Ratio fluorescence aptamer sensor for detecting mercury ions based on fluorescence enhancement PCN-224

Abstract

The invention relates to the technical field of biosensors, and discloses a ratiometric fluorescence aptamer sensor for detecting mercury ions based on fluorescence enhanced PCN-224. According to the method, PCN-224 is modified by 1M Tris-HCl to prepare FE-PCN-224, a T-rich aptamer FAM-Apt marked by 6-FAM is used as a recognition element, mercury ions induce conformational change of the FAM-Apt, the fluorescence intensity of the FAM-Apt is reduced due to the formed photoinduced electron transfer effect between T-Hg < 2 + >-T and FAM, fluorescence of FE-PCN-224 is not affected, ratio fluorescence detection is achieved, the mercury ions can be specifically and sensitively detected, and the method has the advantages of high sensitivity, high sensitivity and high sensitivity. And the method is successfully used for quantitative analysis of mercury ions in river water and fish meat. Under the support of smart phone color analysis software, the fluorescent colorimetric card is prepared, and semi-quantitative detection is realized through naked eyes; and real color information under ultraviolet is converted into RGB values through an image processing algorithm, so that convenient quantitative detection is realized, and personnel undergoing minimum training can perform field detection conveniently. Therefore, the invention provides a potential way for rapid detection of mercury ion pollution, and has practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of biosensors, and specifically relates to a method for preparing fluorescence-enhanced PCN-224. A ratiometric fluorescence aptamer sensor for detecting mercury ions is established, and applied to the detection of mercury ions in river water and fish samples. At the same time, the prepared fluorescent colorimetric card can realize semi-quantitative detection of mercury ions by naked eyes, and can realize convenient quantitative analysis of mercury ions in combination with smartphone analysis software, thus providing a new method for rapid and convenient detection of mercury ions. Background Art

[0002] In recent years, heavy metal ions generated by different industrial and agricultural practices have flowed into food and environmental matrices, causing serious heavy metal pollution and becoming a major source of food safety issues. Mercury ions, as one of the most toxic heavy metals, can be enriched in important organs of the human body through the food chain even if ingested in trace amounts. They are easily combined with sulfhydryl groups in enzymes and proteins, causing irreversible damage to the human nervous system, kidneys, etc. Therefore, it is of great significance to develop a simple, rapid, highly sensitive and highly selective detection strategy to monitor mercury ions in food and the environment. At present, several effective analytical techniques have been applied to detect mercury ions, including inductively coupled plasma mass spectrometry (ICP-MS), atomic fluorescence spectroscopy (AFS), cold vapor atomic absorption spectroscopy (CV-AAS), etc. However, these technologies still have problems such as expensive instruments, complicated operating procedures and difficulties in on-site monitoring.

[0003] As a new generation of molecular recognition elements, nucleic acid aptamers play an important role in rapid detection. Mercury ions can replace the protons on thymine (T) in DNA molecules to form Hg 2+ -N covalent bond, eventually forming a stable T-Hg 2+ -T coordination complex. Based on the specific affinity effect between mercury ions and TT, a variety of mercury ion biosensors have been proposed, including surface enhanced Raman spectroscopy (SERS) detection, electrochemical biosensors, fluorescent biosensors, etc. Among these analytical methods, fluorescence determination has attracted widespread attention in many fields due to its high sensitivity, rapid response, easy operation and real-time detection possibility. However, single-emission fluorescent probes are interfered by various factors in practical applications, such as experimental conditions, local concentration of probes, light scattering caused by sample matrix, and instrument factors. These factors may lead to deviations in the measurement results and reduce the reliability of the method. In order to overcome these challenges, this method introduces ratiometric fluorescent probes to develop a fluorescent sensing method with dual emission signals, which significantly improves the signal-to-noise ratio and sensitivity of the detection method by comparing the ratio of fluorescence intensities at two different emission wavelengths.

[0004] PCN-224 (porous coordination network-224, PCN-224) is a representative luminescent MOF composed of a Zr6 metal node bridged by a carboxyl group of a porphyrin ligand. PCN-224 combines the optoelectronic properties of porphyrin, exhibits high chemical stability, and has a three-dimensional pore structure and a high specific surface area. Therefore, it has received widespread attention in various research fields. In many PCN-224-based fluorescence assays, PCN-224 is usually used as a typical fluorescence quencher to achieve target detection through photoinduced electron transfer (PET) and fluorescence resonance energy transfer (FRET). However, we found that fluorescence-enhanced PCN-224 (FE-PCN-224) prepared with a 1M Tris-HCl mixture can significantly enhance the fluorescence intensity of FAM-DNA in pure water, and its own fluorescence intensity does not change. Based on this finding and the above theory, using FE-PCN-224 as a reference signal and FAM-Apt as a response signal, we were able to construct a fluorescence quencher for Hg 2+ Detection of Ratiometric Fluorescent Biosensors. Summary of the invention

[0005] The purpose of the present invention is to solve the problems of expensive instruments, complicated operation procedures and difficult on-site monitoring in the prior art, and to provide a fluorescence enhanced PCN-224 prepared by modifying porphyrin MOFPCN-224 with 1M Tris-HCl, based on the specific recognition of mercury ions by thymine-enriched aptamers, and T-Hg 2+ -T and FAM, a simple and fast ratiometric fluorescent biosensor for detecting mercury ions was developed, which can achieve high sensitivity and specificity for mercury ions detection, and has shown good results in practical applications. The fluorescent colorimetric card prepared by combining smartphone software can achieve semi-quantitative detection by naked eyes, and convenient quantitative detection can be achieved by RGB channel analysis of real color images. Therefore, the present invention provides a potential way for rapid detection of mercury ion pollution, and has certain practical application value.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] A ratiometric fluorescence aptamer sensor for detecting mercury ions based on fluorescence enhanced PCN-224, the steps of which are as follows:

[0008] A. Preparation of fluorescence enhanced PCN-224; referred to as FE-PCN-224:

[0009] Preparation of PCN-224: 120 mg ZrOCl2·8H2O, 40 mg H2TCPP and 1.6 g BA were ultrasonically dissolved in 8 mL DMF using a polytetrafluoroethylene reactor, and the resulting mixture was incubated in an oven at 120 °C for 24 h; after being taken out and cooled to room temperature, the purple precipitate was centrifuged at 8000 rpm for 5 min and washed three times with DMF; finally, the obtained solid was dried in a vacuum freeze dryer for 12 h for further use;

[0010] Preparation of FE-PCN-224: 10 mg of PCN-224 was weighed and 1 mL of DMF was added to mix and completely dissolved; then 100 μL of 10 mg / mL PCN-224 solution was mixed with 1 M Tris-HCl buffer (pH 7.5) at a ratio of 1:49, and the mixture was stirred for 1 h; the prepared FE-PCN-224 was stored at 4°C in a dark place;

[0011] B. Mercury ion ratio fluorescence analysis:

[0012] First, 50 μL of 0.5 μM FAM-Apt sequence 1 (ttctttcttccccttgtttgtt) was stored at 95°C for 5 min and then slowly annealed to 25°C; 50 μL of mercury ion solution of different concentrations was added and incubated at 25°C for 20 min; finally, 50 μL of FE-PCN-224 (200 μg / mL) and 350 μL of pure water were added to a total volume of 500 μL.

[0013] The fluorescence spectrum was collected at an excitation wavelength of 495 nm. There were two fluorescence emission peaks at 518 nm and 650 nm. The fluorescence peak at 518 nm was emitted by the FAM fluorescent dye as a response signal, while the peak at 650 nm corresponded to the emission of zirconium-based MOFPCN-224 as a self-calibration signal. The fluorescence intensity ratio (F 518 / F 650 ) to quantify the concentration of mercury ions.

[0014] C. Smartphone on-site detection technology:

[0015] The color analysis software on the smartphone was used to automatically extract RGB values ​​by selecting points, and to export color blocks to generate a fluorescent colorimetric card, thereby achieving semi-quantitative detection of mercury ions by the naked eye. The G value of the RGB value of the analyzed image was used as the output signal, and a fitting curve of the G value and mercury ion concentration was established, allowing for convenient quantitative analysis of mercury ions in the range of 0.001–0.25 μg / mL.

[0016] The mechanism of the present invention is as follows:

[0017] In the present invention, PCN-224 is modified with 1M Tris-HCl to obtain fluorescence-enhanced PCN-224, and a thymine-rich mercury ion nucleic acid aptamer (FAM-Apt) labeled with 6-carboxyfluorescein is used as a recognition element. When mixed with FE-PCN-224 in pure water, the fluorescence intensity of FAM-Apt increases significantly, while the fluorescence intensity of FE-PCN-224 remains unchanged. When mercury ions are added, the conformation of FAM-Apt changes, and the formed T-Hg 2+ The PET interaction between -T and FAM will lead to a decrease in the fluorescence intensity of FAM-Apt, but will not affect the fluorescence of FE-PCN-224. Therefore, the fluorescence emission intensity of FE-PCN-224 is used as the reference signal, and the fluorescence emission intensity of FAM-Apt is used as the sensitive response signal for detecting mercuric ions. The gradient concentration of mercury ions can be detected by the ratio signal F 518 / F 650 The difference can be used to accurately identify the mercury ions, thereby realizing the ratio fluorescence detection of mercury ions. With the support of smartphone color analysis software, convenient quantitative detection can be achieved through RGB channel analysis of real color images; the prepared fluorescence colorimetric card can be used for semi-quantitative detection of mercury ions with the naked eye.

[0018] The ratiometric fluorescence biosensing method based on FE-PCN-224 and FAM-nucleic acid aptamer provided by the present invention provides a reliable platform for the rapid detection of mercury ion pollution. The prepared fluorescence colorimetric card and smartphone-assisted quantitative detection technology provide an effective means for simple and convenient on-site inspection of mercury ions. At the same time, it provides a new perspective for the FAM-Apt / MOF sensing method, showing great application prospects in environmental testing and food analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Example 2 is a schematic diagram of the principle of a ratiometric fluorescence aptamer sensor for detecting mercury ions based on fluorescence enhanced PCN-224.

[0020] Figure 2 : Powder state diagram of PCN-224 under natural light as described in Example 1.

[0021] Figure 3 : As described in Example 1, the state diagram of 200μg / mL FE-PCN-224 solution under natural light and ultraviolet light.

[0022] Figure 4: As described in Example 2, the feasibility of this method is verified by the fluorescence spectra of FAM-Apt, FE-PCN-224, FAM-Apt+FE-PCN-224, FAM-Apt+mercury ion, and FAM-Apt+mercury ion+FE-PCN-224.

[0023] Figure 5 : As described in Example 2, the ratiometric fluorescence aptamer sensor based on fluorescence enhanced PCN-224 detects mercury ions, and the fluorescence emission spectra of different concentrations of mercury ions (0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25, 0.5, 1 μg / mL) in the FAM-Apt + mercury ion + FE-PCN-224 system are present.

[0024] Figure 6 : As described in Example 2, it is the fluorescence intensity ratio F 518 / F 650 Linear relationship graph with mercury ion concentration.

[0025] Figure 7 :As described in Example 2, the sensor system is specific for detecting mercury ions. (The metal ion concentration is 0.25 μg / mL)

[0026] Figure 8 :As described in Example 2, the anti-interference property of the sensor system for detecting mercury ions. (The concentration of interfering substances is 1 μg / mL)

[0027] Fig. 9 : As described in Example 3, the ratio fluorescence aptamer sensor based on fluorescence enhanced PCN-224 detected mercury ions in Songhua River water, where the fluorescence intensity ratio F was 0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25 μg / mL in the presence of different concentrations of mercury ions (0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25 μg / mL) in the FAM-Apt+mercury ion+FE-PCN-224 system. 518 / F 650 Linear relationship graph with mercury ion concentration.

[0028] Fig.10 : As described in Example 3, the ratiometric fluorescence aptamer sensor based on fluorescence enhanced PCN-224 detects mercury ions in fish meat, where the fluorescence intensity ratio F is 0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25 μg / mL in the presence of different concentrations of mercury ions (0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25 μg / mL) in the FAM-Apt+mercury ion+FE-PCN-224 system. 518 / F 650 Linear relationship graph with mercury ion concentration.

[0029] Fig.11: As described in Example 4, a fluorescence colorimetric card output by a smartphone image analysis software based on a ratiometric fluorescence aptamer sensor of fluorescence-enhanced PCN-224.

[0030] Fig.12 : As described in Example 4, the smartphone image color analysis software based on the ratiometric fluorescence aptamer sensor of fluorescence enhanced PCN-224 is a linear relationship diagram between the G value and the mercury ion concentration at different concentrations of mercury ions (0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.25 μg / mL).

[0031] Fig.13 : As described in Example 4, a convenient analysis module for mercury ion concentration based on a ratiometric fluorescence aptamer sensor of fluorescence-enhanced PCN-224. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with the accompanying drawings.

[0033] Example 1: Preparation of fluorescence-enhanced PCN-224

[0034] Preparation of PCN-224: 120 mg ZrOCl2·8H2O, 40 mg H2TCPP and 1.6 g BA were ultrasonically dissolved in 8 mL DMF using a polytetrafluoroethylene reactor. The resulting mixture was incubated in an oven at 120 °C for 24 h. After cooling to room temperature, the purple precipitate was centrifuged at 8000 rpm for 5 min and washed three times with DMF. Finally, the obtained solid was dried in a vacuum freeze dryer for 12 h for further use ( Figure 2 );

[0035] Preparation of FE-PCN-224: 10 mg PCN-224 was weighed and 1 mL DMF was added to mix and completely dissolved; then 100 μL of 10 mg / mL PCN-224 solution was mixed with 1 M Tris-HCl buffer (pH 7.5) at a ratio of 1:49, and the mixture was stirred for 1 h to prepare a 200 μg / mL FE-PCN-224 solution ( Figure 3 ); the prepared FE-PCN-224 was stored at 4°C in the dark.

[0036] Example 2: Detection of mercury ions by ratiometric fluorescence aptasensor based on FE-PCN-224;

[0037] First, 50 μL of 0.5 μM FAM-Apt sequence 1 (ttctttcttccccttgtttgtt) was stored at 95°C for 5 min and then slowly annealed to 25°C. 50 μL of mercury ion solution of different concentrations was added and incubated at 25°C for 20 min. Finally, 50 μL of FE-PCN-224 (200 μg / mL) and 350 μL of pure water were added to make the total volume 500 μL.

[0038] The fluorescence spectrum was collected at an excitation wavelength of 495 nm. There were two fluorescence emission peaks at 518 nm and 650 nm. The fluorescence peak at 518 nm was emitted by the FAM fluorescent dye as a response signal, while the peak at 650 nm corresponded to the emission of zirconium-based MOFPCN-224 as a self-calibration signal. The fluorescence intensity ratio (F 518 / F 650 ) to quantify the concentration of mercury ions.

[0039] The principle of this method is feasible ( Figure 4 ), when the final mercury ion concentration was in the range of 0.001–1 μg / mL, as the mercury ion concentration increased, the fluorescence intensity of the system at 518 nm gradually decreased, while the fluorescence intensity at 650 nm remained basically unchanged ( Figure 5 ), which can realize the ratio fluorescence detection of mercury ions. In the range of final mercury ion concentration of 0.001–0.25 μg / mL, the fluorescence intensity ratio F 518 / F 650 It is linearly related to the concentration of mercury ions, and the linear equation is: F 518 / F 650 =-4.155C 汞离子 +2.194(R 2 =0.998), and the limit of detection (LOD) was 0.2 ng / mL ( Figure 6 ), meeting the detection requirements of mercury ions. The method constructed by the present invention has no response to potassium ions, silver ions, calcium ions, magnesium ions, zinc ions, lead ions, cadmium ions, nickel ions, cobalt ions, ferrous ions, iron ions and aluminum ions, and only mercury ions can cause significant changes ( Figure 7 ); In addition, common matrix interferences in water or fish samples, including L-histidine, L-tryptophan, tyrosine, glutamic acid, L-serine, glycine, arginine, L-lysine, phosphate, sulfate, vitamin B1, glucose, phenol and cholesterol, have little effect on the detection of mercury ions ( Figure 8 ). This indicates that the proposed ratiometric fluorescence detection strategy is highly selective for the analysis of mercury ions in complex samples.

[0040] Example 3: Determination of mercury ion content in actual samples

[0041] The present invention adopts the spike recovery method to detect mercury ions in actual samples, and explores its applicability and accuracy. The specific samples are environmental samples (Songhua River water) and food samples (fish meat). The raw material samples are pretreated, and the specific steps are as follows: adding different concentrations of mercury ions to the water sample, and then filtering with a 0.22μm water filter membrane. The fish meat samples are processed in accordance with the national food safety standards (GB 5009.268-2016). Among them, 0.5g of fish sample, 7.0mL of nitric acid, 1.0mL of hydrofluoric acid, 1.0mL of hydrogen peroxide and different concentrations of Hg 2+ The standard solution was digested by microwave. The sample was diluted to 50 mL with ultrapure water and the pH was adjusted to 7.0.

[0042] The final concentrations of mercury ions in the two samples were all 0.001, 0.01, 0.05, 0.1, 0.15, 0.2, and 0.25 μg / mL. The ratio fluorescence method developed by the present invention was used for detection. When the final concentration of mercury ions was in the range of 0.001–0.25 μg / mL, the fluorescence intensity ratio F 518 / F 650 They are linearly correlated with the mercury ion concentration. The linear equation of Songhua River water sample is: 518 / F 650 =-3.16C 汞离子 +2.601(R 2 =0.991)( Fig. 9 ), the linear equation of fish sample is: F 518 / F 650 =-2.298C 汞离子 +2.369(R 2 =0.993)( Fig.10 ) can realize the detection and analysis of environmental samples (Songhua River water) and food samples (fish meat).

[0043] After analyzing the mercury ions in the samples, the results were compared with those of ICP-MS. As shown in Table 1, Hg 2+ The recoveries ranged from 94.6% to 101.9%, and the relative standard deviations (RSD, n = 3) of different real samples ranged from 1.0% to 4.9%. It is noteworthy that the data were consistent with the ICP-MS results, demonstrating that the developed biosensor can quantitatively detect Hg in environmental and food samples. 2+ feasibility and has good application accuracy.

[0044] Table 1: Comparison of recovery rates between this method and ICP-MS (n=3)

[0045]

[0046] Embodiment 4: Smartphone on-site detection technology:

[0047] Using the color analysis software on the smartphone, the RGB values ​​are automatically extracted by selecting points, and the color blocks are exported to generate a fluorescent colorimetric card ( Fig.11 ), realize the semi-quantitative detection of mercury ions by naked eyes; take the G value of the RGB value of the analyzed image as the output signal, and establish the fitting curve of G value and mercury ion concentration ( Fig.12 ), in the range of 0.001–0.25 μg / mL, the equation of G value and mercury ion concentration is: G value = 147.660C 汞离子 +100.947(R 2 =0.990), and convenient quantitative analysis of mercury ions ( Fig.13 ).

Claims

1. A ratiometric fluorescence aptamer sensor for detecting mercury ions based on fluorescence enhanced PCN-224, characterized in that: The steps are as follows: A. Preparation of fluorescence enhanced PCN-224; referred to as FE-PCN-224: Preparation of PCN-224: 120 mg ZrOCl2·8H2O, 40 mg H2TCPP and 1.6 g BA were ultrasonically dissolved in 8 mL DMF using a polytetrafluoroethylene reactor, and the resulting mixture was incubated in an oven at 120 °C for 24 h; after being cooled to room temperature, the purple precipitate was centrifuged at 8000 rpm for 5 min and washed three times with DMF; finally, the obtained solid was dried in a vacuum freeze dryer for 12 h for further use; Preparation of FE-PCN-224: 10 mg PCN-224 was weighed, 1 mL DMF was added and mixed to completely dissolve; then 100 μL of 10 mg / mL PCN-224 solution was mixed with 1 M Tris-HCl buffer (pH 7.5) at a ratio of 1:49, and the mixture was stirred for 1 h to prepare a 200 μg / mL FE-PCN-224 solution; the prepared FE-PCN-224 was stored at 4°C in a dark place; B. Mercury ion ratio fluorescence analysis: First, 50 μL of 0.5 μM FAM-Apt sequence 1 (ttctttcttccccttgtttgtt) was stored at 95°C for 5 min and then slowly annealed to 25°C. 50 μL of mercury ion solution of different concentrations was added and incubated at 25°C for 20 min. Finally, 50 μL of FE-PCN-224 (200 μg / mL) and 350 μL of pure water were added to make the total volume 500 μL. The fluorescence spectrum was collected at an excitation wavelength of 495 nm. There were two fluorescence emission peaks at 518 nm and 650 nm. The fluorescence peak at 518 nm was emitted by the FAM fluorescent dye as a response signal, while the peak at 650 nm corresponded to the emission of zirconium-based MOFPCN-224 as a self-calibration signal. The fluorescence intensity ratio (F 518 / F 650 ) to quantify the concentration of mercury ions; C. Smartphone on-site detection technology: The color analysis software on the smartphone was used to automatically extract RGB values ​​by selecting points, and to export color blocks to generate a fluorescent colorimetric card, thereby achieving semi-quantitative detection of mercury ions by the naked eye. The G value of the RGB value of the analyzed image was used as the output signal, and a fitting curve of the G value and mercury ion concentration was established, allowing for convenient quantitative analysis of mercury ions in the range of 0.001–0.25 μg / mL.

2. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: 10 mg of PCN-224 as described in step A was added with 1 mL of DMF and mixed to completely dissolve.

3. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: 100 μL of the 10 mg / mL PCN-224 solution described in step A was mixed with 1M Tris-HCl buffer at a ratio of 1:49, the pH of the 1M Tris-HCl buffer was 7.5, and the mixture was stirred for 1 hour.

4. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: The concentration of FAM-Apt described in step B is 0.5 μM, the volume is 50 μL, and the concentration of FE-PCN-224 is 200 μg / mL, the volume is 50 μL.

5. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: The fluorescence spectrum is collected at an excitation wavelength of 495 nm as described in step B, and the fluorescence intensity ratio F 518 / F 650 Quantify the concentration of mercury ions.

6. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: Extract the RGB values ​​as described in step C, and derive the fluorescence colorimetric card generated by the color block.

7. A ratiometric fluorescence aptasensor for detecting mercury ions based on fluorescence enhanced PCN-224 as claimed in claim 1, characterized in that: The fitting curve is established by using the G value of the RGB value and the mercury ion concentration described in step C.

Images