Application of NF2 gene / protein as target spot in preparation of medicine for preventing or treating influenza A and B virus infection

Abstract

The invention relates to application of NF2 gene / protein as a target spot in preparation of a medicine for preventing or treating influenza A and B virus infection, and belongs to the technical field of biological genetic engineering. In order to solve the problem that common targets of influenza A and B viruses and drugs capable of effectively inhibiting influenza A and B infection at the same time are lacked in the prior art, the invention provides application of the NF2 gene / protein as a target in preparation of drugs for preventing or treating influenza A and B virus infection. CRISPR (clustered regularly interspaced short palindromic repeats) Screen is used for screening to obtain a common new target NF2 gene / protein for infection and invasion of influenza A virus and influenza B virus in a human host cell, and the new target NF2 gene / protein can be applied to preparation of an expression inhibitor and inhibition of replication of influenza A virus and influenza B virus; the invention also can be applied to preparation of NF2 gene expression synergists, and preparation of replication synergists or vaccine production synergists of influenza A and B viruses.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological gene engineering, and specifically relates to the application of NF2 gene / protein as a target in the preparation of drugs for preventing or treating influenza A and B virus infections. Background Art

[0002] Influenza is an acute respiratory infection caused by influenza viruses, which can cause seasonal epidemics or occasional pandemics. Seasonal influenza viruses evolve to evade host immunity, leading to repeated global epidemics. Among them, influenza A and B viruses belong to the family Orthomyxoviridae; influenza A virus (WSN) can infect humans and a variety of animals, and multiple subtypes of influenza A viruses have high pathogenicity and / or high mortality, seriously threatening the health of animals and humans; influenza B virus (Yamagata) mainly infects humans. Although its pathogenicity to humans is relatively low, pneumonia caused by influenza B virus infection has a high mortality rate. In addition, since the surface protein of influenza virus is prone to antigenic variation, it can develop resistance to drugs that target the surface protein of influenza virus. Therefore, the efficacy of existing drugs against influenza A and B viruses has gradually decreased, and the treatment effect is not ideal.

[0003] The CRISPR (Clustered regularly interspaced short palindromic repeat) system is an adaptive immune defense system from bacteria. CRISPR Screen technology uses the effectiveness and flexibility of the CRISPR Cas gene editing system and has become a very effective tool widely used in biological discoveries.

[0004] Currently, the existing technologies mainly explore the host factors of a single type of influenza virus, but the common targets of multiple different subtypes of influenza viruses have not yet been found. Specifically, there is a lack of common targets for influenza A and B viruses, as well as drugs that can effectively inhibit the replication of influenza A and B viruses at the same time.

[0005] NF2 (MERLIN tumor suppressor) gene / protein is involved in the regulation of cell proliferation and plays a role in cell-cell adhesion and transmembrane signal transduction. It has been shown that NF2 gene / protein interacts with cell surface proteins, proteins involved in cytoskeleton dynamics, and proteins involved in regulating ion transport. However, there are no research reports on whether NF2 gene / protein affects influenza virus infection. Summary of the invention

[0006] The present invention solves the problem that the prior art lacks a common target for influenza A and B viruses, and a drug that can effectively inhibit influenza A and B infections at the same time, and provides an application of NF2 gene / protein as a target in the preparation of a drug for preventing or treating influenza A and B virus infections.

[0007] One of the purposes of the present invention is to provide the use of NF2 gene / protein as a target in the preparation of a drug for preventing or treating influenza A and B virus infections. The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.1.

[0008] In a preferred embodiment of the present invention, the drug for preventing or treating influenza virus infection of type A and type B has at least one of the following functions: inhibiting the adsorption of influenza viruses of type A and type B, inhibiting the growth or proliferation of influenza viruses of type A and type B, inhibiting the invasion of influenza viruses of type A and type B, and inhibiting the expression of influenza virus receptors of type A and type B.

[0009] The second object of the present invention is to provide an application of an NF2 gene / protein expression inhibitor in the preparation of a drug for preventing or treating influenza A and B virus infections. The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.1.

[0010] In a preferred embodiment of the present invention, the NF2 gene / protein expression inhibitor targets the NF2 gene and inhibits or silences the expression of the NF2 gene.

[0011] In a preferred embodiment of the present invention, the NF2 gene / protein expression inhibitor is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, a gene editing vector or a lentivirus.

[0012] The third object of the present invention is to provide an application of an NF2 gene / protein expression enhancer in the preparation of a replication enhancer or a vaccine production enhancer for type A and type B influenza viruses, wherein the nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.1.

[0013] In a preferred embodiment of the present invention, the replication enhancer or production enhancer targets the NF2 gene and promotes the expression of the NF2 gene.

[0014] In a preferred embodiment of the present invention, the QPCR primers for the NF2 gene are:

[0015] F: TACAACAATCAAGGACACAGT, SEQ ID NO.2;

[0016] R: CTCTTCAGCATTCTCAGGAT, SEQ ID NO. 3.

[0017] Beneficial effects of the present invention: The present invention provides the use of NF2 gene / protein as a target in the preparation of drugs for preventing or treating influenza A and B virus infections.

[0018] A human genomic gene knockout library was constructed using CRISPR Screen preparation technology, and a large number of gene mutation cells were obtained. By infecting the mutant cells with influenza A virus (WSN) and influenza B virus (Yamagata), we finally prepared the key common new target NF2 gene / protein that can simultaneously affect the infection and invasion of influenza A and B viruses in human host cells.

[0019] The present invention has proved through expression detection at the protein level and the mRNA level that the NF2 gene / protein, a common new target of type A and type B influenza viruses provided by the present invention, can be used to prepare a drug for preventing or treating type A and type B influenza virus infections. The drug for preventing or treating type A and type B influenza virus infections has at least one of the following functions: inhibiting the adsorption of type A and type B influenza viruses, inhibiting the growth or proliferation of type A and type B influenza viruses, inhibiting the invasion of type A and type B influenza viruses, and inhibiting the expression of type A and type B influenza virus receptors.

[0020] The new target NF2 gene / protein common to type A and type B influenza viruses provided by the present invention achieves the purpose of preventing and controlling the spread of different subtypes of influenza viruses, and provides a reliable research foundation and theoretical basis for the development and preparation of universal influenza vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a graph showing the Cas9 expression detection of the A549 cell line in Example 1;

[0022] Figure 2 : is the expression graph of NF2 gene mRNA level in Example 4; the ordinate Relative mRNA expression of NF2 is the relative mRNA expression of NF2, CTRL is the control group, influenza A is influenza A, and influenza B is influenza B. DETAILED DESCRIPTION

[0023] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0024] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. The test methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0025] Example 1: Construction of a human A549 cell line with stable expression of Cas9

[0026] The human A549 cell line was infected with Cas9 lentivirus, and the ratio of virus added to cell number was 50:1, that is, the virus titer was 1×10 8 2×10 cells were infected with Cas9 lentivirus at TU / mL 6 A549 cell line; after 12 hours, the culture medium was changed to complete culture medium, and the culture was continued for 48 hours, and Hygromycin antibiotics were added for drug preparation. The concentration of Hygromycin antibiotics was 600 μg / mL, and after preparation, A549 cell lines infected with Cas9 were obtained.

[0027] In this example, the A549 cell line obtained above was tested for Cas9 expression. Figure 1 As shown, it was shown that the human A549 cell line stably expressing Cas9 was successfully constructed.

[0028] Example 2: Construction of a mutant cell library for human A549 cell line stably expressing Cas9

[0029] The guide RNA library plasmid (Addgene, Pooled Library #73179) for targeted knockout of 19114 human genes was used to infect the human A549 cell line stably expressing Cas9 obtained in S1 through a lentiviral system to obtain a mutant cell library for targeted knockout of the human genome. Four gRNAs were set for each gene, and the mutant cell library plasmid contained 76441 gRNAs.

[0030] The specific steps include:

[0031] S1: Packaging lentiviral particles on 293T cells, wherein the mixing mass ratio of library plasmid (gRNA pooled library inlentiCRISPRv2): packaging plasmid PAX2: envelope plasmid VSVG is 13:5:2, transfection reagent Lipo3000 (L3000015, Thermofisher) and plasmid are mixed at a volume mass ratio of 3:1, complete culture medium is replaced after 6 hours, and culture is continued for 72 hours, and the supernatant containing lentiviral particles is collected and concentrated, and the supernatant is removed by ultrahigh-speed centrifugation for concentration, and the concentrated suspension containing lentiviral particles is obtained after the culture medium is resuspended;

[0032] S2: The suspension containing lentiviral particles obtained in S1 was used to infect the human A549 cell line stably expressing Cas9 obtained in Example 1 to obtain infected A549-Cas9 cells, and the A549-Cas9 cells were cultured to the logarithmic growth phase and counted. 6×10 7 The A549-Cas9 cells were infected with the virus, and the multiplicity of infection (MOI) of the virus-infected cells was 0.5, that is, the amount of virus was 3×10 7 TU, complete medium was replaced 12 h after infection and culture continued;

[0033] S3: 48 hours after the virus infection described in S2, an effective concentration of puromycin (ST551, Beyotime) was added for drug preparation. The concentration of puromycin added was 5-6 μg / mL according to the sensitivity of A549 cells to prepare cells infected with the virus containing the knockout library. The culture medium was replaced every 2 days to obtain A549-Cas9 cells infected with the virus containing the knockout library;

[0034] S4: The A549-Cas9 cells infected with the virus containing the knockout library obtained in S3 were amplified and cultured, and then the above cells were divided into 3 groups, namely, a control group, an experimental group infected with influenza A virus (Flu A, specifically WSN), and an experimental group infected with influenza B virus (Flu B, specifically Yamagata). The culture medium was replaced 12 hours after infection and culture was continued.

[0035] Example 3: Extraction and sequencing of genomic DNA

[0036] S1: In a 15 mL centrifuge tube, 6 mL of NK lysis buffer (50 mM Tris, 50 mM EDTA, 1% SDS, pH=8) and 30 μL of 20 mg / mL proteinase K (QIAGEN 19131) were added to each group of cell samples (the cell samples were the control group, the experimental group infected with influenza A virus, and the experimental group infected with influenza B virus described in Example 2), and incubated at 55° C. overnight to obtain a lysed sample;

[0037] S2: The next day, 30 μL of RNase A (QIAGEN 19101) was added to each group of lysed samples obtained in S1, inverted 25 times, and incubated at 37°C for 30 min;

[0038] S3: The lysed samples of each group obtained in S2 were placed on ice for cooling, and then 2 mL of pre-cooled 7.5 M ammonium acetate (Sigma A1542) was added to precipitate the protein. After adding ammonium acetate, the sample was vortexed at high speed for 20 seconds, and then centrifuged at 4000×g for 10 minutes; 6 mL of 100% isopropanol was added, inverted and mixed 50 times, and centrifuged at 4000×g for 10 minutes. At this time, genomic DNA was visible in the tube as small white particles; after discarding the supernatant, 6 mL of freshly prepared 70% ethanol was added, the tube was inverted 10 times, and centrifuged at 4000×g for 1 minute; the supernatant was poured out and the remaining ethanol was aspirated with a pipette; after air drying for 10-30 minutes, when the DNA changed from white particles to slightly translucent, 500 μL of 1x TE buffer (Sigma T9285), incubated at 65°C for 1 h, and incubated at room temperature overnight to fully dissolve the DNA, and obtained the sample DNA of the control group, the experimental group infected with influenza A virus, and the experimental group infected with influenza B virus in Example 2, respectively, referred to as the control group, A549-Cas9Library+Flu A, and A549-Cas9 Library+Flu B, respectively.

[0039] In this example, the above groups of DNA samples were shaken and centrifuged the next day, and the genomic DNA concentration was measured using Nanodrop. The samples were sent to Anno Biotech for next-generation sequencing. The sequencing results were analyzed to obtain the common target NF2 gene that can affect influenza A and B virus infection. The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.1.

[0040] Example 4: Use of NF2 gene as a target in the preparation of drugs for preventing or treating influenza A and B virus infections

[0041] In this example, the A549 cell line obtained in Example 1 was infected with a representative strain of influenza A virus (WSN) and a representative strain of influenza B virus Yamagata B / Yamagata / 16 / 1988 (BYam), all of which were from the Institute of Microbiology, Chinese Academy of Sciences, and the infection time was 12 hours; the uninfected A549 cell line was used as a control group (CTRL), and the control group, the influenza A infection experimental group, and the influenza B infection experimental group were subjected to fluorescence quantitative qPCR detection.

[0042] In this example, RNA was extracted from cells in the control group, the experimental group infected with influenza A, and the experimental group infected with influenza B according to the instructions of the RNA extraction kit (19211ES60, Yeasen Company), and the RNA was reverse transcribed into cDNA using a reverse transcription kit (AU341-02, Quanshijin Company). The reverse transcription program was: 55°C-5min, 85°C-2min, 4°C-∞; after the reverse transcription was completed, the reaction tube was placed on ice to prepare a fluorescent quantitative qPCR reaction system, and the fluorescent quantitative qPCR reaction system was: 5 μL SYBR (SYBR enzyme AQ601-01-V2, Quanshijin Company), 0.3 μL upstream primer (10 μM), 0.3 μL downstream primer (10 μM), DEPC water was supplemented to 10 μL, and the fluorescence quantitative qPCR reaction program was: 95°C-2 min, 95°C-5s, 57°C-30s, 72°C-30s, 95°C-30s, 65°C-5s, 95°C-15s, for a total of 40 cycles; the primer sequences used for NF2 gene expression detection are shown in SEQ ID NO.2 and SEQ ID NO.3, and the primer sequences used for reference gene GAPDH expression detection are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0043] The results are as follows Figure 2 As shown, compared with the mRNA expression level of NF2 gene in the control group, the mRNA expression level of NF2 gene in the cells of the experimental group infected with influenza A and the experimental group infected with influenza B were significantly increased; thus, the NF2 gene plays an important role in the process of cell infection with influenza A and B viruses, among which, the decrease in the mRNA expression level of NF2 gene helps to inhibit the replication of influenza A and B viruses, thereby preventing or treating influenza A and B virus infections.

[0044] In summary, the present invention has verified through expression detection at the mRNA level that the NF2 gene / protein provided by the present invention can be used as a target for both type A and type B influenza viruses. The novel target NF2 gene / protein can inhibit type A and type B influenza viruses from infecting host cells, as well as their survival and replication in host cells.

[0045] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. Use of NF2 gene / protein as a target in the preparation of a drug for preventing or treating influenza A and B virus infections, characterized in that: The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug for preventing or treating influenza virus infection of type A and type B has at least one of the following functions: inhibiting the adsorption of influenza viruses of type A and type B, inhibiting the growth or proliferation of influenza viruses of type A and type B, inhibiting the invasion of influenza viruses of type A and type B, and inhibiting the expression of influenza virus receptors of type A and type B.

3. Use of an inhibitor of NF2 gene / protein expression in the preparation of a drug for preventing or treating influenza A and B virus infections, characterized in that: The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The NF2 gene / protein expression inhibitor targets the NF2 gene and inhibits or silences the expression of the NF2 gene.

5. The use according to claim 3, characterized in that: The NF2 gene / protein expression inhibitor is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, a gene editing vector or a lentivirus.

6. Use of NF2 gene / protein expression enhancer in the preparation of influenza A and B virus replication enhancer or vaccine production enhancer, characterized in that: The nucleotide sequence of the CDS region of the NF2 gene is shown in SEQ ID NO.

1.

7. The use according to claim 6, characterized in that: The replication enhancer or production enhancer takes the NF2 gene as a target and promotes the expression of the NF2 gene.

8. The use according to claim 7, characterized in that: The QPCR primers for the NF2 gene are: F: TACACAATCAAGGACACAGT, SEQ ID NO.2; R: CTCTTCAGCATTCTCAGGAT, SEQ ID NO. 3.

Images