Recombinant plasmid and recombinant engineering bacterium for expressing white kidney bean Alpha-amylase inhibitory protein and preparation method of recombinant plasmid and recombinant engineering bacterium

Abstract

The invention discloses a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, a recombinant engineering bacterium and a preparation method of the recombinant plasmid. The white kidney bean Alpha-amylase inhibitory protein is obtained by a prokaryote fermentation method. The method comprises the following steps: extracting white kidney bean Alpha-amylase inhibitory protein genes, respectively carrying out codon optimization on the white kidney bean Alpha-amylase inhibitory protein genes, respectively constructing a first white kidney bean Alpha-amylase inhibitory protein gene and a second white kidney bean Alpha-amylase inhibitory protein gene, and respectively constructing a first recombinant plasmid, a first recombinant engineering bacterium, a second recombinant plasmid and a second recombinant engineering bacterium; enzyme activity detection and inhibition rate test are carried out on proteins expressed by two strains of the first engineering bacterium and the second engineering bacterium, and experimental results show that the proteins expressed by the two strains have an inhibition effect on Alpha-amylase and are Alpha-amylase inhibitory proteins, and the Alpha-amylase inhibitory proteins have the inhibition effect on Alpha-amylase. The invention provides a method for producing the white kidney bean Alpha amylase inhibitory protein more safely and efficiently.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, a recombinant engineering bacterium and a preparation method thereof. Background Art

[0002] Alpha-amylase inhibitors are important bioactive substances with significant application value in the field of medical health. By inhibiting the activity of alpha-amylase, alpha-amylase inhibitors can slow down the digestion rate of starch in the mouth and small intestine, thereby reducing the glycemic index (GI value) of food and helping to control blood sugar levels. This feature makes it a powerful tool for diabetes management, especially for patients who need to control postprandial blood sugar fluctuations. In addition to the hypoglycemic effect, alpha-amylase inhibitors also have multiple benefits such as fat reduction, improving the sensitivity of target cells to insulin, and slowing down the gastric emptying rate, which makes them potential for application in weight management and the regulation of diabetic metabolic syndrome. In the food industry, alpha-amylase inhibitors can be used as functional food ingredients to help develop low-GI foods, which is particularly important for diabetic patients and consumers with high health awareness. Alpha-amylase inhibitors can slow down the digestion of starch and help prolong satiety, thus playing a role in weight loss and weight management products. In addition, the application of alpha-amylase inhibitors in the agricultural field is also attracting attention, such as for improving crop resistance to insects and improving crop storage stability. These various applications not only demonstrate the potential of alpha-amylase inhibitors in promoting human health, but also highlight their diverse applications in the food industry and agricultural technology. In general, as a multifunctional bioactive substance, alpha-amylase inhibitors show broad application prospects in the fields of medicine, food and agriculture. The health benefits brought by alpha-amylase inhibitors through various mechanisms make them a target worthy of further research and development.

[0003] The researchers also conducted further research on the preparation method of Alpha-amylase inhibitory protein. The research showed that white kidney beans can be used as the main source of extracting Alpha-amylase inhibitory protein. Alpha-amylase inhibitors extracted from white kidney beans have the advantages of natural health and less side effects compared to traditional diabetes drugs. However, most of the existing technologies use physical methods to extract Alpha-amylase inhibitory protein from white kidney beans, such as leaching method, etc. The content of Alpha-amylase inhibitory protein in the natural isolated product of white kidney beans extracted by this method is low. Not only that, the isolated product also contains plant lectins, and the extraction and purification of Alpha-amylase inhibitory protein is more difficult. Studies have found that plant lectins are a toxic component that can cause lectin poisoning, which leads to the poor safety of Alpha-amylase inhibitory protein extracted from white kidney beans, and its application in actual products is also limited. Developing a high-yield, plant lectin-free white kidney bean Alpha-amylase inhibitory protein extraction method has become an important demand in the field of food and health.

[0004] Therefore, the method of extracting Alpha-amylase inhibitory protein from white kidney bean using physical methods such as extraction in the prior art has the technical defect of low yield of Alpha-amylase inhibitory protein. Summary of the invention

[0005] The purpose of the present invention is to propose a recombinant plasmid, a recombinant engineered bacterium and a preparation method thereof for expressing white kidney bean Alpha-amylase inhibitory protein, aiming to solve the technical defect of the prior art of extracting Alpha-amylase inhibitory protein from white kidney bean using physical methods such as extraction, which has a low yield of Alpha-amylase inhibitory protein.

[0006] To achieve this object, the present invention adopts the following technical scheme: In the first aspect, the present invention discloses a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, comprising: a first recombinant plasmid and / or a second recombinant plasmid; the first recombinant plasmid contains a first white kidney bean Alpha-amylase inhibitory protein encoding gene; the second recombinant plasmid contains a second white kidney bean Alpha-amylase inhibitory protein encoding gene.

[0007] The first white kidney bean Alpha-amylase inhibitory protein gene is obtained by subjecting the white kidney bean Alpha-amylase inhibitory protein gene to a first codon optimization, and the sequence of the first white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.2.

[0008] The second white kidney bean Alpha-amylase inhibitory protein gene is obtained by subjecting the white kidney bean Alpha-amylase inhibitory protein gene to a second codon optimization, and the sequence of the second white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.3.

[0009] The white kidney bean Alpha-amylase inhibitory protein gene is derived from white kidney bean extract, and the white kidney bean Alpha-amylase inhibitory protein gene sequence is shown in SEQ ID NO.1.

[0010] In a second aspect, the present invention discloses a recombinant engineered bacterium, comprising: a first recombinant engineered bacterium and / or a second engineered bacterium; the first recombinant engineered bacterium contains the first recombinant plasmid as described above, and the first recombinant engineered bacterium includes a nucleotide sequence as shown in SEQ ID NO.2; the second recombinant engineered bacterium contains the second recombinant plasmid as described above, and the second recombinant engineered bacterium includes a nucleotide sequence as shown in SEQ ID NO.3.

[0011] In a third aspect, the present invention discloses a method for preparing a recombinant engineered bacterium for expressing white kidney bean Alpha-amylase inhibitory protein, comprising:

[0012] S1. Design specific primers for the white kidney bean Alpha-amylase inhibitory protein gene, and use the white kidney bean genomic cDNA as a template for PCR reaction; the amplified product is verified by gel electrophoresis and DNA sequencing to obtain the white kidney bean Alpha-amylase inhibitory protein gene (PASI);

[0013] S2. Using software tools, the first codon of the white kidney bean Alpha-amylase inhibitory protein gene (PASI) was optimized for the Escherichia coli expression system to obtain the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01), and the second codon was optimized for the Bacillus subtilis expression system to obtain the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02);

[0014] S3. Design primers to introduce a first restriction enzyme site into the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and the pET28a vector, and introduce a second restriction enzyme site into the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) and the pHY-P43 vector;

[0015] S4. The first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and the pET28a vector were opened at the first restriction site by double enzyme digestion; the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) and the pHY-P43 vector were opened at the second restriction site by double enzyme digestion;

[0016] S5. The first open white kidney bean Alpha-amylase inhibitory protein gene (PASI01) was connected to the pET28a vector using a ligase to construct a first recombinant plasmid (pET28a-PASI01), and then the first recombinant plasmid was transformed into an expression vector Escherichia coli Rosetta (DE3) using a heat shock method;

[0017] S6. The opened second white bean Alpha-amylase inhibitory protein gene (PASI02) was connected to the pHYP43 vector using a ligase to construct a second recombinant plasmid (pHY-P43-PASI02), and then the second recombinant plasmid was transformed into the expression vector Bacillus subtilis WB800N using electroporation;

[0018] S7. The bacterial solutions cultured in S5 and S6 were diluted and spread on kanamycin resistant medium, and positive transformants were selected to obtain the first recombinant engineered bacteria (DE3-pET28a-PASI01) and the second recombinant engineered bacteria (WB800N-pHYP43-PASI02), respectively;

[0019] S8. The first recombinant engineered bacteria (DE3-pET28a-PASI01) and the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02) were inoculated into LB culture medium respectively, and IPTG was added to induce expression when the bacteria were propagated to the logarithmic phase.

[0020] Preferably, the white bean Alpha-amylase inhibitory protein gene (PASI) is first codon optimized for the Escherichia coli expression system, wherein the codon preference is referenced to Escherichia coli K12MG1655, and the rare codons or low-frequency codons of Escherichia coli, such as CCC, GGG, GGA, and AGG, are optimized.

[0021] Preferably, the white bean Alpha-amylase inhibitory protein gene (PASI) is subjected to a second codon optimization for the Bacillus subtilis expression system, wherein the codon preference is optimized with reference to Bacillus subtilis (strain 168).

[0022] Preferably, the first restriction enzyme cutting site is BamHI and HindIII; the second restriction enzyme cutting site is BamHI and EcoRI.

[0023] Preferably, the ligase is T4 DNA ligase.

[0024] Beneficial effects of the invention: The technical scheme discloses a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, a recombinant engineered bacterium and a preparation method thereof, wherein the white kidney bean Alpha-amylase inhibitory protein is obtained by a prokaryotic fermentation method, the white kidney bean Alpha-amylase inhibitory protein gene is extracted and the first codon and the second codon are optimized respectively, and the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) are constructed respectively, and the first recombinant plasmid (pET28a-PASI01), the first recombinant engineered bacterium (DE3-pET28a-PASI01), the second recombinant plasmid (pHY-P43-PASI02) and the second recombinant engineered bacterium (WB800N-pHYP43-PASI02) are constructed respectively, aiming to solve the limitations of the prior art and provide a more efficient method for producing white kidney bean Alpha-amylase inhibitory protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The present invention is a flowchart of the experimental method disclosed in the embodiment of the present invention.

[0027] Figure 2 This is a schematic diagram of the construction process of the first recombinant plasmid disclosed in an embodiment of the present invention.

[0028] Figure 3 This is a flow chart for constructing the second recombinant plasmid disclosed in an embodiment of the present invention.

[0029] Figure 4 This is a plate image of the positive clones of the first recombinant engineered bacteria disclosed in the embodiment of the present invention.

[0030] Figure 5 This is a plate diagram of the positive clones of the second recombinant engineered bacteria disclosed in the embodiment of the present invention.

[0031] Figure 6 This is an SDS-PAGE image of the target protein expressed by the first recombinant engineered bacteria disclosed in the embodiment of the present invention.

[0032] Figure 7This is a bar graph showing the effects of the first PASI recombinant protein crude extract and the second PASI recombinant protein crude extract on the Alpha-amylase activity disclosed in the embodiments of the present invention.

[0033] Figure 8 This is a bar graph showing the inhibition rates of the first PASI recombinant protein crude extract and the second PASI recombinant protein crude extract on Alpha-amylase disclosed in the embodiments of the present invention. DETAILED DESCRIPTION

[0034] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0036] In the description of the present invention, it should be noted that the terms "center", "upper", "lower", "left", "right", "vertical", "horizontal", "inner", "outer", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as limiting the present invention. In addition, the terms "first", "second", and "third" are used for descriptive purposes only, and cannot be understood as indicating or implying relative importance.

[0037] In the description of the present invention, it should be noted that, unless otherwise clearly specified and limited, the terms "installed", "connected", and "connected" should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be indirectly connected through an intermediate medium, or it can be the internal communication of two components. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0038] In addition, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0039] In the first aspect, the present invention discloses a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, comprising: a first recombinant plasmid and / or a second recombinant plasmid; the first recombinant plasmid contains a first white kidney bean Alpha-amylase inhibitory protein encoding gene; the second recombinant plasmid contains a second white kidney bean Alpha-amylase inhibitory protein encoding gene.

[0040] Wherein, the first white kidney bean Alpha-amylase inhibitory protein gene is obtained by optimizing the white kidney bean Alpha-amylase inhibitory protein gene through the first codon, and the sequence of the first white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.2; the second white kidney bean Alpha-amylase inhibitory protein gene is obtained by optimizing the white kidney bean Alpha-amylase inhibitory protein gene through the second codon, and the sequence of the second white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.3; the white kidney bean Alpha-amylase inhibitory protein gene is derived from a white kidney bean extract, and the sequence of the white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.1, which is specifically as follows:

[0041] .

[0042] In a second aspect, the present invention discloses a recombinant engineered bacterium, comprising: a first recombinant engineered bacterium and / or a second engineered bacterium; the first recombinant engineered bacterium contains the first recombinant plasmid as described above, and the first recombinant engineered bacterium comprises SEQ ID The nucleotide sequence shown in NO.2 is as follows: atgggcagcattaacctggtgctgagctcaaccctgctgctgcttctggtgggctttgcgaccagcgatattaatcaggataaa tcggaatgcatgaacaaaattattggcctggcgggttgtctgacctatgcgagcggcgaagccgccgtgccgaccatggattgctgctttggcctgaaagaag tgattgataaaagcaaacgctgtctgtgcattctgattaaagatcgtaacgacccgtcactgggcctgaaagtgaatgtgaccctggcgctgaaactgccgga agtgtgcaaaaccccgaccaacattaccgaatgcgtggacctgctgcatctgccgccgaacagcgcggatgcgaaagtgttcgaaggctttgaaaaaagctta accaatcagaccagcccgccgagcaccccggcggccaccgccaaaggcgaaaatattaatgatgataacaaaaaaaacggtggctgggccaaaaaaggcctggtgaccgaagtggtgtgcggcattctgccgctgctgctggtgagccatctggtgctgtttctggtttaa.

[0043] The second recombinant engineered bacteria contains the second recombinant plasmid as described above, and the second recombinant engineered bacteria includes the nucleotide sequence shown in SEQ ID NO.3, which is specifically as follows:.

[0044] In a third aspect, the present invention discloses a method for preparing a recombinant engineered bacterium for expressing white kidney bean Alpha-amylase inhibitory protein, such as Figure 1 As shown, including:

[0045] S1. Design specific primers for the white kidney bean Alpha-amylase inhibitory protein gene, and use the white kidney bean genomic cDNA as a template for PCR reaction; the amplified product is verified by gel electrophoresis and DNA sequencing to obtain the white kidney bean Alpha-amylase inhibitory protein gene (PASI);

[0046] S2. Using software tools, the first codon of the white kidney bean Alpha-amylase inhibitory protein gene (PASI) was optimized for the Escherichia coli expression system to obtain the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01), and the second codon was optimized for the Bacillus subtilis expression system to obtain the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02); the purpose of codon optimization is to increase the expression efficiency of the Alpha-amylase inhibitory protein gene in chassis cells;

[0047] S3. Design primers to introduce a first restriction enzyme site into the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and the pET28a vector, and introduce a second restriction enzyme site into the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) and the pHY-P43 vector;

[0048] S4. The first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and the pET28a vector were opened at the first restriction site by double enzyme digestion; the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) and the pHY-P43 vector were opened at the second restriction site by double enzyme digestion;

[0049] S5. The opened first white bean Alpha-amylase inhibitory protein gene (PASI01) was connected to the pET28a vector using a ligase to construct a first recombinant plasmid (pET28a-PASI01), and then the first recombinant plasmid was transformed into an expression vector Escherichia coli Rosetta (DE3) using a heat shock method, as follows: Figure 2 As shown;

[0050] S6. The opened second white bean alpha-amylase inhibitory protein gene (PASI02) was connected to the pHYP43 vector using a ligase to construct a second recombinant plasmid (pHY-P43-PASI02), and then the second recombinant plasmid was transformed into the expression vector Bacillus subtilis WB800N using electroporation, as shown in the following example. Figure 3 As shown;

[0051] S7. The bacterial solutions cultured in S5 and S6 were diluted and spread on kanamycin resistant medium, and positive transformants were selected to obtain the first recombinant engineered bacteria (DE3-pET28a-PASI01) and the second recombinant engineered bacteria (WB800N-pHYP43-PASI02), respectively;

[0052] S8. The first recombinant engineered bacteria (DE3-pET28a-PASI01) and the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02) were inoculated into LB culture medium respectively, and IPTG was added to induce expression when the bacteria were propagated to the logarithmic phase.

[0053] Among them, in step S2, the white bean Alpha-amylase inhibitory protein gene (PASI) is first codon optimized for the Escherichia coli expression system, wherein the codon preference is referenced to Escherichia coli K12MG1655, and the rare codons or low-frequency codons of Escherichia coli, such as CCC, GGG, GGA, and AGG, are optimized.

[0054] Wherein, in step S2, the white bean alpha-amylase inhibitory protein gene (PASI) is subjected to a second codon optimization for the Bacillus subtilis expression system, wherein the codon preference is optimized with reference to Bacillus subtilis (strain 168).

[0055] Wherein, in step S3, the first restriction enzyme cutting site is BamHI and HindIII; the second restriction enzyme cutting site is BamHI and EcoRI.

[0056] Wherein, the ligase is T4 DNA ligase.

[0057] Example 1 Extraction of White Kidney Bean Alpha-Amylase Inhibiting Protein Gene (PASI)

[0058] S1. Extraction of Alpha-amylase Inhibiting Protein Gene (PASI) from White Kidney Bean

[0059] S11. Sample preparation: Select healthy white kidney bean seeds and avoid seeds with diseases or insect pests. Under sterile conditions, clean the surface of the seeds to remove possible contaminants. Freeze the cleaned seeds with liquid nitrogen and grind them into powder using a rapid grinder.

[0060] S12. RNA extraction: Transfer the seed powder to a sterile centrifuge tube, add 1 ml of TRIzol reagent to the seed powder, and incubate at room temperature for 5 minutes to fully dissolve the RNA. Then add 200 μl of chloroform, shake well, incubate at room temperature for 3 minutes, and then centrifuge at 12,000 rpm for 15 minutes to separate the phases.

[0061] S13. RNA precipitation: Transfer the supernatant from step S12 to a new centrifuge tube. Add an equal volume of isopropanol, gently invert the tube to mix, and incubate at room temperature for 10 minutes or in a -20°C refrigerator for at least 1 hour or overnight to precipitate RNA. Centrifuge at 12,000 rpm for 10 minutes to precipitate RNA and discard the supernatant.

[0062] S14. RNA washing and dissolution: Add 1 ml of 75% ethanol (precooled to -20°C), gently invert the centrifuge tube to mix, and then centrifuge at 7500 rpm for 5 minutes to wash the RNA precipitate. Use a pipette to absorb the upper layer of ethanol and dry the RNA precipitate at room temperature. After the centrifuge tube is dry, add 30-50 μl of RNase-free water or 1x TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) to resuspend the RNA precipitate, and finally store the dissolved RNA in a -80°C refrigerator for later use.

[0063] S2. RNA reverse transcription, first PCR and sequencing

[0064] S21. Reverse transcription: Take out the RNA sample from the -80℃ freezer, thaw it completely, and centrifuge it briefly to collect the liquid at the bottom of the tube.

[0065] Reverse transcription reaction mixture:

[0066] RNA sample: 5 μl,

[0067] Oligo(dT) primer: 1μl,

[0068] dNTP mix: 2 μl,

[0069] 5X reverse transcription buffer: 4 μl,

[0070] Reverse transcriptase Invitrogen SuperScript III: 1 μl,

[0071] RNase inhibitor: 1 μl;

[0072] The mixture was incubated at 25°C for 5 minutes, 50°C for 60 minutes, and then at 70°C for 15 minutes to complete the reverse transcription reaction and obtain cDNA.

[0073] S22. First round of PCR and sequencing verification: The predicted CDS sequence of the white kidney bean (Phaseolus vulgaris L.) alpha-amylase inhibitor gene was retrieved using the accession number XM_007159330.1 for primer design.

[0074] Forward Primer B1: ATGGGTTCAATCAATCTAGT

[0075] Reverse primer B2: TTGGTGCTGTTCAGACCAGG

[0076] Using the cDNA obtained by reverse transcription as a template and B1 and B2 as two primers, a PCR reaction was performed to obtain the PCR product:

[0077] The reaction system was as follows: 10X PCR buffer, 5 μl, 10 mM dNTP mixture, 1 μl, forward primer (10 μM), 1 μl, reverse primer (10 μM), 1 μl, Taq DNA polymerase (5 U / μl), 0.25 μl, cDNA template, 2 μl, sterile water, supplemented to a total volume of 50 μl; PCR reaction parameters were: PCR cycle number was set to 35 times, pre-denaturation: 95°C, 3 minutes, denaturation: 95°C, 30 seconds, annealing: 58°C, 30 seconds, extension: 72°C, 30 seconds, final extension: 72°C, 5 minutes.

[0078] S23. PCR product purification

[0079] Add 5 volumes of binding buffer to the PCR product and mix well. Transfer the mixture to the DNA Clean & Concentrator column. Centrifuge at 12000g for 1 minute to allow the DNA to bind to the column. Discard the waste liquid in the collection tube, but keep the column. Add 700μl of Wash Buffer to the column. Centrifuge at full speed for 1 minute, then discard the waste liquid. Repeat this step once. Centrifuge at full speed for 2 minutes to completely dry the column. Add the washing decolorizer to the column, centrifuge at full speed for 1 minute, then discard the waste liquid. Transfer the column to a new 1.5mL or 2mL centrifuge tube. Add 50-100μl of Elution Buffer or sterile water to the center of the column. Let stand for 2 minutes, then centrifuge at full speed for 1 minute to elute the DNA. Collect the eluted DNA and store at -20℃ or use it in subsequent experiments. A portion of the obtained DNA samples was sent to a sequencing service provider for sequencing to obtain the white kidney bean Alpha-amylase inhibitory protein gene (PASI). The white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.1.

[0080] Example 2 Construction of the first recombinant engineering bacteria (DE3-pET28a-PASI01)

[0081] S1. First codon optimization

[0082] The GC content and CAI value of the white kidney bean Alpha-amylase inhibitory protein gene in Example 1 were calculated, and then the white kidney bean Alpha-amylase inhibitory protein gene in Example 1 was first codon optimized according to the codon preference of Escherichia coli K12MG1655 to obtain the first white kidney bean Alpha-amylase inhibitory protein gene (PASI01), and the results were as follows:

[0083] The GC content of the Alpha-amylase inhibitory protein gene of white kidney bean before optimization was 45.92% and the CAI was 0.53; the GC content of the first Alpha-amylase inhibitory protein gene of white kidney bean (PASI01) after optimization was 52.84% and the CAI was 0.95; the CAI value after optimization reached 0.95, which is in line with the generally recognized reasonable range of 0.8-1. The specific sequence information of the first Alpha-amylase inhibitory protein gene of white kidney bean (PASI01) is shown in: SEQ ID NO.2.

[0084] The first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) was delivered to a biological company for synthesis, and after synthesis, the target gene was obtained by PCR on the vector returned by the company.

[0085] S2. PCR of target gene with restriction sites

[0086] The purpose of primer design is to introduce restriction sites BamHI / HindIII before and after the gene and add protective bases.

[0087] (1) Primer design: (The underlined part is the restriction site)

[0088] Forward primer: CAGGATCCGAATGGGTTCAATCAAT;

[0089] Back primer: CAAAGCTTTCTCAAACCAGGAACAG

[0090] (2) PCR reaction configuration:

[0091] The PCR reaction system (25 μl) is as follows:

[0092] 2.5 μl 10x PCR buffer, 2 μl dNTP mix (2.5 mM each), 1 μl forward primer (10 μM), 1 μl rear primer (10 μM), 1 μl product of the first round of PCR, add ddH2O to 25 μl;

[0093] (3) PCR reaction procedure:

[0094] Pre-denaturation: 94°C, 3 minutes; Denaturation: 94°C, 30 seconds; Annealing: 60°C, 30 seconds; Extension: 72°C, 60 seconds; Final extension: 72°C, 5 minutes; Keep at 4°C until the reaction tube is taken out; Cycle steps 2-4 for 35 cycles;

[0095] (4) Electrophoresis verification: Use 1% agarose gel to check the target size of the PCR product.

[0096] (5) PCR purification: The PCR purification process is the same as step S23 in Example 1 and will not be repeated here.

[0097] S3. Cloning and restriction endonuclease digestion of target gene in pET28a vector:

[0098] Prepare the following mixture in a microcentrifuge tube:

[0099] PCR product: 10 μl, 10X restriction enzyme digestion buffer: 5 μl, BamHI: 1 μl, HindIII: 1 μl, sterile water: add to 50 μl, incubate at 37°C for 2 hours.

[0100] Gel electrophoresis and DNA purification:

[0101] Prepare a 1% agarose gel and perform electrophoresis to separate and visualize the digestion products. Purify the target DNA fragment using a gel excision and DNA purification kit as previously described.

[0102] (3) Ligation reaction:

[0103] Prepare the following mixture in a microcentrifuge tube:

[0104] Purified PCR product: 50 ng, purified pET28a vector: 50 ng, 10X T4 DNA ligation buffer: 2 μl, T4 DNA ligase: 1 μl, sterile water: make up to 20 μl, incubate at room temperature for 1 hour, then treat at 65°C for 10 minutes to inactivate the ligase.

[0105] (4) Transformation (storage and expansion culture):

[0106] Take 100 μl of E. coli cells into a freezing tube, add 5 μl of the ligation reaction mixture, mix gently, and let stand on ice for 30 minutes. Heat shock in a 42°C water bath for 90 seconds, then quickly transfer to ice and cool for 2 minutes. Add 900 μl of SOC medium and shake and culture on a shaker at 37°C and 225 rpm for 1 hour. Take an appropriate amount of cell suspension and spread it on an LB agar plate (containing kanamycin), invert and culture overnight in a 37°C incubator, check for positive clones, and prepare pET28a-PASI01 plasmid.

[0107] S4. Construction of the first recombinant engineering bacteria (DE3-pET28a-PASI01)

[0108] (1) Plasmid transformation:

[0109] Take out the constructed pET28a-PASI01 plasmid from the -80℃ freezer and thaw it on ice. Take out the Escherichia coli Rosetta (DE3) competent cells (purchased externally) and thaw them on ice. Add 10μl of the plasmid solution to 50μl of the competent cells, mix gently, and let stand on ice for 30 minutes. Heat shock in a 42℃ water bath for 90 seconds, then quickly transfer to ice and let stand for 2 minutes. Add 250μl of LB medium to each tube, and then shake and culture at 37℃ and 225rpm for 1 hour to revive the cells. Spread 200μl of the cell suspension on an LB agar plate containing kanamycin and culture inverted at 37℃ overnight.

[0110] (2) Monoclonal selection and cultivation:

[0111] Positive transformants were selected from the transformation plate, and the results were verified by gel electrophoresis. Finally, positive strains that could be further used were obtained: the first recombinant engineered bacteria (DE3-pET28a-PASI01). The positive clone plate of the first recombinant engineered bacteria is shown in the figure below: Figure 4 shown.

[0112] Example 3 Construction of the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02)

[0113] S1. Second codon optimization

[0114] The GC content and CAI value of the white kidney bean Alpha-amylase inhibitory protein gene in Example 1 were calculated, and then the white kidney bean Alpha-amylase inhibitory protein gene in Example 1 was subjected to a second codon optimization according to the codon strain168 preference of Bacillus subtilis to obtain a second white kidney bean Alpha-amylase inhibitory protein gene (PASI02), and the results obtained were as follows:

[0115] The GC content of the white kidney bean Alpha-amylase inhibitory protein gene before optimization was 45.92% and the CAI was 0.53; the GC content of the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) after optimization was 40.95% and the CAI was 0.99; after optimization, the CAI reached 0.99, which is in line with the recognized reasonable range of 0.8-1. The specific sequence information of the second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) is shown in: SEQ ID NO.3.

[0116] The second white kidney bean Alpha-amylase inhibitory protein gene (PASI02) was delivered to a biological company for synthesis, and after synthesis, the target gene was obtained by PCR on the vector returned by the company.

[0117] S2. PCR of target gene with restriction sites

[0118] (1) Primer design: (The underlined part is the restriction site)

[0119] Forward primer: CGCGGATCCATGGGCTCTATCAACCT

[0120] Back primer: CGCGAATTCTTAAACAAGGAAAAGAACAA

[0121] (2) PCR reaction configuration:

[0122] The PCR reaction system (25 μl) was as follows: 2.5 μl 10× PCR buffer, 2 μl dNTP mix (2.5 mM each), 1 μl forward primer (10 μM), 1 μl rear primer (10 μM), 1 μl product of the first round of PCR, and ddH O was added to 25 μl;

[0123] (3) The PCR reaction procedure is as follows:

[0124] Pre-denaturation: 94°C, 3 minutes; Denaturation: 94°C, 30 seconds; Annealing: 60°C, 30 seconds; Extension: 72°C, 60 seconds; Final extension: 72°C, 5 minutes; Keep at 4°C until the reaction tube is taken out; Cycle steps 2-4 for 35 cycles;

[0125] S3. Cloning and restriction endonuclease digestion of target gene in pHY-P43 vector:

[0126] Prepare the following mixture in a microcentrifuge tube:

[0127] PCR product: 10 μl, 10X restriction enzyme digestion buffer: 5 μl, BamHI: 1 μl, EcoRI: 1 μl, sterile water: add to 50 μl, incubate at 37°C for 2 hours.

[0128] (2) Gel electrophoresis and DNA purification:

[0129] Prepare a 1% agarose gel and perform electrophoresis to separate and visualize the digestion products. Purify the target DNA fragment using a gel excision and DNA purification kit as previously described.

[0130] (3) Ligation reaction:

[0131] Prepare the following mixture in a microcentrifuge tube:

[0132] Purified PCR product: 50 ng, purified pHY-P43 vector: 50 ng, 10X T4 DNA ligation buffer: 2 μl, T4 DNA ligase: 1 μl, sterile water: make up to 20 μl, incubate at room temperature for 1 hour, then treat at 65°C for 10 minutes to inactivate the ligase.

[0133] (4) Transformation (storage and expansion culture):

[0134] Take 100 μl of E. coli cells into a cryovial, add 5 μl of ligation reaction mixture, mix gently, and place on ice for 30 minutes. Heat shock in a 42°C water bath for 90 seconds, then quickly transfer to ice and cool for 2 minutes. Add 900 μl of SOC medium and shake and culture on a shaker at 37°C and 225 rpm for 1 hour. Take an appropriate amount of cell suspension and spread it on an LB agar plate, invert and culture overnight in a 37°C incubator, check for positive clones, and prepare pHY-P43-PASI02 plasmid solution.

[0135] S4. Construction of the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02)

[0136] (1) Preparation of WB800N competent cells

[0137] Pick a fresh single colony of B.subtilis WB800n. Inoculate it into 5mL of LB liquid medium and culture it overnight at 37℃ and 200r / min. After that, take 500μL of the bacterial solution and transfer it to 50mL of GM proliferation medium, and continue to culture at 37℃ and 200r / min until the OD600 value of the bacterial solution reaches 1.0. Subsequently, transfer the bacterial solution to a sterilized 100mL centrifuge tube and cool it in an ice water bath for 10 minutes. After that, centrifuge at 5000r / min for 10 minutes at 4℃ to collect the bacteria. Wash the bacteria 3 to 4 times with pre-cooled electrotransformation buffer ETM. After washing, resuspend the bacteria in 500μL of ETM, and the electrotransformation competent cells of Bacillus subtilis WB800N are obtained.

[0138] (2) Plasmid transformation:

[0139] Add 5μl of pHY-P43-PASI02 plasmid solution to B.subtilis WB800N competent cells and mix well. After precooling for 5 minutes, add the mixed bacterial solution to a 2mm electroporation cup and use an electroporator to electroporate once at 2000V and 5ms. After electroporation, quickly add 1mL of RM recovery medium and recover at 37℃ and 200rpm for 4 hours. After centrifugation and resuspension, spread on solid LB medium containing ampicillin, place inverted culture in a 37℃ constant temperature incubator for 1 to 2 days to screen antibiotic-resistant strains.

[0140] (3) Monoclonal selection and cultivation:

[0141] Positive transformants were selected from the transformation plate, and the results were verified by gel electrophoresis. Finally, a positive strain that can be further used was obtained: the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02). The positive clone plate of the second recombinant engineered bacteria is shown in FIG. Figure 5 shown.

[0142] Example 4 Target protein expression and crude enzyme preparation of the first recombinant engineered bacteria and the second recombinant engineered bacteria S1. Target protein expression and crude enzyme preparation of the first recombinant engineered bacteria (DE3-pET28a-PASI01) strain

[0143] (1) Strain culture

[0144] A single colony of the first recombinant engineered bacteria (DE3-pET28a-PASI01) was picked and inoculated into 5 mL of LB liquid culture medium containing kanamycin, and cultured overnight at 37°C with a shaker at 220 rpm.

[0145] (2) Bacterial liquid dilution and induction of expression

[0146] Determine the OD600 of the overnight bacterial solution and dilute it to an initial OD value of 0.1. Continue to culture the diluted bacterial solution at 37°C until the OD600 reaches 0.6. Add IPTG to the culture to a final concentration of 1 mM. Continue to culture at 37°C for 4 hours to induce the expression of the target protein of the first recombinant engineered bacteria (DE3-pET28a-PASI01).

[0147] (3) Collect cells and lyse

[0148] Collect 1 mL of culture and collect cells by centrifugation (12000g, 4°C, 10 minutes). Resuspend cells in 500 μL lysis buffer. Lyse cells by ultrasonic treatment (30 seconds, cooling interval 30 seconds, 3 times in total). Centrifuge at 4°C and 12000 rpm for 30 minutes, and collect the supernatant, which is the crude enzyme solution of the first recombinant engineered bacteria (DE3-pET28a-PASI01).

[0149] S2. Expression of target protein and preparation of crude enzyme solution in the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02)

[0150] (1) Strain culture

[0151] A single colony of WB800N-pHY-P43-PASI02 was selected and inoculated into 5 mL of LB liquid medium containing ampicillin and cultured overnight at 37°C and 220 rpm shaking.

[0152] (2) Bacterial liquid dilution and expression

[0153] The P43 promoter is a constitutive promoter. Directly measure the OD600 of the overnight bacterial solution and dilute to an initial OD value of 0.1. Continue to culture at 37°C until the OD600 reaches 0.6. Add IPTG to the culture to a final concentration of 1 mM. Continue to culture at 37°C for 4 hours to induce the expression of the target protein in the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02).

[0154] (3) Collect cells and lyse

[0155] Collect 1 mL of culture and collect cells by centrifugation (12000 g, 4°C, 10 minutes). Resuspend cells in 500 μL lysis buffer. Lyse cells by ultrasonic treatment (30 seconds, cooling interval 30 seconds, 3 times in total). Centrifuge at 4°C and 12000 rpm for 30 minutes and collect the supernatant, which is the crude enzyme solution of the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02).

[0156] Example 5 Identification of target protein of the first recombinant engineered bacteria (DE3-pET28a-PASI01) strain

[0157] S1. Extraction and purification of target protein from the first recombinant engineering bacteria (DE3-pET28a-PASI01):

[0158] The supernatant of the crude enzyme solution of the first recombinant engineering bacteria (DE3-pET28a-PASI01) was taken and protein was purified using a Ni-NTA affinity chromatography column according to the manufacturer's instructions.

[0159] (1) SDS-PAGE gel electrophoresis:

[0160] Prepare 10% SDS-PAGE gel. Take appropriate amount of crude enzyme solution, flow-through solution, wash solution and eluent of the first recombinant engineered bacteria (DE3-pET28a-PASI01), add appropriate amount of 5X SDS loading buffer, and boil for 5 minutes to denature the protein. Load the sample into the gel well, add appropriate amount of protein marker, set the electrophoresis conditions to 80-120V, and run for 1-2 hours until the staining solution runs to the bottom of the gel.

[0161] (2) Staining and development:

[0162] After electrophoresis, the gel was placed in Coomassie Brilliant Blue R-250 staining solution for 30 minutes to 1 hour. The staining solution was removed and destaining was performed with a destaining solution (10% ethanol, 10% acetic acid) until the background was clear and the target protein band was clearly visible. The first recombinant engineering bacteria (DE3-pET28a-PASI01) expressed the first PASI recombinant protein. The SDS-PAGE image of the first PASI recombinant protein is shown in FIG. Figure 6 shown.

[0163] The results of SDS-PAGE electrophoresis showed that the first recombinant engineered bacteria (DE3-pET28a-PASI01) expressed the target pale spot, and the molecular weight of the first PASI recombinant protein was preliminarily estimated to be about 21 kDa (including a tag of about 3 kDa).

[0164] Example 6 Inhibitory Activities of the First PASI Recombinant Protein and the Second PASI Recombinant Protein on Alpha-Amylase The inhibitory activities of the first PASI recombinant protein and the second PASI recombinant protein on Alpha-amylase were tested using conventional amylase activity assay experiments.

[0165] Accurately weigh 5g of soluble starch and pre-dissolve it in 20mL of ultrapure water, heat and boil until completely dissolved, and dilute to 1000mL after cooling; accurately weigh 0.05g of Alpha-amylase powder and dilute to 100mL with enzyme diluent; prepare 1mL of the first PASI recombinant protein crude extract and the second PASI recombinant protein crude extract. According to the components in Table 1, add the corresponding solutions to the blank group and experimental groups 1-3, and set up three replicates for each group.

[0166] Table 1 Solution composition and enzyme activity, and inhibition rate of amylase in blank group and experimental groups 1-3

[0167] Group Starch solution Alpha-Amylase Solution First PASI recombinant protein crude extract Second PASI recombinant protein crude extract Enzyme activity Inhibition rate of Alpha-amylase Blank group √ / / / / / Experimental Group 1 √ √ / / 2.31 0 Experimental Group 2 √ √ √ / 1.36 0.42 Experimental Group 3 √ √ / √ 1.29 0.48

[0168] Specifically, the blank group contained only starch solution; 1 mL of amylase solution and 10 mL of starch solution were added to experimental groups 1-3, respectively. Among them, 1 mL of the first PASI recombinant protein crude extract and 1 mL of the second PASI recombinant protein crude extract were added to experimental groups 2 and 3, respectively, and incubated at 37°C for 10 minutes, followed by the addition of 5 mL of iodine solution and subsequent thorough mixing. The absorbance of each sample was measured at A580, and the enzyme activity and inhibition rate of each group of samples were calculated. The results are shown in Table 1 and Figure 7-8 shown.

[0169] The calculation formula of enzyme activity is as follows:

[0170]

[0171] The calculation formula of inhibition rate is as follows:

[0172]

[0173] The experimental results show that the proteins expressed by the first recombinant engineered bacteria (DE3-pET28a-PASI01) and the second recombinant engineered bacteria (WB800N-pHY-P43-PASI02) have an inhibitory effect on Alpha-amylase, and the proteins expressed by the two strains are Alpha-amylase inhibitory proteins.

[0174] The technical scheme discloses a recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, a recombinant engineered bacterium and a preparation method thereof. The white kidney bean Alpha-amylase inhibitory protein is obtained by a prokaryotic fermentation method, and the white kidney bean Alpha-amylase inhibitory protein gene is extracted and the first codon and the second codon are optimized respectively to make it more suitable for the translation mechanism of a specific host cell, thereby increasing the protein yield without changing the protein sequence, and respectively constructing a first white kidney bean Alpha-amylase inhibitory protein gene (PASI01) and a second white kidney bean Alpha-amylase inhibitory protein gene (PASI02), and respectively constructing a first recombinant plasmid (pET28a-PASI01), a first recombinant engineered bacterium (DE 3-pET28a-PASI01), the second recombinant plasmid (pHY-P43-PASI02), and the second recombinant engineered bacteria (WB800N-pHYP43-PASI02) were genetically optimized for two different microbial hosts, which expanded the scope of application of Alpha-amylase inhibitory protein in different biotechnology applications and increased its flexibility in industrial production and scientific research. The enzyme activity detection and inhibition rate test of the proteins expressed by the first engineered bacteria and the second engineered bacteria showed that the proteins expressed by the two strains had an inhibitory effect on Alpha-amylase, and the proteins expressed by the two strains were Alpha-amylase inhibitory proteins, which greatly increased the production of Alpha-amylase inhibitory proteins.

[0175] The Alpha-amylase inhibitory protein prepared by this technology is expected to be used in the fields of medicine and health products, food industry, biotechnology and industrial enzyme preparations. In medicine and health products, the prepared Alpha-amylase inhibitory protein can be incorporated into drug formulations or used as dietary supplements to utilize its inhibitory effect on amylase; in the food industry, the prepared Alpha-amylase inhibitory protein can be added to food as a processing ingredient to reduce the glycemic index (GI) of the food; in biotechnology applications, the prepared Alpha-amylase inhibitory protein can be used as part of a bioreactor to optimize the conversion process of biomass.

[0176] The technical principle of the present invention is described above in conjunction with specific embodiments. These descriptions are only for explaining the principle of the present invention and cannot be interpreted as limiting the scope of protection of the present invention in any way. Based on the explanations herein, those skilled in the art can associate other specific implementations of the present invention without paying creative labor, and these methods will fall within the scope of protection of the present invention.

Claims

1. A recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein, characterized in that: include: A first recombinant plasmid and / or a second recombinant plasmid; The first recombinant plasmid contains a first white kidney bean alpha-amylase inhibitory protein encoding gene; The second recombinant plasmid contains a second white kidney bean Alpha-amylase inhibitory protein encoding gene.

2. The recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein according to claim 1, characterized in that: The first white kidney bean Alpha-amylase inhibitory protein gene is obtained by subjecting the white kidney bean Alpha-amylase inhibitory protein gene to a first codon optimization, and the sequence of the first white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.

2.

3. The recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein according to claim 2, characterized in that: The second white kidney bean Alpha-amylase inhibitory protein gene is obtained by subjecting the white kidney bean Alpha-amylase inhibitory protein gene to a second codon optimization, and the sequence of the second white kidney bean Alpha-amylase inhibitory protein gene is shown in SEQ ID NO.

3.

4. The recombinant plasmid for expressing white kidney bean Alpha-amylase inhibitory protein according to claim 3, characterized in that: The white kidney bean Alpha-amylase inhibitory protein gene is derived from white kidney bean extract, and the white kidney bean Alpha-amylase inhibitory protein gene sequence is shown in SEQ ID NO.

1.

5. A recombinant engineered bacterium, characterized in that: include: The first recombinant engineered bacteria and / or the second engineered bacteria; The first recombinant engineering bacterium contains the first recombinant plasmid according to any one of claims 1 to 4, and the first recombinant engineering bacterium includes the nucleotide sequence shown in SEQ ID NO.2; The second recombinant engineered bacterium contains the second recombinant plasmid as described in any one of claims 1 to 4, and the second recombinant engineered bacterium includes the nucleotide sequence shown in SEQ ID NO.

3.

6. A method for preparing a recombinant engineered bacterium for expressing white kidney bean Alpha-amylase inhibitory protein, characterized in that: include: S1. Design specific primers for the white kidney bean Alpha-amylase inhibitory protein gene, and use the white kidney bean genomic cDNA as a template for PCR reaction; the amplified product is verified by gel electrophoresis and DNA sequencing to obtain the white kidney bean Alpha-amylase inhibitory protein gene; S2. using software tools to optimize the first codon of the white kidney bean Alpha-amylase inhibitory protein gene for the Escherichia coli expression system to obtain the first white kidney bean Alpha-amylase inhibitory protein gene, and to optimize the second codon of the white kidney bean Alpha-amylase inhibitory protein gene for the Bacillus subtilis expression system to obtain the second white kidney bean Alpha-amylase inhibitory protein gene; S3. Design primers to introduce a first restriction enzyme site into the first white kidney bean Alpha-amylase inhibitory protein gene and the pET28a vector, and introduce a second restriction enzyme site into the second white kidney bean Alpha-amylase inhibitory protein gene and the pHY-P43 vector; S4. using double enzyme digestion method to open the first white kidney bean Alpha-amylase inhibitory protein gene and the pET28a vector at the first enzyme digestion site; The second white kidney bean Alpha-amylase inhibitory protein gene and pHY-P43 vector were opened at the second restriction site by double enzyme digestion method; S5. The first open white kidney bean Alpha-amylase inhibitory protein gene was connected to the pET28a vector using a ligase to construct a first recombinant plasmid, and then the first recombinant plasmid was transformed into an expression vector EscherichiacoliRosetta using a heat shock method; S6. The opened second white kidney bean Alpha-amylase inhibitory protein gene was connected to the pHY-P43 vector using a ligase to construct a second recombinant plasmid, and then the second recombinant plasmid was transformed into the expression vector Bacillus subtilisWB800N using electroporation; S7. Dilute the bacterial solution cultured in S5 and S6 and spread them on kanamycin resistance medium, pick positive transformants, and obtain the first recombinant engineered bacteria and the second recombinant engineered bacteria, respectively; S8. The first recombinant engineered bacteria and the second recombinant engineered bacteria were inoculated into LB culture medium respectively, and IPTG was added to induce expression when the bacteria were propagated to the logarithmic phase.

7. The preparation method according to claim 6, characterized in that: In step S2, the first codon optimization of the white bean alpha-amylase inhibitory protein gene is performed for the Escherichia coli expression system, wherein the codon preference is referenced to Escherichia coli K12MG1655, and the rare codons or low-frequency codons of Escherichia coli, such as CCC, GGG, GGA, and AGG, are optimized.

8. The preparation method according to claim 6, characterized in that: In step S2, the white bean alpha-amylase inhibitory protein gene is subjected to a second codon optimization for the Bacillus subtilis expression system, wherein the codon preference is optimized with reference to Bacillus subtilis.

9. The preparation method according to claim 6, characterized in that: In step S3, the first restriction enzyme cutting site is BamHI and HindIII; the second restriction enzyme cutting site is BamHI and EcoRI.

10. The preparation method according to claim 6, characterized in that: In steps S5 and S6, the ligase is T4 DNA ligase.

Images