its conjugate according to any one of claims 1 to 7, wherein: The conjugated group has the structure shown below: wherein the conjugated group is connected to the 3' end of the sense strand; Preferably, the conjugated group is conjugated to the 3' end of the sense strand via a phosphodiester bond; Preferably, the sense strand and the antisense strand of the conjugate are complementary to each other to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region; or, The sense strand and the antisense strand of the conjugate are at least partially complementary to each other to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, while the 3' end of the antisense strand forms a blunt end.

9. A pharmaceutical composition, wherein: The pharmaceutical composition comprises the double-stranded ribonucleic acid, its modification, or its conjugate according to any one of claims 1 to 8 and optionally one or more pharmaceutically acceptable carriers.

10. Use of the double-stranded ribonucleic acid according to any one of claims 1 to 8, its modified substance, or their conjugate, or the pharmaceutical composition according to claim 9 in at least one of the following: (1) Inhibiting SMAD2 gene expression, or preparing a drug for inhibiting SMAD2 gene expression; (2) for preventing or treating diseases associated with abnormal expression of the SMAD2 gene, or for preparing drugs for preventing or treating diseases associated with abnormal expression of the SMAD2 gene; (3) for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SMAD2 gene expression, Preferably, the disease associated with abnormal expression of the SMAD2 gene is selected from the group consisting of the following diseases: Fatty liver disease, nonalcoholic steatohepatitis, cirrhosis, liver fibrosis, pulmonary fibrosis, vascular fibrosis, glomerular sclerosis and interstitial fibrosis, osteoarthritis, cancer, inflammatory diseases, parasitic diseases, autoimmune leukoproliferative diseases, colorectal cancer, and other related conditions, pathologies or syndromes not yet identified.

Images