Method and system for establishing CNVs mutation molecular mechanism and pathogenic mechanism model

Abstract

The invention belongs to the technical field of establishment of CNVs pathogenic mechanism models, and discloses a molecular mechanism of CNVs mutation and an establishment method of a CNVs pathogenic mechanism model.Deafness predeaf people CNVs are taken as an entry point, common CNVs in Chinese people with normal hearing are combined, and through establishment of researched deafness gene CNVs characteristics, mutation mechanism and pathogenic mechanism models, the molecular mechanism of CNVs mutation and the establishment method of the CNVs pathogenic mechanism model are established. The important function and significance of the copy number variation in hereditary hearing loss are explored, and meanwhile molecular diagnosis and prevention and treatment of the copy number variation in hereditary hearing loss are guided. Summarizing hot spot positions, sequences and structural characteristics of the deafness gene CNVs; the distribution and characteristic difference between pathogenic CNVs and common CNVs polymorphisms is summarized, and molecular diagnosis of CNVs related diseases is guided; and a molecular mechanism of deafness gene CNVs mutation and a deafness gene CNVs pathogenic mechanism model are explored.

Description

Technical Field

[0001] The present invention belongs to the technical field of establishing a CNVs pathogenic mechanism model, and in particular relates to a method and system for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model. Background Art

[0002] The popularity of the second-generation sequencing technology has led to the discovery and identification of more and more pathogenic CNVs of deafness genes, thereby improving the diagnostic accuracy of CNVs. In the early stage of the present invention, high-throughput sequencing technology / second-generation sequencing technology was used to detect CNVs in deaf patients. By performing pathogenic analysis on the detected CNVs, the genetic etiology of 5.16% of the probands with hearing loss was clarified, which was helpful for the early intervention treatment of the probands. The sources of CNVs of some probands were analyzed, the characteristics of the occurrence of CNVs of hereditary deafness in China were analyzed, and the CNV spectrum of the hearing-impaired population in China was depicted. However, what is the distribution of copy number variation of the deafness gene in the normal hearing population? How does the copy number variation of the deafness gene mutate? What are the characteristics and laws? What are its pathogenic mechanisms? This series of scientific questions remain unanswered. Therefore, the key scientific problem that the present invention intends to solve is: a molecular epidemiological survey and mechanism study of copy number variation of the deafness gene in the Chinese population.

[0003] Copy number variation breakpoint (CNVB) refers to the starting and ending positions of the CNV region, that is, the boundary between the CNV and the normal copy number region. The significance of copy number variation breakpoints is that they can reflect the occurrence mechanism of CNV, affect the functional effects of CNV, reveal the association between CNV and disease, etc. The occurrence mechanism of CNV: copy number variation breakpoints can provide clues to speculate how CNV is generated. Functional effects of CNV: copy number variation breakpoints can affect the impact of CNV on gene expression and function. The association between CNV and disease: copy number variation breakpoints can help determine the causal relationship between CNV and disease. The present invention will analyze the second-generation data of pathogenic CNVs in the early stage, accurately locate the breakpoints of pathogenic CNVs of deafness genes, and then conduct bioinformatics analysis to summarize the regions and structural characteristics where copy number variation breakpoints of deafness genes are prone to occur.

[0004] The rearrangement process of the genome can be mediated by different molecular mechanisms. There are many known mutation mechanism models that can lead to CNVs, which produce CNVs with different structural and sequence characteristics. The structural characteristics of CNVs are simple CNVs and complex CNVs; the breakpoint sequence characteristics of CNVs include: microhomologous sequences, SINE / LINE, no homologous sequences and other forms. The present invention will study the mutation mechanism of genomic CNVs in the formation process of human deafness genes, and explore the role of mutation mechanism models based on DNA recombination (for example, NAHR and BIR, etc.) and DNA replication (for example, FoSTeS and MMBIR, etc.) caused by DNA damage in the formation process of genomic CNVs. The present invention uses DNA sequencing technology to determine the breakpoints of CNVs to the single base level, study its sequence characteristics, and summarize the structure of various pathogenic CNVs, the distribution pattern on the genome, mutation hotspots and other characteristics. Based on the analysis of breakpoints and structural characteristics, the contribution of different mutation mechanisms based on DNA recombination and DNA replication in CNVs is predicted. Explore the impact of the compositional characteristics of genomic repetitive sequences on non-allelic homologous recombination and explore the relationship between the special structure of the human genome and its instability.

[0005] Genome CNVs are closely related to human diseases, especially in the high incidence of birth defects. At the same time, some common CNVs in the population have important effects on human physiological functions and traits. However, the pathogenic mechanism of CNVs has not yet been clearly elucidated, and there are few related research reports. The existing molecular mechanism models of CNVs pathogenicity mainly include: gene inactivation, dosage effect, gene fusion, position effect, secondary mutation, etc. These mechanisms or hypotheses provide theoretical guidance for our research on the pathogenic mechanism after the discovery of CNVs in the deafness gene. According to the variation form of CNVs, under the theoretical guidance of mechanisms such as "gene inactivation, dosage effect, gene fusion, position effect, secondary mutation", a reasonable CNVs pathogenic mechanism hypothesis is proposed for different CNVs; with the help of gene expression analysis, gene overexpression or gene knockout in vitro cell culture and functional identification and other technical means, the CNVs pathogenic mechanism hypothesis is tested.

[0006] Hearing loss (HL) is one of the most common disabling diseases in clinical practice. About 466 million people worldwide are disabled due to deafness, accounting for about 5% of the world's population. There are 2-3 deaf or hearing-impaired patients in every 1,000 newborns. There are many genetic factors that have been found to cause NSHL, including single nucleotide variation SNP, abnormal chromosome number or structure, chromosome microdeletion, microduplication and other complex genetic mechanisms. However, as another form of genomic variation, gene copy number variations (CNVs) are also increasingly being found in polygenic genetic studies of hereditary deafness.

[0007] The existing technologies have the following major technical problems and defects in the deafness gene copy number variations (CNVs):

[0008] 1) The distribution of copy number variation of deafness genes in normal hearing population is unclear:

[0009] At present, there is a lack of in-depth research and systematic data collection on the distribution of copy number variation of deafness genes in normal hearing people. This makes it difficult for us to compare the differences in gene variation between hearing loss patients and normal people, and thus it is impossible to fully understand the role of CNVs in hereditary deafness.

[0010] 2) The characteristics and patterns of CNVs of deafness genes are unclear:

[0011] Existing studies have not systematically summarized and analyzed the characteristics and patterns of CNVs in deafness genes. This includes research on the size, location, structural characteristics, breakpoint sequence characteristics, etc. of CNVs. Without this key information, it is difficult for us to conduct in-depth discussions on the pathogenic mechanism and impact of CNVs.

[0012] 3) The mutation mechanism of CNVs in deafness genes is unclear:

[0013] There is currently a lack of in-depth understanding of how CNVs in deafness genes are generated by mutations. Although there are some known mutation mechanism models, their specific role in the formation of CNVs in deafness genes has not yet been elucidated. In addition, we also need to study the impact of the composition characteristics of genomic repeat sequences on the formation of CNVs, as well as the relationship between the special structure of the human genome and its instability.

[0014] 4) Lack of simple and feasible pathogenic mechanism model of CNVs related to deafness genes:

[0015] Most of the existing CNVs pathogenic mechanism models are complex and lack direct experimental verification. The lack of a simple and feasible pathogenic mechanism model makes it difficult for us to quickly and accurately evaluate the pathogenicity of CNVs in deafness genes. Therefore, it is necessary to develop new experimental techniques and methods to establish a more accurate and practical pathogenic mechanism model. Summary of the invention

[0016] In view of the problems existing in the prior art, the present invention provides a method for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model.

[0017] The present invention is achieved in that a method for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model comprises:

[0018] Step 1: Based on the breakpoint sequence analysis data of genomic CNVs, determine the single or multiple functional genes involved in the CNVs;

[0019] Step 2: Based on the variation forms of CNVs, a reasonable hypothesis of the pathogenic mechanism of CNVs is proposed for different CNVs under the mechanism of "gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation";

[0020] Step 3: Test the CNVS pathogenic mechanism hypothesis by gene expression analysis, gene knockout, in vitro cell culture and functional identification techniques;

[0021] Step 4: Establish a pathogenic mechanism model of CNVs related to deafness genes.

[0022] Further, the breakpoint sequence analysis data method based on genomic CNVs is as follows:

[0023] (1) Using CNVs analysis methods covering the whole genome and high-density CNVs detection methods to identify CNVs, analyze their fine structures and characteristics, and discover the complex structures of CNVs that cannot be detected by other low-resolution technologies;

[0024] (2) Based on the high-density CNVs analysis results, specific amplification of CNVs breakpoint sequences is performed, and the CNVs breakpoints are determined to the single base level using DNA sequencing technology. The breakpoint positions are estimated based on the positions of CNVs analyzed by the second-generation sequencing results, and PCR amplification primers are designed; PCR reaction solution is prepared for PCR reaction; PCR products are identified by 1% agarose gel electrophoresis. Samples with CNVs can detect two bands; sequencing; sequence analysis determines the breakpoints:

[0025] (3) Analyze the DNA sequence near the breakpoint by comparing it with the known CNVs database.

[0026] Further, the comparison with the known CNVs database analyzes the DNA sequence near the breakpoint:

[0027] a. RepeatMasker software analyzes the sequence identity of the microhomology domains of the sequences within ±500bps to 10kbs on both sides of the breakpoint and calculates the CG ratio;

[0028] b. Statistics were made on the types of repetitive elements, specific sequence insertions, palindromic sequences (≥6 bp), polypyrimidine sequences (≥7 bp), and TTTAAA and TG (A / G) (A / G) (G / T) (A / C)), sizes, and distances between multiple elements;

[0029] c. Use GeneOntology to annotate repetitive sequences, analyze their functions, structures and evolution;

[0030] d. Mfold program predicts and analyzes secondary structure.

[0031] Furthermore, the prediction method of the pathogenic mechanism of CNVs is as follows:

[0032] (1) Use DNA sequencing technology to determine CNVs breakpoints to the single base level, study their sequence characteristics, and summarize the structure, distribution patterns on the genome, and mutation hotspot characteristics of various pathogenic CNVs;

[0033] (2) Based on the analysis of breakpoints and structural features, predict the contribution of different mutational mechanisms based on DNA recombination and DNA replication to CNVs;

[0034] (3) Based on the breakpoint and structural feature analysis of large sample and high-throughput data, detect the contribution of different mutation mechanisms based on DNA recombination and DNA replication to CNVs of deafness genes, and obtain new CNV mutation models based on the accumulation of a large amount of new data;

[0035] (4) To explore the influence of the composition characteristics of genomic repetitive sequences on non-homologous recombination and explore the relationship between the special structure of the human genome and its instability;

[0036] (5) Tracing the mutational origin of genomic CNVs; the mitosis of germline stem cells or the meiosis stage of germ cells to guide prenatal diagnosis of hereditary deafness.

[0037] Further, the CNVs variation investigation method:

[0038] Based on the reported CNVs of deafness genes and CNVs in the normal person database, the distribution and characteristic differences of CNPs of deafness genes on the human genome are studied and summarized, the molecular diagnosis of CNVs of hereditary deafness is guided, the pathogenicity and risk of CNVs in the normal hearing population are evaluated, and the frequency of CNVs in the normal hearing population is analyzed and summarized; the polymorphism spectrum of CNVs in the normal hearing population is completed;

[0039] 1) Merging of CNVs:

[0040] The breakpoint positions of CNVs are diverse; two CNVs with a region overlap greater than 80% are generally considered to be the same type of CNVs; the region where CNVs are merged is called the CNV region; the cluster command of bedtools is first used to cluster CNVs with an overlap of 60%, and then they are manually merged according to the merging rules;

[0041] According to the literature and ACMG guidelines, relatively strict CNVs merging rules were set;

[0042] a. Select a threshold of 200 kb based on the resolution, and the difference between the maximum and minimum values ​​of the starting point is no more than 200 kb;

[0043] b. For CNVs in regions containing protein-coding genes, the merged CNVs all have the same gene;

[0044] c. The size difference of the merged CNVs does not exceed 200 Kb;

[0045] The frequency of occurrence of each CNV in the hearing normal population was obtained by merging, and the CNVs with a population carrier rate greater than one thousandth were selected to obtain the genome-wide copy number variation polymorphism map of the hearing normal population;

[0046] 2) Gene function analysis and pathogenicity scoring annotation;

[0047] a. Gene function analysis: extract genes from duplicated and deleted regions respectively, and merge them into duplicated region gene sets and deleted region gene sets; submit the gene sets to DAVID website for GO analysis and KEGG analysis; and plot the results using R language and GraphPadPrism;

[0048] b. Pathogenicity scoring and annotation: Use the ClassifyCNVs script to score according to the 2020 CNVs interpretation guidelines, and combine Clingen to annotate the dosage-sensitive genes and related case literature included in the CNVs to score the pathogenicity of the CNVs;

[0049] CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

[0050] Furthermore, the pathogenicity of CNVs is scored:

[0051] CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

[0052] The present invention also provides a system for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model, including:

[0053] An analysis module, used for analyzing the breakpoint sequence data of genomic CNVs to determine the single or multiple functional genes involved in the CNVs;

[0054] The hypothesis module is used to propose reasonable CNV pathogenic mechanism hypotheses for different CNVs based on the variation forms of CNVs under the mechanisms of "gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation";

[0055] The testing module is used to test the CNVS pathogenic mechanism hypothesis by means of gene expression analysis, gene knockout, in vitro cell culture and functional identification technology;

[0056] The model building module is used to establish a model of the pathogenic mechanism of CNVs related to deafness genes.

[0057] The present invention also provides a computer device, which includes a memory and a processor, wherein the memory stores a computer program, and when the computer program is executed by the processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model.

[0058] The present invention also provides a computer-readable storage medium storing a computer program. When the computer program is executed by a processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model.

[0059] The present invention also provides an information data processing terminal, characterized in that the information data processing terminal is used to implement a system for establishing the molecular mechanism of the CNVs mutation and the CNVs pathogenic mechanism model.

[0060] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0061] First, the recently discovered human genome CNVs have a high mutation rate, a large degree of variation, and strong pathogenicity, and are a hot topic in life science research in recent years. Further exploration of CNVs on the deafness genome is expected to achieve major breakthroughs in this cutting-edge issue. Guided by the major reproductive health needs of my country's eugenics, the present invention targets the international scientific frontier of genomic CNVs and focuses on scientific and technological research on mutations in the deafness genome CNVs and their molecular mechanisms of pathogenicity. Through the study of the characteristics, mutation mechanisms, pathogenic mechanisms, and population effects of the deafness genome CNVs, a series of deafness genome CNVs were identified, the molecular mechanisms of their mutations were clarified, and the biological functions were explained. While answering scientific questions and achieving theoretical breakthroughs, CNVs were guided in the molecular diagnosis and prevention of hereditary deafness.

[0062] The major difficulty and bottleneck in the research of this field is that CNVs in the deafness gene are difficult to identify, which hinders the subsequent research on the mutation mechanism and pathogenic mechanism of CNVs. The present invention takes the previous deafness genome CNVs family and large-scale population research as the starting point, conducts comprehensive family analysis and population analysis on the rich CNVs-related case resources accumulated over a long period of time, and breaks through the bottleneck of the difficulty in identifying CNVs mutations in the deafness genome.

[0063] This paper takes CNVs of deafness probands as the starting point, combined with the common CNVs in the Chinese hearing normal population, through the study of the CNVs characteristics of the deafness gene, mutation mechanism, and pathogenic mechanism model establishment, while exploring the important role and significance of copy number variation in the occurrence of hereditary deafness, it also guides the molecular diagnosis and prevention of copy number variation in hereditary deafness.

[0064] (1) Summarize the hotspot locations, sequences and structural characteristics of CNVs in deafness genes

[0065] (2) Summarize the distribution and characteristic differences between pathogenic CNVs and common CNVs polymorphisms to guide the molecular diagnosis of CNV-related diseases

[0066] (3) Explore the molecular mechanism of CNVs mutations in deafness genes and the pathogenic mechanism model of CNVs in deafness genes.

[0067] Second, the present invention takes the CNVs of deafness probands as the starting point, combined with the common CNVs in the Chinese normal hearing population, and establishes a model of the CNVs characteristics, mutation mechanism, and pathogenic mechanism of the deafness gene through research. While exploring the important role and significance of copy number variation in the occurrence of hereditary deafness, it also guides the molecular diagnosis and prevention of copy number variation in hereditary deafness.

[0068] (1) Summarize the hotspot locations, sequences, and structural characteristics of CNVs in deafness genes.

[0069] (2) To summarize the distribution and characteristic differences between pathogenic CNVs and common CNVs polymorphisms, and to guide the molecular diagnosis of CNVs-related diseases.

[0070] (3) Explore the molecular mechanism of CNVs mutations in deafness genes and the pathogenic mechanism model of CNVs in deafness genes.

[0071] Third, the technical solution of the present invention fills the technical gap in the industry at home and abroad:

[0072] The population effect of CNVs in the deafness gene is an important component of the biological function and pathogenic effect of CNVs. No systematic scientific research has been carried out at home and abroad on the mutation of CNVs in the deafness genome and the molecular mechanism of their pathogenicity. The present invention identifies a series of CNVs in the deafness genome through the study of the characteristics, mutation mechanism, pathogenic mechanism, population effect, etc. of CNVs in the deafness genome, clarifies the molecular mechanism of their mutation, explains the biological function, and guides the molecular diagnosis and prevention of CNVs in hereditary deafness while answering scientific questions and achieving theoretical breakthroughs, and establishes a systematic research system for CNVs in the deafness gene.

[0073] Fourth, the present invention has achieved significant technological progress in the field of hereditary deafness through in-depth research and analysis of deafness gene copy number variations (CNVs), which is specifically manifested in the following aspects:

[0074] 1. Improved the diagnosis rate of genetic factors of deafness

[0075] Through the application of high-throughput sequencing technology and bioinformatics methods, the present invention can more effectively identify and analyze CNVs in deafness genes, including those small fragment variations that were previously difficult to detect. The application of this method significantly improves the diagnosis rate of hereditary deafness, provides more hearing loss patients with accurate genetic diagnosis, and helps with early intervention and the formulation of personalized treatment strategies.

[0076] 2. Deepened understanding of the mechanism of CNVs in deafness genes

[0077] This study not only determined the breakpoints of CNVs of the deafness gene, but also predicted and analyzed its mutation mechanism. Through the careful study of CNVs breakpoints, the molecular mechanism of CNVs generation, including DNA recombination and replication errors, was revealed. These findings deepened our understanding of the pathogenic mechanism of hereditary deafness and laid the foundation for future research on disease prevention and treatment.

[0078] 3. Established the distribution spectrum of CNVs of deafness genes in the Chinese population

[0079] Through large-scale sample analysis, the present invention mapped the distribution spectrum of CNVs of deafness genes in the hearing-impaired population in China. This is the first systematic study of the distribution characteristics of CNVs of deafness genes in the Chinese population. This achievement not only provides valuable data for understanding the distribution of hereditary deafness in the Chinese population, but also helps in the future risk assessment and customization of prevention strategies in different populations.

[0080] 4. Exploring the pathogenic mechanism of CNVs in deafness genes

[0081] The present invention proposes a variety of CNVs-based hypotheses on the pathogenic mechanism of deafness and verifies them through experimental studies. The discovery and verification of these pathogenic mechanisms provide new methods for the development of new treatments for deafness, especially in gene therapy and drug development, providing patients with more treatment options.

[0082] 5. Provides new ideas for early diagnosis and treatment of hereditary deafness

[0083] The research results of the present invention not only improve the accuracy of genetic diagnosis of deafness, but also provide new ideas and methods for early diagnosis and treatment of hereditary deafness, especially for those who have been diagnosed by traditional methods.

[0084] Fifth, the significant technical progress of the technical solution provided by the present invention compared with the prior art is mainly reflected in the following aspects:

[0085] 1. Improved the accuracy of CNVs detection: By adopting a high-density CNVs analysis method covering the entire genome, more complex CNVs structures that cannot be detected by low-resolution technology can be discovered compared to existing technologies, greatly improving the accuracy of detection and the ability to identify complex structures.

[0086] 2. High-precision determination of CNVs breakpoints has been achieved: By using DNA sequencing technology combined with high-density CNVs analysis results, CNVs breakpoints can be determined to the single base level, greatly improving the accuracy of breakpoint determination compared to traditional methods.

[0087] 3. Enhanced understanding of sequence features near CNVs breakpoints: By combining the use of RepeatMasker software, GeneOntology annotations, and Mfold programs, we conducted in-depth analysis of microhomology, repetitive elements, functions, and secondary structures near the breakpoints, providing detailed information that is difficult to obtain with existing technologies.

[0088] 4. Provides new insights into the pathogenic mechanism of CNVs: Through the above-mentioned technological advances, this technical solution not only improves the detection and analysis capabilities of CNVs, but also provides new insights into the understanding of the pathogenic mechanism of CNVs, which is helpful for the diagnosis and treatment research of related diseases.

[0089] The following is a table showing the comparison with the prior art:

[0090]

[0091] Through these remarkable technological advances, this technical solution not only improves the ability to detect and analyze CNVs, but also lays a solid foundation for further pathogenic mechanism research and clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 It is a flow chart of the molecular mechanism of CNVs mutation and the method for establishing the CNVs pathogenic mechanism model provided by the embodiments of the present invention.

[0093] Figure 2 This is a location map of CNVs breakpoints of the deafness gene provided by an embodiment of the present invention.

[0094] Figure 3 It is a biological information analysis flow chart provided by an embodiment of the present invention.

[0095] Figure 4 This is a diagram for establishing a deafness gene CNVs pathogenic model provided by an embodiment of the present invention.

[0096] Figure 5 It is a technical roadmap of the present invention provided by an embodiment of the present invention.

[0097] Figure 6 It is a system structure block diagram for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model provided by the embodiments of the present invention.

[0098] Figure 7 It is a diagram of the pathogenic mechanism of CNVs provided in an embodiment of the present invention.

[0099] Figure 8 This is a graph showing pathogenic CNVs (5.16%) detected in 7 deaf patients provided in an embodiment of the present invention.

[0100] Fig. 9 This is a deafness gene map for early identification of CNVs provided by an embodiment of the present invention.

[0101] Fig.10 It is a diagram analyzing the gene mutation information and its biological significance provided by the embodiment of the present invention.

[0102] Fig.11 It is a flow chart of bioinformatics analysis of third-generation sequencing provided by an embodiment of the present invention.

[0103] Fig.12 This is a diagram of repetitive elements appearing at CNVs breakpoint junctions provided by an embodiment of the present invention.

[0104] a. Family map; b. Nanopore sequencing results showed that the proband carried a 3.38Mb deletion mutation located in the Xq21.1 (chrX:81079396-84457540) region; c. Primers were designed on both sides of the fusion site and the breakpoint after the deletion mutation; d. Agarose electrophoresis showed that only the mutant sequence band was amplified in the subject, the wild-type sequence band was amplified in the father of the proband, and both the mutant and wild-type sequence bands were amplified in the mother of the proband; e. Sanger sequencing verification results showed that the deletion mutation came from the mother.

[0105] Fig.13 It is a repetitive element identified using RepeatMasker provided in an embodiment of the present invention, representing a percentage graph of repetitive sequences in the ±500 bp region of the reference sequence flanking the breakpoint. DETAILED DESCRIPTION

[0106] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0107] The following are two specific application examples for the study of copy number variations (CNVs) of deafness genes:

[0108] Application Example 1: Detection and pathogenicity analysis of CNVs of deafness genes based on high-throughput sequencing technology

[0109] 1) Sample collection and pretreatment:

[0110] Blood samples were collected from deaf patients and normal-hearing controls.

[0111] Genomic DNA was extracted and quality controlled to ensure the purity and integrity of the DNA.

[0112] 2) High-throughput sequencing:

[0113] The samples are sequenced using next-generation sequencing technology (such as whole genome sequencing or targeted region sequencing).

[0114] Generate high-quality sequencing data and perform initial data processing and analysis.

[0115] 3) CNVs detection:

[0116] Bioinformatics tools were used to detect CNVs in sequencing data and determine the location, size, and type of CNVs.

[0117] The detected CNVs were quality controlled and filtered to exclude false positive results.

[0118] 4) Pathogenicity analysis:

[0119] The pathogenicity of the detected CNVs was analyzed by combining known deafness-related genes and databases.

[0120] To assess the effects of CNVs on gene expression and function, and their association with deafness.

[0121] 5) Interpretation and application of results:

[0122] The test results and pathogenicity analysis results are presented to doctors and patients in the form of a report.

[0123] Based on the results, personalized diagnosis and treatment recommendations are provided to deaf patients, including genetic counseling, early intervention treatment, etc.

[0124] Application Example 2: In vitro cell experiment study on the mutation mechanism of CNVs of deafness gene

[0125] 1) CNVs breakpoint location and sequence analysis:

[0126] DNA sequencing technology is used to accurately locate the breakpoints of CNVs of deafness genes and determine their sequence characteristics.

[0127] Analyze the structural characteristics, genomic distribution patterns, mutation hotspots and other information of CNVs.

[0128] 2) In vitro cell culture and gene manipulation:

[0129] Select appropriate cell lines or primary cells for in vitro culture.

[0130] Gene editing techniques such as CRISPR-Cas9 are used to mimic specific CNVs mutations in cells.

[0131] 3) Gene expression and functional analysis:

[0132] The expression levels of related genes in mutant cells were detected by real-time quantitative PCR, Western Blot and other techniques.

[0133] Cell function experiments (such as cell proliferation, apoptosis, migration, etc.) are used to evaluate the effects of mutations on cell function.

[0134] 4) Research on mutation mechanism:

[0135] The mutation mechanism of CNVs was analyzed by combining the breakpoint sequence characteristics of CNVs and the results of cell experiments.

[0136] To explore the role of recombination and replication after DNA damage in the formation of CNVs.

[0137] 5) Result verification and application:

[0138] By comparing the cell experimental results of different CNVs mutation types, the accuracy and reliability of the mutation mechanism are verified.

[0139] The research results will be applied to the study of the pathogenesis and clinical diagnosis of deafness, providing new ideas and methods for the prevention and treatment of deafness.

[0140] These two application examples respectively demonstrate CNVs detection and pathogenicity analysis based on high-throughput sequencing technology, as well as the application of in vitro cell experiments in the study of CNVs mutation mechanism. These studies not only help us to deeply understand the pathogenic mechanism of CNVs in deafness genes, but also provide new strategies and methods for the diagnosis and treatment of deafness.

[0141] like Figure 1 , 4 As shown in , 5, a method for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model provided by an embodiment of the present invention includes the following steps:

[0142] S101, based on the breakpoint sequence analysis data of genomic CNVs, determine the single or multiple functional genes involved in the CNVs;

[0143] S102, based on the variation forms of CNVs, propose reasonable CNV pathogenic mechanism hypotheses for different CNVs under the mechanisms of “gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation”;

[0144] S103, testing the CNVS pathogenic mechanism hypothesis by gene expression analysis, gene knockout, in vitro cell culture and functional characterization techniques;

[0145] S104, establish a pathogenic mechanism model of CNVs related to deafness genes.

[0146] like Figure 2 As shown, the method for analyzing breakpoint sequence data based on genomic CNVs provided in an embodiment of the present invention is as follows:

[0147] (1) Using CNVs analysis methods covering the whole genome and high-density CNVs detection methods to identify CNVs, analyze their fine structures and characteristics, and discover the complex structures of CNVs that cannot be detected by other low-resolution technologies;

[0148] (2) Based on the high-density CNVs analysis results, specific amplification of CNVs breakpoint sequences is performed, and the CNVs breakpoints are determined to the single base level using DNA sequencing technology. The breakpoint positions are estimated based on the positions of CNVs analyzed by the second-generation sequencing results, and PCR amplification primers are designed; PCR reaction solution is prepared for PCR reaction; PCR products are identified by 1% agarose gel electrophoresis. Samples with CNVs can detect two bands; sequencing; sequence analysis determines the breakpoints:

[0149] (3) Analyze the DNA sequence near the breakpoint by comparing it with the known CNVs database.

[0150] The embodiment of the present invention provides a comparison of known CNVs database to analyze DNA sequences near the breakpoints:

[0151] a. RepeatMasker software analyzes the sequence identity of the microhomology domains of the sequences within ±500bps to 10kbs on both sides of the breakpoint and calculates the CG ratio;

[0152] b. Statistics on the types of repetitive elements, specific sequence insertions, palindromic sequences (≥6bp), polypyrimidine sequences (≥7bp), TTTAAA and TG (A / G) (A / G) (G / T) (A / C)), sizes, and distances between multiple elements;

[0153] c. Use GeneOntology to annotate repetitive sequences, analyze their functions, structures and evolution;

[0154] d. Mfold program predicts and analyzes secondary structure.

[0155] The method for predicting the pathogenic mechanism of CNVs provided in the embodiment of the present invention is as follows:

[0156] (1) Use DNA sequencing technology to determine CNVs breakpoints to the single base level, study their sequence characteristics, and summarize the structure, distribution patterns on the genome, mutation hotspots and other characteristics of various pathogenic CNVs;

[0157] (2) Based on the analysis of breakpoints and structural features, predict the contribution of different mutational mechanisms based on DNA recombination and DNA replication to CNVs;

[0158] (3) Based on the breakpoint and structural feature analysis of large sample and high-throughput data, detect the contribution of different mutation mechanisms based on DNA recombination and DNA replication to CNVs of deafness genes, and study and reveal new CNV mutation models based on the accumulation of a large amount of new data;

[0159] (4) Explore the impact of the compositional characteristics of genomic repetitive sequences on non-allelic homologous recombination and explore the relationship between the special structure of the human genome and its instability;

[0160] (5) Tracing the mutational origin of genomic CNVs; the mitosis of germline stem cells or the meiosis stage of germ cells to guide prenatal diagnosis of hereditary deafness.

[0161] like Figure 3 As shown, the CNVs variation investigation method provided by the embodiment of the present invention is:

[0162] Based on the reported CNVs of deafness genes and CNVs in the normal person database, the distribution and characteristic differences of CNPs of deafness genes on the human genome are studied and summarized, the molecular diagnosis of CNVs of hereditary deafness is guided, the pathogenicity and risk of CNVs in the normal hearing population are evaluated, and the frequency of CNVs in the normal hearing population is analyzed and summarized; the polymorphism spectrum of CNVs in the normal hearing population is completed;

[0163] Whole exome testing was completed for 2,350 hearing normal individuals, and CNVs detected in 633 hearing normal individuals will be grouped according to age, gender, ethnicity, and source of variation;

[0164] 1) Merging of CNVs:

[0165] The breakpoint positions of CNVs are diverse; two CNVs with a region overlap greater than 80% are generally considered to be the same type of CNVs; the region where CNVs are merged is called the Copy Number Variations Region (CNVR); first use the cluster command of bedtools to cluster CNVs with an overlap of 60%, and then manually merge them according to the merging rules;

[0166] According to the literature and ACMG guidelines, relatively strict CNVs merging rules were set;

[0167] a. Select a threshold of 200 kb based on the resolution, and the difference between the maximum and minimum values ​​of the starting point is no more than 200 kb;

[0168] b. For CNVs in regions containing protein-coding genes, the merged CNVs all have the same gene;

[0169] c. The size difference of the merged CNVs does not exceed 200 Kb;

[0170] The frequency of occurrence of each CNV in the hearing normal population was obtained by merging, and the CNVs with a population carrier rate greater than one thousandth were selected to obtain the genome-wide copy number variation polymorphism map of the hearing normal population;

[0171] 2) Gene function analysis and pathogenicity scoring annotation;

[0172] a. Gene function analysis: extract genes from duplicated and deleted regions respectively, and merge them into duplicated region gene sets and deleted region gene sets; submit the gene sets to DAVID website for GO analysis and KEGG analysis; and plot the results using R language and GraphPadPrism;

[0173] b. Pathogenicity scoring and annotation: The ClassifyCNVs script can be used to score CNVs according to the 2020 CNV interpretation guidelines, and combined with Clingen to annotate the dosage-sensitive genes and related case literature contained in the CNVs; the pathogenicity of CNVs is determined by referring to the 2015 [6] and 2020 [7] consensus of the American College of Medical Genetics and Genomics (ACMGG) and Clinical Genomics Resources (Clin Gen), Technical Standards for the Interpretation and Reporting of Inherited Copy Number Variations, to score the pathogenicity of CNVs;

[0174] CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

[0175] The embodiment of the present invention provides a scoring method for the pathogenicity of CNVs:

[0176] CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

[0177] A system for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model includes:

[0178] An analysis module, used for analyzing the breakpoint sequence data of genomic CNVs to determine the single or multiple functional genes involved in the CNVs;

[0179] The hypothesis module is used to propose reasonable CNV pathogenic mechanism hypotheses for different CNVs based on the variation forms of CNVs under the theoretical guidance of mechanisms such as "gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation";

[0180] The testing module is used to test the CNVS pathogenic mechanism hypothesis by means of gene expression analysis, gene knockout, in vitro cell culture and functional identification.

[0181] The model building module is used to establish a simple and feasible model of the pathogenic mechanism of CNVs related to deafness genes.

[0182] A computer device, characterized in that the computer device includes a memory and a processor, the memory stores a computer program, and when the computer program is executed by the processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model.

[0183] A computer-readable storage medium stores a computer program. When the computer program is executed by a processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model.

[0184] An information data processing terminal, characterized in that the information data processing terminal is used to implement the molecular mechanism of the CNVs mutation and the establishment system of the CNVs pathogenic mechanism model.

[0185] Figure 7 It is a diagram of the pathogenic mechanism of CNVs provided in an embodiment of the present invention.

[0186] Figure 8 This is a graph showing pathogenic CNVs (5.16%) detected in 7 deaf patients provided in an embodiment of the present invention.

[0187] Fig. 9 This is a deafness gene map for early identification of CNVs provided by an embodiment of the present invention.

[0188] Table 1 Distribution of CNVs associated with non-syndromic deafness --- 46 cases (80.70%, 46 / 57)

[0189]

[0190] Table 2 Distribution of CNVs associated with syndromic deafness --- 11 cases (19.30%, 11 / 57)

[0191]

[0192] Copy number variation breakpoints (CNVsB)

[0193] Definition of CNVsB:

[0194] The starting and ending positions of the CNVs region, that is, the junction of CNVS and the normal copy number region

[0195] They can reflect the occurrence mechanism of CNV, affect the functional effect of CNV, reveal the association between CNV and disease, etc.

[0196] The mechanism of CNVs;

[0197] The presence of highly homologous repetitive sequences------non-allelic homologous recombination;

[0198] There are small insertions or deletions --- non-homologous end joining;

[0199] The presence of transposon sequences---retrotransposon driven mechanism;

[0200] Functional effects of CNVs;

[0201] Breakpoints are located within genes - leading to changes in gene dosage, gene fusions, and changes in transcript structure

[0202] The breakpoint is located outside the gene - affecting gene regulatory elements, epigenetic modifications, and chromosome conformation;

[0203] The association between CNV and disease;

[0204] The breakpoints contain or are close to known disease-causing genes or regulatory elements—either causes or risk factors for the disease.

[0205] Example method:

[0206] Molecular genetic diagnosis and analysis

[0207] 1. Peripheral Blood Collection

[0208] With the consent of the patient or his / her guardian, 1-2 mL of venous blood was drawn from the patient and his / her parents and other relevant relatives into EDTA anticoagulant tubes. After standing and stratification, genomic DNA was extracted in a timely manner.

[0209] 2. Extraction of Genomic DNA

[0210] The QIAam whole blood DNA extraction kit (Qiagen, Germany) was used to extract genomic DNA according to the instructions. The sample DNA quality was checked by using Nanodrop2000t to detect the OD260 / 280 ratio of the sample DNA. After the sample quality inspection was confirmed to be qualified, the subsequent processes such as library construction were carried out.

[0211] 3. Library preparation according to different sequencing methods

[0212] 3.1 Short-read sequencing library preparation

[0213] The library preparation was completed by the Illumina standard kit process. In brief, 3 mg of DNA from the research subjects was taken as the starting amount, and the genomic DNA was ultrasonically fragmented using a Covaris S2 ultrasonic instrument (Covaris, USA). The end repair of the DNA fragments, the addition of 3' adenine (A), the adapter ligation and the reaction purification were performed according to the manufacturer's protocol, and then enriched by PCR amplification. The final library fragments were quality controlled by a Nanodrop 2000 sample quantification detector (Thermo, USA) and an Agilent 12100 bioanalyzer (Agilent Technologies, USA).

[0214] 3.2 Preparation of long-length sequencing

[0215] According to the manufacturer's standard operating procedures, the DNA extraction kit (Qiagen, Germany) was used to extract the sample genomic DNA, and the purity of the obtained DNA was tested using the NanoDrop One UV-Vis spectrophotometer (Thermo, USA). After the quality control was qualified, the large fragment DNA was cut and recovered using the BluePippin automatic nucleic acid recovery instrument (SageScience, USA); damage repair, A addition reaction and adapter ligation reaction were performed after purification, and finally the DNA library was accurately quantitatively detected using the Qubit 3.0 Fluorometer (Invitrogen, USA).

[0216] 4. Sequencing

[0217] 4.1 Short read length (whole exome capture and high-throughput sequencing) sequencing

[0218] GenCap liquid phase capture technology was used to capture and enrich the exon regions and flanking intron regions of 168 hereditary deafness genes (159 deafness-related nuclear genes, 6 deafness-related mitochondrial regions, and 3 deafness-related miRNA regions, as shown in Table 3 below) in the samples, and paired-end sequencing was performed on the Nextseq500 sequencer (Illumina, USA) using 150 bp paired-end reads.

[0219] 4.2 Long-length sequencing (Nanopore sequencing)

[0220] After the DNA library was completed, the flow cell with the added quantitative DNA library was transferred to PromethION (Oxford, UK) for real-time nanopore single-molecule sequencing.

[0221] 5. Bioinformatics Analysis

[0222] After filtering, splitting, comparing with reference sequences, and annotating the sequencing data, the obtained gene mutation information and its biological significance are analyzed ( Fig.10 ). The paired-end reads of each sample were analyzed for CNVs according to the read-depth method. The analysis process is shown in the figure. The sequencing reads were aligned with the reference genome using BWA software, and the supporting reads and local assembly results of the breakpoints in the soft-clipped reads region were analyzed to obtain the breakpoints.

[0223] The Nanopore sequencing data were counted and filtered (filtering criteria: average qScore of reads ≥ 7). The acquired data were used to detect structural variations using the NGMLR-Sniffles process. Structural variation annotation was performed using ANNOVAR. 1000genome phase3, DGV gold standard CNV, dbVar nstd37, DESPICHER and local databases were used to annotate structural variations with a mutual overlap of ≥ 50% with structural variations in public databases. Databases such as OMIM, HPO and Clinvar were queried according to the phenotype of the disease, and relevant literature was read to determine disease-related genes ( Fig.10 ).

[0224] 6. Pathogenicity Analysis

[0225] Combined with the clinical phenotype and genetic pattern of the proband and his family members, potential variant sites were screened, and relevant databases such as OMIM, Decipher, Clin Var, DGV, DVD and internal databases were queried to obtain phenotypic information related to chromosome regions to evaluate the pathogenicity of genetic variants. Software such as Provean, SIFT, PolyPhen2, Mutation Taster, and GERP++ were used to predict and evaluate functional variants, and the pathogenicity of variants was determined by referring to the American College of Medical Genetics and Genomics (ACMG) genetic variation classification standards and guidelines. The CNVs pathogenicity annotation process is as follows:

[0226] First, CNVs that are common in the healthy population (incidence >1%) or occur in the normal population <1% but do not contain genes or important genetic components or have been reported in multiple publications and have not been confirmed to be associated with deafness were classified as “benign CNVs”.

[0227] All remaining CNVs were classified as “pathogenic CNVs” if they met the following criteria:

[0228] a. When the CNVs overlap ≥80% with any CNVs known to be associated with deafness; or the CNV size is ≥3Mb; or the de novo CNVs are larger than 1Mb;

[0229] b. When the CNV involves the coding region of a gene known to be associated with deafness, and its phenotype and inheritance pattern are consistent with those in the literature;

[0230] c. When the deletion variant contains a gene that is pathogenic due to haploid insufficiency or some duplication variants contain all triploid dosage sensitive genes;

[0231] d. If the CNV involves a gene associated with deafness but other conditions are not met, the CNVs are considered "pathogenic" only if they are proven to be de novo mutations, otherwise they are classified as "suspected pathogenic CNVs".

[0232] Variants whose pathogenic nature cannot be determined after the above analysis are defined as “CNVs of unknown nature”.

[0233] 7. Mutation Verification

[0234] Sequencing was used to verify the candidate SNVs / indels and CNVs obtained in the proband, parents and other related family members by PCR+Sanger and qPCR / MLPA, respectively.

[0235] 7.1 Result Verification

[0236] Sanger sequencing was performed on the patient and his parents to verify the accurate breakpoint location information of CNVs. The CNVs found by sequencing were amplified by PCR using primers designed by Primer3 and then agarose electrophoresis was performed (PCR reaction system see Table 5-1, PCR reaction conditions see Table 5-2). Because the deletion fragment of the variant is long, it is impossible to obtain the normal DNA fragment and the mutant DNA fragment at the same time, so the two sides of the fusion site after the deletion mutation (chrX:81078896-81079395, chrX:84457541-844578, Fig.10 middle FR primer) and both sides of the breakpoint (chrX:84457254-84458046, Fig.11 fr primers) (such as Fig.12 c), the specific primers are as follows:

[0237] Fusion site primers:

[0238] Gseq2921F:GTACCCCAGAGTGAGTGGTTA

[0239] Gseq2921R:ATGGCTCATCACCAGAAA

[0240] Gseq2922F:AGTCTGGGCCATTACTGACT

[0241] Gseq2922R:CCAGTAGCCCAATTCCACGA

[0242] Primers on both sides of the breakpoint:

[0243] Gseq2925f:CCATTCTGTAGGCTTACTC

[0244] Gseq2925r:GGGTGCCCATTCCCGTAT

[0245] 2925seqr:CCTCCATCTTGGGCTGACT (reverse sequencing)

[0246] Table 5-1 PCR reaction system (50 μl):

[0247]

[0248] Table 5-2 PCR reaction conditions

[0249]

[0250] 8. Analysis of Repeat Elements on Both Sides of the Breakpoint

[0251] RepeatMasker software (http: / / www.repeatmasker.org) was used to analyze various interspersed repetitive elements on both sides of the determined breakpoints (±500 bps) and calculate their percentages.

[0252] result

[0253] 1 Bioinformatics analysis

[0254] The proband was found to carry a hemizygous deletion mutation of about 3.38Mb in the Xq21.1 (chrX:81079396-84457540) region. Agarose electrophoresis showed that only the mutant sequence band was amplified in the subject, the wild-type sequence band was amplified in the father of the proband, and both the mutant and wild-type sequence bands were amplified in the mother of the proband. The first generation verification results showed that the deletion mutation came from the proband's mother ( Fig.12 e).

[0255] 2 Pathogenicity analysis

[0256] The deletion variant covers the APOOL, CYLC1, HDX, POU3F4, RPS6KA6, and SATL1 genes. The APOOL, CYLC1, HDX, and RPS6KA6 genes have no associated diseases in the OMIM database, and the SATL1 gene has not been included, so the pathogenicity of the above genes is excluded. In addition, no other pathogenic single nucleotide variants were found.

[0257] The POU3F4 gene (OMIM:#300039) covered by this deletion CNVs is clearly recorded in the OMIM database as the pathogenic gene of X-linked deafness type 2 (OMIM:#304400; DFNX2). This variation completely deletes the coding sequence of the POU3F4 gene, affecting the normal function of the encoded protein (PVS1). The DGV database and the gnomAD SVs database did not find the inclusion of this variation (PM2). However, one deletion variant (287069) in the DESPICHER database was defined as a suspected pathogenic variant, and the related clinical phenotype was moderate intellectual disability; one pathogenic deletion variant (nssv578452) in the ISCA database was defined as global developmental delay, and there were multiple pathogenic deletion variants (nssv578451, nssv578449) that overlapped with the variant, and the related clinical phenotypes were hearing impairment, etc.; multiple deletion variants (57931, 57965, 57967) in the ClinVar database that overlapped with the variant were defined as pathogenic variants, and the related clinical phenotypes were hearing impairment, etc. (PM3). Based on the results of parent verification and the above evidence, according to the guidelines jointly issued by ACMG and Clinvar, the variant was determined to be a pathogenic variant (Pathogenic: PVS1+PM2+PM3), and the POU3F4 gene was the pathogenic gene.

[0258] 3 Repeat elements appear at the junction of CNVs breakpoints

[0259] Evaluation of the breakpoint sequences using RepeatMasker also identified longer repetitive elements in all individuals. LINE1 repeat elements were found in the sequences on both sides of the two breakpoints, which were 974 bp and 66 bp in size, respectively.

[0260] Fig.12a. Family map; b. Nanopore sequencing results showed that the proband carried a 3.38Mb deletion mutation located in the Xq21.1 (chrX:81079396-84457540) region; c. Primers were designed on both sides of the fusion site and the breakpoint after the deletion mutation; d. Agarose electrophoresis showed that only the mutant sequence band was amplified in the subject, the wild-type sequence band was amplified in the father of the proband, and both the mutant and wild-type sequence bands were amplified in the mother of the proband; e. Sanger sequencing verification results showed that the deletion mutation came from the mother.

[0261] Fig.13 .Repetitive elements identified using RepeatMasker, representing the percentage of repeat sequences in the ±500 bp region of the reference sequence flanking the breakpoint.

[0262] discuss

[0263] The human POU3F4 gene is located on chromosome Xq21.1. The POU3F4 transcription factor protein encoded by this gene belongs to the POU domain family, which contains a POU specific domain (POUs) and a POU homeodomain (POUHD). POU superfamily genes play an important role in cell differentiation and organ formation. About 50% of non-syndromic X-linked hearing loss is caused by single nucleic acid mutations in the coding region of the POU3F4 gene, as well as gene deletions or upstream regulatory element deletions. Its typical imaging features can be distinguished from other X-linked hearing losses, such as cochlear septation incomplete type III, bulbous enlargement of the internal auditory canal, abnormal communication between the basal gyrus of the cochlea and the internal auditory canal, and thickening of the stapes base plate. Studies have verified in animal models that mutations in this gene can block mesenchymal differentiation, leading to a variety of ear malformations and playing a role in cell signaling during the development of the labyrinth necessary for spiral ganglion innervation, explaining the human hearing loss and imaging features caused by POU3F4 mutations. Recently, studies have also reported patients with hearing loss, inner ear malformations, and hypothalamic hamartoma-like malformations caused by POU3F4 gene mutations, and other genes or syndromes have been excluded.

[0264] Deletion mutations covering only the POU3F4 gene sequence have been detected in multiple deaf pedigree patients by NGS and other technologies, all of which are within the variation interval detected by the present invention, and the clinical characteristics of the patients are consistent with the phenotype of male cases of non-syndromic DFNX2 associated with the POU3F4 gene CNVs reported therein. This mutation will lead to the complete loss of the POU3F4 gene sequence, resulting in a lack of functional POU3F4 protein, thereby disrupting the normal development of the middle ear and inner ear structures and causing hearing impairment.

[0265] In addition, there are also reports of large deletions in the Xq21 region that cause the POU3F4 gene and adjacent genes to form syndromic hearing impairment. The specific phenotype depends on the size of its CNVs and the content of pathogenic genes, mainly DFNX2, attention deficit, intellectual disability and choroidal hemorrhage. Although the deletion range of the case in the present invention also covers other genes, the patient did not show other special phenotypes, and there is currently no clear pathogenic evidence for the other genes covered, so the patient is excluded from syndromic hearing impairment. However, it cannot be ruled out that the proteins encoded by other genes interact with known pathogenic genes and produce functional changes associated with the observed phenotypes, which requires further identification through whole genome analysis.

[0266] Since the POU3F4 gene is located in the gene desert on the X chromosome, this region does not cover many important functional genes and is rich in highly conserved non-coding regions, which leads to frequent CNVs in the POU3F4 gene or the corresponding region. To clarify the exact mechanism of the occurrence of CNVs in the POU3F4 gene, it is necessary to further analyze the repetitive sequences around the CNVs breakpoints. Therefore, the precise positioning of the breakpoints is crucial to explore the mechanism of the occurrence of CNVs in the POU3F4 gene and evaluate its functional impact. Traditional detection methods and NGS have certain limitations for the precise positioning of CNVs breakpoints, and need to face problems such as the richness of complex repetitive elements in the region where the breakpoint is located, high GC rate or the presence of pseudogenes, short sequencing read length, and inability to accurately map back to the correct genomic position. The Oxford Nanopor platform used in the present invention is a third-generation single-molecule gene sequencing technology based on nanopore sequencing. This technology not only has the characteristics of high throughput, but also can obtain sequences at both ends of CNVs. Even if the breakpoints appear in highly repetitive and complex regions, more accurate mapping and genome comparison can be performed. The long read sequencing of this technology overcomes many limitations of short reads of traditional detection technologies, making it possible to obtain larger gapless full-length genomes and perform structural sequence analysis on them. Long reads are particularly useful for resolving breakpoints in repetitive genomic regions with transposable elements. Transposable elements, including DNA transposons and retrotransposons, are the main factors leading to genomic instability.

[0267] There are LINE-1 elements (Long Interspersed Element-1, LINE-1 or L1) at the breakpoint junctions on both sides of the CNVs in the present invention. L1 is the only autonomously active human retrotransposon known so far, accounting for about one-sixth of the genome. It can be integrated back into the genome through the reverse transcription pathway, replacing the original gene or producing a pseudogene, and once it obtains introns, it can lead to an increase in gene dosage. In addition, the L1-mediated retrotransposition mechanism can be used as a mutagen to produce abnormal alleles by directly destroying exons or inserting intron regions. In addition, the L1-mediated retrotransposition mechanism also leads to various forms of human structural variation. Studies have shown that L1 expression leads to high levels of DNA double-strand breaks, which in turn lead to instability in the region through non-allelic homologous recombination mechanisms, promoting the formation of large-fragment CNVs. About 10% of L1 retrotransposition events are related to the formation of mosaic L1, accompanied by intrachromosomal deletions, duplications or inversions, and interchromosomal translocations. In addition, studies have shown that single-strand annealing during the DNA recombination process, and microhomology-mediated break-induced replication (MMBIR) or non-homologous end joining (NHEJ) are involved in the formation of these abnormal structures.

[0268] Clarifying the pathogenicity of CNVs of the proband can provide strong support for accurate genetic counseling and prenatal diagnosis before the proband's mother becomes pregnant again. In the present invention, the proband's mother became pregnant again, and prenatal diagnosis and sex identification of the fetus were performed by collecting amniotic fluid and ultrasound examination at 19 weeks of pregnancy. The results showed that the fetus was female and carried a heterozygous variation of the fragment. For X-linked recessive genetic diseases, female carriers of a single pathogenic variation will not develop into patients. Only when the male patient's genotype is hemizygous and the female patient's genotype is homozygous or a compound heterozygous pathogenic variation (such as trans) will it cause deafness. Therefore, the fetus is a carrier of the deletion variation like its mother, and will not repeat the phenotype of its brother. After follow-up after birth, the baby girl had normal hearing.

[0269] in conclusion

[0270] The present invention uses TGS detection and Sanger sequencing verification to clarify the molecular etiology of a patient with hereditary deafness accompanied by inner ear malformation, and conducts genetic counseling and prenatal diagnosis on the fetus of the proband's mother who is pregnant again. The present invention proves that the clinical application of TGS for CNVs in hereditary deafness genes is feasible, but it still faces many problems, such as the high error rate of single read length, which requires repeated sequencing for error correction; the lack of rich bioinformatics analysis software and little data accumulation; the high price cost, etc. Its effectiveness and accuracy still require a large amount of data evaluation and verification.

[0271] It should be noted that the embodiments of the present invention can be implemented by hardware, software, or a combination of software and hardware. The hardware part can be implemented using dedicated logic; the software part can be stored in a memory and executed by an appropriate instruction execution system, such as a microprocessor or dedicated design hardware. It can be understood by a person of ordinary skill in the art that the above-mentioned devices and methods can be implemented using computer executable instructions and / or contained in a processor control code, such as a carrier medium such as a disk, CD or DVD-ROM, a programmable memory such as a read-only memory (firmware), or a data carrier such as an optical or electronic signal carrier. Such code is provided on the carrier medium. The device and its modules of the present invention can be implemented by hardware circuits such as very large-scale integrated circuits or gate arrays, semiconductors such as logic chips, transistors, etc., or programmable hardware devices such as field programmable gate arrays, programmable logic devices, etc., can also be implemented by software executed by various types of processors, and can also be implemented by a combination of the above-mentioned hardware circuits and software, such as firmware.

[0272] In view of the problems and defects in the existing technologies, the following solutions and technical improvement directions can be adopted:

[0273] (1) Establish a database of gene copy number variation in hearing-normal people

[0274] -Data Collection: Through extensive population screening, genomic data from hearing people will be collected, especially those individuals with a family history of deafness but who do not show symptoms of deafness.

[0275] - High-throughput sequencing: Use second-generation sequencing technology or more advanced third-generation sequencing technology to perform deep sequencing on selected samples to ensure the comprehensiveness and accuracy of the data.

[0276] -Database establishment: Combined with bioinformatics methods, CNVs related to deafness are screened and a public database is established to provide a reference for researchers and facilitate the search for potential non-pathological variations.

[0277] (2) Clarify the characteristics and patterns of CNVs in deafness genes

[0278] - Large-scale population studies: By collecting genetic data from a large number of deaf patients and normal hearing people, statistical methods are used to analyze the distribution differences of CNVs.

[0279] -Bioinformatics analysis: In-depth study of the gene location, size, type (such as increase or loss), affected gene function, etc. of CNVs to reveal the molecular mechanisms and laws behind them.

[0280] (3) Explore the mutation mechanism of CNVs in deafness genes

[0281] - Mutation mechanism research: Analyze the sequence characteristics of CNVs breakpoints, explore the role of microhomology sequences, repetitive sequences and other elements in the generation of CNVs, and thus reveal the generation mechanism of different types of CNVs.

[0282] - Experimental verification: Use gene editing technology (such as CRISPR / Cas9) in cell models and animal models to simulate the generation of CNVs and observe their effects on the expression and function of deafness genes.

[0283] (4) Develop pathogenic mechanism models for CNVs related to deafness genes

[0284] -Multi-level biological analysis: Combine data from multiple levels, including gene expression, proteomics, and cell biology, to analyze how CNVs affect the expression and function of deafness genes.

[0285] - Mechanistic hypothesis verification: Based on the different characteristics of CNVs, a variety of pathogenic mechanisms (such as gene inactivation, dosage effect, etc.) are proposed and verified through experimental studies.

[0286] Second, through the implementation of the above technical solutions, the key scientific problems mentioned in the existing technology can be effectively solved, which can not only improve the depth and breadth of the research on CNVs of deafness genes, but also help to discover new deafness-causing genes and provide new ideas and methods for the early diagnosis and treatment of deafness. In addition, these studies also provide references for the research of other genetic diseases.

[0287] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A method for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model, characterized in that: The following steps are involved: Step 1: Based on the breakpoint sequence analysis data of genomic CNVs, determine the single or multiple functional genes involved in the CNVs; Step 2: Based on the variation forms of CNVs, a reasonable hypothesis of the pathogenic mechanism of CNVs is proposed for different CNVs under the mechanism of "gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation"; Step 3: Test the CNVS pathogenic mechanism hypothesis by gene expression analysis, gene knockout, in vitro cell culture and functional identification techniques; Step 4: Establish a pathogenic mechanism model of CNVs related to deafness genes.

2. The method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as claimed in claim 1, characterized in that: The method for analyzing data based on breakpoint sequences of genomic CNVs is as follows: (1) Using CNVs analysis methods covering the whole genome and high-density CNVs detection methods to identify CNVs, analyze their fine structures and characteristics, and discover the complex structures of CNVs that cannot be detected by other low-resolution technologies; (2) Based on the high-density CNVs analysis results, specific amplification of CNVs breakpoint sequences is performed, and the CNVs breakpoints are determined to the single base level using DNA sequencing technology. The breakpoint positions are estimated based on the positions of CNVs analyzed by the second-generation sequencing results, and PCR amplification primers are designed; PCR reaction solution is prepared for PCR reaction; PCR products are identified by 1% agarose gel electrophoresis. Samples with CNVs can detect two bands; sequencing; sequence analysis determines the breakpoints: (3) Analyze the DNA sequence near the breakpoint by comparing it with the known CNVs database.

3. The method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as described in claim 2, characterized in that: The comparison of the known CNVs database analyzes the DNA sequence near the breakpoint: a. RepeatMasker software analyzes the sequence identity of the microhomology domains of the sequences within ±500bps to 10kbs on both sides of the breakpoint and calculates the CG ratio; b. Statistics were made on the types of repetitive elements, specific sequence insertions, palindromic sequences (≥6 bp), polypyrimidine sequences (≥7 bp), and TTTAAA and TG (A / G) (A / G) (G / T) (A / C)), sizes, and distances between multiple elements; c. Use GeneOntology to annotate repetitive sequences, analyze their functions, structures and evolution; d. Mfold program predicts and analyzes secondary structure.

4. The method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as claimed in claim 1, characterized in that: The prediction method of the pathogenic mechanism of CNVs is as follows: (1) Using DNA sequencing technology to determine CNVs breakpoints to the single base level and study their sequence characteristics, Summarize the structure, distribution patterns on the genome, and mutation hotspot characteristics of various pathogenic CNVs; (2) Based on the analysis of breakpoints and structural features, predict the contribution of different mutational mechanisms based on DNA recombination and DNA replication to CNVs; (3) Based on the breakpoint and structural feature analysis of large sample and high-throughput data, detect the contribution of different mutation mechanisms based on DNA recombination and DNA replication to CNVs of deafness genes, and obtain new CNV mutation models based on the accumulation of a large amount of new data; (4) To explore the influence of the composition characteristics of genomic repetitive sequences on non-homologous recombination and explore the relationship between the special structure of the human genome and its instability; (5) Tracing the mutational origin of genomic CNVs; the mitosis of germline stem cells or the meiosis stage of germ cells to guide prenatal diagnosis of hereditary deafness.

5. The method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as claimed in claim 1, characterized in that: Methods for investigating the variation of CNVs: Establish a CNVs database of normal hearing gene, study and summarize the distribution and characteristic differences of CNPs of hearing gene on the human genome, guide the molecular diagnosis of hereditary hearing CNVs, evaluate the pathogenicity and risk of CNVs in normal hearing population, analyze and summarize the frequency of CNVs in normal hearing population; complete the CNVs polymorphism spectrum of normal hearing population; 1) Merging of CNVs: The breakpoint positions of CNVs are diverse; two CNVs with a region overlap greater than 80% are generally considered to be the same type of CNVs; the region where CNVs are merged is called the CNV region; the cluster command of bedtools is first used to cluster CNVs with an overlap of 60%, and then they are manually merged according to the merging rules; According to the literature and ACMG guidelines, relatively strict CNVs merging rules were set; a. Select a threshold of 200 kb based on the resolution, and the difference between the maximum and minimum values ​​of the starting point is no more than 200 kb; b. For CNVs in regions containing protein-coding genes, the merged CNVs all have the same gene; c. The size difference of the merged CNVs does not exceed 200 Kb; The frequency of occurrence of each CNV in the hearing normal population was obtained by merging, and the CNVs with a population carrier rate greater than one thousandth were selected to obtain the genome-wide copy number variation polymorphism map of the hearing normal population; 2) Gene function analysis and pathogenicity scoring annotation; a. Gene function analysis: extract genes from duplicated and deleted regions respectively, and merge them into duplicated region gene sets and deleted region gene sets; submit the gene sets to DAVID website for GO analysis and KEGG analysis; and plot the results using R language and GraphPadPrism; b. Pathogenicity scoring and annotation: Use the ClassifyCNVs script to score according to the 2020 CNVs interpretation guidelines, and combine Clingen to annotate the dosage-sensitive genes and related case literature included in the CNVs to score the pathogenicity of the CNVs; CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

6. The method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as claimed in claim 5, characterized in that: The pathogenicity of CNVs was scored as follows: CNVs are divided into five categories according to the scores: score ≥ 0.99 is judged as "pathogenic variant", 0.9 ≤ score ≤ 0.98 is judged as "pathogenic variant", score ≤ -0.99 is "benign variant", -0.98 ≤ score ≤ -0.90 is judged as "benign variant", and other scores are judged as variants of unknown significance. The study summarizes the distribution and characteristic differences of CNPs of deafness genes on the human genome to guide the molecular diagnosis of hereditary deafness CNVs.

7. A system for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model for implementing the method for establishing a molecular mechanism of CNVs mutation and a CNVs pathogenic mechanism model as described in any one of claims 1 to 6, characterized in that: The molecular mechanism of CNVs mutation and the establishment system of CNVs pathogenic mechanism model include: An analysis module, used for analyzing the breakpoint sequence data of genomic CNVs to determine the single or multiple functional genes involved in the CNVs; The hypothesis module is used to propose reasonable CNV pathogenic mechanism hypotheses for different CNVs based on the variation forms of CNVs under the mechanisms of "gene inactivation, dosage effect, gene fusion, position effect, and secondary mutation"; The testing module is used to test the CNVS pathogenic mechanism hypothesis by means of gene expression analysis, gene knockout, in vitro cell culture and functional identification technology; The model building module is used to establish a model of the pathogenic mechanism of CNVs related to deafness genes.

8. A computer device, characterized in that: The computer device includes a memory and a processor, the memory stores a computer program, and when the computer program is executed by the processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as described in any one of claims 1 to 6.

9. A computer-readable storage medium storing a computer program, wherein when the computer program is executed by a processor, the processor executes the steps of the method for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as described in any one of claims 1 to 6.

10. An information data processing terminal, characterized in that: The information data processing terminal is used to implement the system for establishing the molecular mechanism of CNVs mutation and the CNVs pathogenic mechanism model as described in claim 7.

Images