Natural cleavage lignan component derivative DhpB and application thereof

Abstract

The invention discloses a natural schizolignan component derivative DhpB and application thereof, and particularly relates to application of the natural schizolignan component derivative DhpB as a covalent binding ubiquitinating enzyme MKRN2 target in resisting KRAS mutant lung cancer. The derivative is from a Piper plant of Pipeaceae, and through semi-synthetic structure optimization, in-vivo and in-vitro proliferation of KRAS mutant non-small cell lung cancer cells can be significantly inhibited, and tumor cell apoptosis can be induced. The DhpB is covalently bound with ubiquitinating enzyme MKRN2 abnormally expressed in KRAS mutant lung cancer cells, so that the combination of the MKRN2 and small ribosomal protein RPS7 is promoted, the ubiquitinating degradation of the RPS7 is promoted, and the ribosomal stress apoptosis of tumor cells is caused. The invention provides a new target and an inhibitor for preparing a medicine for treating the refractory KRAS mutant lung cancer, and has a good medicinal prospect.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and specifically relates to a natural schizolone component derivative DhpB and an application thereof. Background Art

[0002] KRAS mutant lung cancer is a common type of non-small cell lung cancer (NSCLC) with a poor prognosis, mainly due to the enhanced proliferation and metastasis of tumor cells caused by KRAS mutation (Cascetta et al. Cancers 2022, 14:5430). Although targeted drugs such as Sotorasib and Adagrasib have shown efficacy in clinical trials in recent years, there are still limitations in efficacy and tolerability, and tumor recurrence and drug resistance are still prominent (Awad et al. N Engl J Med, 84:2382-2393). Therefore, it is particularly important to develop new and efficient KRAS mutant lung cancer treatment drugs and find new anti-KRAS mutant lung cancer targets.

[0003] Some progress has been made in the study of natural products in the treatment of KRAS mutant lung cancer. For example, catechins and soy isoflavones have shown the potential to inhibit the growth of KRAS mutant tumor cells (Niloy et al. Curr Med Chem. 28, 8098–8115). In particular, the schizoloid components in the genus Piper have good anti-NSCLC activity (Wu et al. JNat Prod. 2006, 69: 790–794). Natural products have the advantages of less toxicity and novel targets as anticancer drug leads, but their targets and mechanisms are unclear, their bioavailability is low, and their drugability is poor. Therefore, it is a current challenge to modify the structure of natural products to improve their efficacy and drugability, and to clarify their mechanisms and targets against KRAS mutant lung cancer.

[0004] MKRN2 (Makorin Ring Finger Protein 2) is a protein that promotes degradation by ubiquitinating proteins. Studies have shown that the expression of MKRN2 in KRAS mutant NSCLC is closely related to lymph node metastasis, cancer differentiation and prognosis. Regulating the expression of MKRN2 can inhibit the migration and invasion of tumor cells by downregulating the PI3K / Akt pathway (Jiang et al. J Exp Clin Cancer Res. 2018, 37:189). Therefore, finding small molecule compounds targeting MKRN2 is of great significance for the treatment of KRAS mutant lung cancer.

[0005] Molecular glue drugs are a class of small molecule compounds that mediate protein-protein interactions and can change the protein recruitment of E3 ligase receptors, causing the target protein to be ubiquitin-tagged and degraded. They are characterized by the fact that they do not need to form a specific binding pocket on the target protein and are suitable for targets that are traditionally difficult to handle (Lemaitre et al. Expert Opin DrugDiscov. 2024;19:433-449). Compared with traditional PROTAC drugs, molecular glue drugs have advantages such as small molecular weight, high cell permeability, and good oral absorption, and have broad application prospects, especially in cancer treatment (Roman et al. Science.2024;386:eadl5361). Therefore, the development of new molecular glue small molecule anticancer drugs has a very bright prospect. Summary of the invention

[0006] In view of the deficiencies of the prior art, the present invention aims to provide a natural schizoloid component derivative DhpB and its application.

[0007] In order to solve the problems of the prior art, the present invention adopts the following technical solutions: A natural schizolignan derivative DhpB or a pharmaceutically acceptable salt thereof, wherein the structural formula of the natural schizolignan derivative DhpB is as follows: ; The salt is hydrochloride or phosphate.

[0008] As an improvement, the preparation method of the natural schizolone derivative DhpB is as follows: Step 1, synthesis of phenylselenide intermediate Under the protection of inert nitrogen gas, triethylamine was added to a solution of Peperomin B in dichloromethane in an ice bath, trimethylsilyl trifluoromethanesulfonate was added after the reaction, and the mixture was stirred at 0°C for 30 minutes, and then stirred at room temperature for 30 minutes, and a dichloromethane solution of phenylselenyl chloride was added to the mixture twice, and the reaction was reacted for 30 minutes each time, and finally the reaction mixture was warmed to room temperature and stirred for 1 hour. After the reaction was completed, a saturated aqueous ammonium chloride solution was added to quench the reaction, and the mixture was extracted with ethyl acetate to obtain a crude oily product; the product was purified by flash column chromatography to obtain a light yellow oily phenylselenide intermediate; Step 2, oxidative dephenylization The intermediate was dissolved in tetrahydrofuran, and glacial acetic acid was added. After reacting at 0°C for 10 minutes, 30% hydrogen peroxide was added, and the reaction was continued at 0°C for 40 minutes. A saturated sodium chloride solution was added to the mixture, and the mixture was extracted with ethyl acetate. Finally, the ethyl acetate extract was washed with a saturated sodium bicarbonate solution to obtain a crude crystalline product, which was purified by flash column chromatography (to obtain yellow crystal Dhp; Step 3, Synthesis of DhpB 2-(Methylamino)ethanol was added to a stirred methanol solution of Dhp and triethylamine, and the reaction mixture was stirred at room temperature for 12 hours. After the reaction was completed, the reaction mixture was concentrated under reduced pressure to obtain a crude product. Water was added to the crude product, and the product was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain a yellow compound DhpB.

[0009] As an improvement, in step 1, the molar ratio of trimethylsilyl trifluoromethanesulfonate to Peperomin B is 1:10-1:20; the molar ratio of phenylselenyl chloride added for the first time to Peperomin B is 1:1-5; and the molar ratio of phenylselenyl chloride added for the second time to Peperomin B is 1:1-2.

[0010] As an improvement, in step 2, the molar ratio of glacial acetic acid to the intermediate is 1:2 to 1:10; the molar ratio of hydrogen peroxide to the intermediate is 1:2 to 1:10.

[0011] As an improvement, in step 3, the molar ratio of 2-(methylamino)ethanol to Dhp is 1:1 to 1:2.

[0012] A pharmaceutical composition comprises the above-mentioned natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof.

[0013] As an improvement, the carrier of the pharmaceutical composition is an excipient, a filler, a binder, a lubricant, a disintegrant, an absorption promoter, an adsorption carrier or a surfactant.

[0014] As an improvement, the dosage form of the pharmaceutical composition is injection, tablet, soft capsule, pill or granule.

[0015] Use of the above-mentioned natural schizoloid derivative DhpB or its pharmaceutically acceptable salt or pharmaceutical composition in the preparation of drugs for treating KRAS mutant lung cancer.

[0016] As an improvement, the effective concentration of the natural schizophrenia derivative DhpB against lung cancer cells in vitro is 2.7-10 μM.

[0017] As an improvement, the effective dose of the natural schizophrenia derivative DhpB in KRAS mutant lung cancer model animals is 10 mg / kg.

[0018] As an improvement, the target of the drug is MKRN2.

[0019] As an improvement, the drug includes a drug that inhibits the proliferation of lung cancer cells, a drug that induces apoptosis of lung cancer cells, a drug that covalently targets MKRN2 protein, a drug that promotes ubiquitination of small ribosomal protein RPS7, or a drug that causes ribosome stress in cells.

[0020] Beneficial effects: Compared with the prior art, the natural schizolone derivative DhpB and its application in the present invention have the following advantages: 1. The DhpB of the present invention is a new structure of a medicinal schizophrenia derivative with good water solubility, and its water solubility is increased by 1000 times compared with the prototype; it is the first discovered covalent inhibitor of the ubiquitinase MKRN2, which promotes the degradation of RPS7 by increasing the binding of MKRN2 to the small ribosomal protein RPS7, and significantly inhibits the ribosome synthesis pathway highly expressed in KRAS mutant lung cancer cells. As a new type of ribosome synthesis inhibitor, it is non-toxic to normal cells, especially lung epithelial cells.

[0021] 2. The DhpB of the present invention can effectively inhibit the proliferation of KRAS mutant lung cancer cells in situ in the lungs at a corresponding dose; induce apoptosis of KRAS mutant lung cancer cells, and has good medicinal prospects in the treatment of KRAS mutant lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The synthetic route of the natural schizoloid component derivative Dhp B of the present invention is shown in the figure.

[0023] Figure 2 The CCK8 method was used to detect the proliferation inhibition effect at different drug doses and draw the dose-effect curve. (a) is the IC value of DhpB and its positive drug gemcitabine (GEM) on the proliferation inhibition of different non-small cell lung cancers. 50 (a) is the inhibitory curve of DhpB on the proliferation of different non-small cell lung cancer cells, BEAS-2B is a normal cell line (n=5), and (c) is the comparison of the inhibitory curves of DhpB and Peperomin B without α-methylene-γ-butyrolactone group on the proliferation of H1299 non-small cell lung cancer cells.

[0024] Figure 3The representative figure of Dhp B inhibiting the proliferation of KRAS mutant lung adenocarcinoma 3D cell spheres, where (a) is the cell status on day 1 and day 5 at different drug concentrations, (b) is the 3D cell sphere size change curve from day 1 to day 5, (c) is the expression level of Ki-67, a proliferation marker of 3D cell spheres at different drug concentrations, and the Ki-67 expression level, (d) is the expression level of Ki-67, a proliferation marker of 3D cell spheres at different drug concentrations, and the bar graph of Ki-67 expression level changes with concentration (n=5). The results are expressed as Mean ± SD; statistics were performed using t-test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.

[0025] Figure 4 (a) Representative flow cytometric images and apoptosis rate bar graphs showing the effect of 5 μM Dhp B on apoptosis of five types of lung adenocarcinoma cells and normal lung epithelial cells.

[0026] Figure 4 (b) Representative flow cytometry plots and apoptosis rate bar graphs of the apoptotic effects of different concentrations of Dhp B on sensitive lung cancer cells H1299. The experimental results are expressed as Mean ± SD, and the statistics were analyzed using the t-test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001 (n=3, gemcitabine (GEM) was the positive control drug).

[0027] Figure 5 (a) Representative flow cytometric images of the effect of 5 μM Dhp B on the cell cycle of five KRAS mutant lung adenocarcinoma cells and a bar graph showing the cell cycle ratio.

[0028] Figure 5 (b) is a representative flow cytometry graph and apoptosis rate bar graph of the apoptosis effect of different concentrations of Dhp B on sensitive lung cancer cells H1299. The above effect evaluation experiment n=3, the experimental results are expressed as Mean ± SD, and the statistics are analyzed by t test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.

[0029] Figure 6HE staining of lung tumors in LLC lung adenocarcinoma mice after treatment with each drug group (normal saline, Dhp B 50 mg / kg group, and gemcitabine (GEM) 10 mg / kg group) and box plots of tumor area (above), as well as representative fluorescence immunohistochemistry images of Ki67 (green) and TUNEL (red) in lung tumors after drug treatment and bar charts of their expression levels in tumor sections, DAPI (blue) was used for nucleus staining and fluorescence ratios were calculated. Experimental results are expressed as Median ± IQR or Mean ± SD, and statistics were performed using t-test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001 (n=3, gemcitabine (GEM) was the positive control drug).

[0030] Figure 7 The figure shows the Kaplan-Meier curves of the effects of different drug administration groups (normal saline, Dhp B 50 mg / kg group and gemcitabine (GEM) 10 mg / kg group) on the survival of model mice (n=10). The results are expressed as Mean ± SD; the statistics were analyzed by t test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.

[0031] Figure 8 (a) Western Blot verification results of H1299 cells stably transfected with sh-MKRN2 plasmid (left), statistical bar graph of CCK8 inhibition rate of MKRN2 knockdown cell lines after different drug treatments (Dhp B: 5μM; mean±SD, n=5; right), (b) apoptosis diagram and apoptosis rate statistics of MKRN2 knockdown cell lines treated with Dhp B (Dhp B: 5μM; mean±SD, n=3; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001, middle); (c) Sanger sequencing verification of MKRN2 WT and MKRN2 C335S The gene sequence of successful mutation, the mutation site is shown by the red line in the figure (left); (de) Proliferation and apoptosis results and statistical graphs of cells overexpressing MKRN2 treated with Dhp B (Dhp B: 5μM; mean±SD, n=3; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001, lower right).

[0032] Figure 9 shows proteins significantly bound to MKRN2 in different drug treatment groups identified by co-immunoprecipitation (CoIP)-MS, (A) proteins interacting with MKRN2 identified in the control group; (B) proteins interacting with MKRN2 identified in the Dhp B group; (C) proteins interacting with MKRN2-C335S identified in the control group; (D) proteins interacting with MKRN2-C335S identified in the Dhp B group. The fourth quadrant of the cross gate in the figure indicates proteins significantly enriched with P<0.05 and log2 fold change > 2. DETAILED DESCRIPTION

[0033] The present invention is described in further detail below in conjunction with examples, but embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are reagents, methods and equipment conventional in the art. Specific experimental conditions and test methods are not specified in the following examples, usually according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0034] Example 1 Preparation of compound DhpB Step 1, synthesis of phenylselenide intermediate Under the protection of inert nitrogen gas, triethylamine (7.2 mL) was added to a solution of Peperomin B (1.392 g, 0.054 mmol) in dichloromethane (24 mL) in an ice bath (0°C). After 10 minutes of reaction, trimethylsilyl trifluoromethanesulfonate (9 mL, 0.65 mmol) was added. The mixture was stirred at 0°C for 30 minutes and then continued to stir at room temperature for 30 minutes. Then, a dichloromethane solution of phenylselenyl chloride (1.866 g, 0.162 mmol and 936 mg, 0.081 mmol) was added to the mixture in two portions, each reacting for 30 minutes. The reaction mixture was warmed to room temperature and stirred for 1 hour. After the reaction was completed, a saturated aqueous solution of ammonium chloride was added to quench the reaction. Extraction with ethyl acetate (3×50 mL) gave a crude oily product. Purification by flash column chromatography (silica gel 200-300 mesh, column 1.5 cm id, petroleum ether:ethyl acetate 3:1) gave the phenylselenide intermediate (458 mg) as a pale yellow oil.

[0035] The NMR spectrum of the light yellow oily phenylselenide intermediate was consistent with that reported in the literature (Tsutsu et al. Bioorg Medi Chem Lett 2009, 15:4084-87).

[0036] Step 2, oxidative dephenylization The intermediate (458 mg, 0.0167 mmol) was dissolved in tetrahydrofuran (10.2 mL), and glacial acetic acid (180 µL, 0.045 mmol) was added. After reacting at 0°C for 10 minutes, 30% hydrogen peroxide (450 µL, 0.067mmol) was added and the reaction was continued at 0°C for 40 minutes. Saturated sodium chloride solution (60 mL) was added to the mixture, and it was extracted with ethyl acetate (3×50 mL). Finally, the ethyl acetate extract was washed with saturated sodium bicarbonate solution (2×50 mL) to obtain a crude crystalline product. Purification by flash column chromatography (silica gel 200-300 mesh, column 1.5 cm id, petroleum ether: ethyl acetate 3:1) gave yellow crystals Dhp (408.27 mg).

[0037] The NMR spectrum of yellow crystalline Dhp is consistent with that reported in the literature (Tsutsui et al. Bioorg MediChem Lett 2009, 15:4084-87).

[0038] Step 3, Synthesis of DhpB 2-(Methylamino)ethanol (240 μL, 0.3 mmol) was added to a stirred solution of Dhp (856 mg, 0.2 mmol) and triethylamine (0.6 mmol) in methanol (4 mL). The reaction mixture was stirred at room temperature for 12 hours. After the reaction was completed (monitored by thin layer chromatography), the reaction mixture was concentrated under reduced pressure to obtain a crude product. 10 mL of water was added to the crude product and extracted with dichloromethane (2×10 mL). The organic layer was dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography (n-hexane: ethyl acetate 3:1 to 1:1) to obtain a yellow compound DhpB (761 mg). The purity of the compound was determined by HPLC analysis and was 95%.

[0039] NMR data of DhpB 1H NMR (CDCl3, 500 MHz): δ 2.29 (m, 1H), 2.24 (t, J = 9.5 Hz, 2H), 2.03 (s, 3H), 2.46–2.49 (m, 1H), 2.62 (m, 1H), 3.58 (m, 2H), 3.70 (d, J =11.5 Hz, 1H), 3.78 (d, J = 11.5, 7.8, 4.6 Hz, 1H), 3.81 (s, 3H), 3.84 (s,6H), 3.91 (s, 3H), 4.01 (dd, J = 9.5, 4.6 Hz, 1H), 4.34 (dd, J = 9.5, 7.8 Hz,1H), 5.94–5.96 (m, 2H), 6.41 (br s, 1H), 6.44 (br s, 2H), 6.47 (br s, 1H). 13 C NMR (CDCl3, 125 MHz): δ 41.4, 42.6, 47.2, 55.6, 56.3, 57.0, 59.2,59.5, 60.9, 63.3, 69.7, 101.2, 101.5, 105.2, 108.2, 134.4, 136.0, 136.9,137.3, 143.7, 149.5, 153.4, 170.7.

[0040] Example 2 Inhibitory effect of DhpB on proliferation of KRAS mutant lung cancer cells and normal lung epithelial cells (1) CCK-8 experimental method KRAS mutant lung adenocarcinoma cells (H1299, H23, H1650, H1975, A549) and normal lung epithelial cells (BEAS-2B) in the logarithmic growth phase were obtained, among which the mutant lung adenocarcinoma cells (H1299, H23, H1650, H1975, A549) and normal lung epithelial cells (BEAS-2B) were from Wuhan Punosai Life Science Technology Co., Ltd.

[0041] Resuspend the cells in culture medium and count them with a cell counting plate, and dilute to 1 × 10 5 / mL, inoculated in a 96-well plate, 100 μL per well. Set up a blank group (DMSO), experimental group (DhpB, Peperomin B, referred to as PepB) and positive drug group (GEM), each group has 5 replicates. The experimental groups were added with final concentrations of 0.5, 1, 2, 4, 8, 16, 32, 64 μM DhpB and PepB (prototype), and final concentrations of 0.0625, 0.125, 0.25, 0.5, 1, 2, 4, 8 μM gemcitabine (GEM). The blank group and the control group were added with an equal volume of DMSO and cultured at 37°C for 48 hours. A mixture containing 10 μL CCK-8 solution and 100 μL basal culture medium was added to each well, incubated at 37°C for 1-4 hours, and the absorbance (OD value) of each well at a wavelength of 450 nm was measured using an enzyme reader to calculate the survival rate and obtain the IC50 value. That is, the half inhibitory concentration (IC50) of Dhp B on KRAS mutant lung adenocarcinoma cells and normal lung epithelial cells was calculated, and the anticancer activity of Dhp B and its prototype Pep B was compared (n=5). The results are expressed as Mean ± SD; statistics were performed using t-test; ns, no significant difference, *P<0.05, **P<0.01, ***P<0.001.

[0042] The composition of the basal culture medium used in the experiment was 90% RPMI-1640 + 10% fetal bovine serum + 1% penicillin G-streptomycin double antibody.

[0043] DhpB inhibits proliferation of KRAS mutant lung adenocarcinoma cells 50 Value Figure 2 As shown in the figure. DhpB significantly reduced the proliferation ability of five lung adenocarcinoma cell lines in the concentration range of 0.5~64 μM, among which H1299 cells were the most sensitive. It had no obvious cytotoxicity to normal lung epithelial cells BEAS-2B and had lower toxic and side effects than gemcitabine.

[0044] (2) 3D cell proliferation model experimental methods

[0045] Take H1299 cells in the logarithmic growth phase, resuspend them in culture medium and count them, dilute them to 2×10^5 cells / mL, and inoculate 100 μL per well in a 96-well U-shaped plate for 3D culture until the cells are clumped. Take a flat-bottomed 6-well plate, add 6 drops of 75 μL of Collagen Mix I to each well, and place them at 37°C for 30 minutes to solidify. Select the cell spheres in the 96-well U-shaped plate that are round and round, aspirate them with a large-caliber pipette, plant them on the Collagen Mix I gel, and culture them for 15-30 minutes to allow the cells to adhere. Add 75 μL of Collagen Mix II, place them at 37°C for 30 minutes to solidify, and add 2 mL of culture medium containing 10% FBS to each well. Treat the control group (no drug) and the DhpB administration group (2.5, 5, 10 μM) respectively. Observe the cell spheres microscopically within 5 days, measure the area changes by Image J software, and perform ki67 immunofluorescence staining.

[0046] 3D Cell Proliferation Assay Results:

[0047] DhpB can significantly inhibit the proliferation of 3D lung adenocarcinoma cell spheres (see Figure 3 Within 5 days, the cell sphere area of ​​the control group increased significantly, while the cell sphere area of ​​the drug-treated group was significantly inhibited to varying degrees.

[0048] Example 3 DHPB induces apoptosis of KRAS mutant lung cancer cells Experimental methods

[0049] Five KRAS mutant lung adenocarcinoma cells in the logarithmic growth phase were selected and counted using a cell counter and the cell density was adjusted to 2 mL per well and 2 × 10 5 Inoculate in 6-well plates, place in the incubator for 24 hours before drug treatment. Collect cells treated with different drugs, centrifuge at 1000 rpm, 4℃ for 5 minutes, and discard the supernatant. Add ice PBS to resuspend and wash cells, centrifuge at 1000rpm, 4℃ for 5 minutes, and discard the supernatant. Take 100 µL of cell suspension, add 5 µL Annexin V-FITC and 10 µL PI to mix, and incubate at room temperature in the dark for 20 minutes. After staining, add 400 µL PBS, pass through a 300-mesh cell sieve, and place in a flow tube. Use flow cytometry to detect, and FlowJo software to analyze the data.

[0050] Experimental Results

[0051] like Figure 4As shown in the figure, under the treatment of the control group, DhpB group (5 μM) and gemcitabine group (2.5 μM), the cell apoptosis showed that DhpB and gemcitabine significantly increased the apoptosis rate of various lung adenocarcinoma cells, which was significantly different from the control group (P < 0.001, P < 0.05). Among them, DhpB had the most obvious effect on inducing apoptosis of H1299 cells. Further, different concentrations of DhpB treatment groups (2.5, 5, 10 μM) were set up to observe their effects on cell apoptosis. The results showed that DhpB could induce apoptosis of H1299 cells in a dose-dependent manner, and the apoptosis rate increased significantly with the increase of concentration.

[0052] Example 4 DhpB induces cell cycle arrest in lung cancer cells Experimental methods H1299, H23, H1650, H1975, and A549 cells in the logarithmic growth phase were seeded in 6-well plates at a rate of 1×10 5 / mL, 2 mL per well. Add DhpB at a final concentration of 5 μM and gemcitabine at 2.5 μM, and an equal volume of DMSO (the final concentration was controlled below 0.1% (v / v)), respectively. After treating the cells for 48 hours, collect the cells by centrifugation. Wash twice with ice PBS, add 1 mL of 70% ethanol, and fix overnight at 4°C. The next day, collect the cells by centrifugation, add 0.5 mL of staining buffer, 10 μL of PI and 10 μL of RNase A to resuspend the cells, and incubate at 37°C in the dark for 30 minutes. Filter using a 300-mesh cell sieve, and set the flow cytometer parameters for detection according to the literature method.

[0053] Experimental Results

[0054] like Figure 5 As shown in the results, DhpB at a concentration of 5 μM can significantly block the cell cycle of five lung adenocarcinoma cells in the G2 phase (P< 0.001, P < 0.05), among which DhpB has the most significant cell cycle arrest effect on H1299 cells. Further, different concentrations of DhpB treatment groups (2.5, 5, 10 μM) were set up, and the results showed that DhpB can dose-dependently induce apoptosis of H1299 cells and block the cycle in the G2 phase.

[0055] Example 5 Evaluation of DhpB's anti-KRAS mutant lung cancer cell proliferation activity in vivo Experimental methods LLC cells in the logarithmic growth phase were collected by centrifugation and washed three times with ice-cold PBS to adjust the cell density to 1×10 7The cell suspension was placed in an ice box and the tail vein injection was completed within 30 minutes. The tail of the C57 mouse was disinfected with 75% alcohol, and the cell suspension was extracted with a 1 mL syringe and injected into the tail vein at 1 / 3-1 / 2 of the tip of the mouse tail. The model group was injected with 2×10 6 / 0.2 mL / cell suspension. One week after modeling, C57 mice were randomly divided into 3 groups: model group, DhpB group and gemcitabine group, with 10 mice in each group, and free access to water and diet. The mice were intraperitoneally injected, with the doses of 50 mg / kg and 10 mg / kg in the DhpB group and gemcitabine group, respectively, and the model group was given an equal volume of normal saline. The drug was administered once every two days, and the administration cycle was 2 weeks. One month later, the mice were killed by cervical dislocation, and the liver and lung tissues were taken, photographed and paraffin-embedded, sliced, and HE staining and Ki67 and TUNEL immunofluorescence double staining were performed to observe cell proliferation and apoptosis.

[0056] Experimental Results

[0057] As shown in Figure 6, the lung tumor area of ​​mice in the DhpB group was significantly lower than that in the model group (P < 0.001, P < 0.05). The results of double immunofluorescence staining of Ki67 and TUNEL in tumor sections of different treatment groups showed that the Ki67 / DAPI ratio in tumor sections of mice in the DhpB group and GEM group was significantly lower than that in the model group, indicating that both drugs can effectively inhibit cell proliferation; while the TUNEL / DAPI ratio was significantly higher than that in the model group, indicating that both drugs can effectively induce cell apoptosis.

[0058] Example 6: Study on the effect of DhpB on the survival of lung cancer model mice Experimental methods One week after the tail vein modeling, C57 mice were randomly divided into 3 groups: model group, DhpB group and gemcitabine group, with 10 mice in each group, and free access to water and diet. The DhpB group was given a dose of 50 mg / kg, the gemcitabine group was given a dose of 10 mg / kg, and the model group was given an equal volume of normal saline. The drug was administered once every two days, and the administration cycle was 2 weeks. After the end of the administration, the mice were raised normally, and the survival cycle of the mice was recorded within two months. When the weight loss of the mice was 20%, it was considered the end of life, and the mice were killed by cervical dislocation. The survival of the model mice in each group was evaluated using the Kaplan-Meier survival chart.

[0059] Experimental Results

[0060] According to the Kaplan-Meier graph of mouse survival rate (see Figure 7), compared with the model group, both the DhpB group and the gemcitabine group significantly increased the median pain-free survival time of the model mice (P=0.0059), indicating that DhpB can improve the quality of life of mice.

[0061] Example 7 In vivo and in vitro validation study of the MKRN2 target of DhpB Experimental methods: Using short hairpin RNA (shRNA, Target sequence-F:TGGGTGGAAGATCAGAATAAA, H1299 cells were transduced with lentiviral vectors containing target sequence-R: GGCACTGTGAGGTTCTTTAAT) or non-targeting control. Lentiviral vectors were prepared by co-transfecting shRNA plasmids and packaging plasmids into 293T cells using Lipofectamine 6000. Transduced cells were selected with puromycin (1 μg / mL) for 3 days, and MKRN2 expression was verified by Western blotting. MKRN2 was generated by site-directed mutagenesis using the QuickMutation Plus Site-Directed Mutagenesis Kit and wild-type MKRN2 plasmid as template. C335S Mutation plasmids. MKRN2 and its C335S mutant were re-expressed in MKRN2 knockdown H1299 cells. C335S Transduce cells with lentiviral vectors fused with the puromycin resistance gene. After production and transduction of lentiviral vectors, re-expressing cells were selected with puromycin (1 μg / mL) for 3 days. After construction of overexpression and knockdown cell lines, they were treated with Dhp B (5 μM) to evaluate cell proliferation and apoptosis effects.

[0062] Experimental results:

[0063] like Figure 8 As shown, knockdown of MKRN2 significantly promoted the proliferation of KRAS mutant human cells H1299, and the inhibitory effect of DhpB on the proliferation of the knockdown strain was significantly lower than that of the blank control group. The proliferation level of normal BEAS-2B lung glandular epithelial cells increased significantly after MKRN2 knockdown, and the inhibitory effect of DhpB on the corresponding knockdown strain was significantly lower than that of the blank control group. After MKRN2 knockdown, the pro-apoptotic effect of DhpB on the H1299 knockdown strain was significantly lower than that of the blank control group; after knocking down MKRN2 in normal BEAS-2B lung glandular epithelial cells, the pro-apoptotic effect of DhpB was also significantly reduced. MKRN2 is highly expressed in H1299 tumor cells WT, which can significantly inhibit the proliferation activity of the cells. After DhpB treatment, compared with the blank control Vector group, the high expression of MKRN2 WT The proliferation inhibitory activity of DhpB was significantly enhanced in the group, while high expression of MKRN2 C335S The corresponding proliferation inhibition activity was not enhanced in the group. WT Significantly promoted the apoptosis of H1299 tumor cells. After DhpB treatment, MKRN2 was highly expressed WT Compared with the blank control Vector group, the pro-apoptotic activity of DhpB was significantly enhanced in the group, while the high expression of MKRN2 C335S No corresponding pro-apoptotic effect was observed in the control group. In conclusion, MKRN2 is the main target of DhpB against KRAS mutant lung cancer, and its binding site is at C335.

[0064] Example 8 DhpB is a molecular glue between MKRN2 and RPS7 proteins in cells Point mutations were performed and verified on the p3XFLAG-CMV-14-MKRN2 plasmid. 293T cells were co-transfected with p3XFLAG-CMV-14-MKRN2 (MKRN2 sequence: NCBI Reference Sequence: NM_001271707.2) or p3XFLAG-CMV-14-MKRN2-C335S (mutation site verification see Figure 8 (c)) plasmids and treated with corresponding drugs (DMSO or DhpB 5μM). After 48 hours, the culture medium was removed, washed with PBS, and lysis buffer containing inhibitors was added. After lysis, centrifuged at 12000×g and 4ºC for 20 minutes, and the supernatant was collected. FLAG antibody magnetic beads were prepared and added to the protein lysates of different groups [including 3xFLAG MKRN2 WT (DMSO or DhpB), 3xFLAG MKRN2 C335S (DMSO or DhpB) group], incubated at 4ºC overnight. Magnetic separation and washing 3 times, finally eluted and neutralized Flag-tagged proteins and bound proteins with acidic eluent. Mass spectrometry pretreatment included DTT reduction, IAA alkylation, methanol and chloroform cleavage, urea buffer enzymatic hydrolysis and desalting. Samples were analyzed by LC-MS / MS on a ResprosilC18 AQ column, with an electron energy of 2.5 kV and a full scan range of m / z 300-2000. Tandem mass spectrometry analysis obtained a total ion chromatogram (TIC), and a series of MS / MS images were generated by collision-induced decomposition (CID). MaxQuant was used for data analysis, and Perseus software was used for subsequent data analysis and visualization of the quantitative results.

[0065] The processing results are as follows Fig. 9As shown in the figure, the proteins pulled down by FLAG antibody Co-IP were analyzed by LC-MS / MS. The results showed that compared with the empty plasmid group, the RPS7 ribosome-associated protein was significantly enriched in the MKRN2 WT group after treatment with 10μM DhpB (P<0.05, log2fold change>2). After DhpB treatment in the MKRN2 C335S group, the protein was not enriched. This indicates that in cancerous cells, DhpB promotes the binding between MKRN2-RPS7 and acts as a molecular glue.

Claims

1. A natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof, characterized in that: The structural formula of the natural schizolone derivative DhpB is shown below: ; The salt is hydrochloride or phosphate.

2. A natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The preparation method of the natural schizolone derivative DhpB comprises the following steps: Step 1, synthesis of phenylselenide intermediate Under the protection of inert nitrogen gas, triethylamine was added to a solution of Peperomin B in dichloromethane in an ice bath, trimethylsilyl trifluoromethanesulfonate was added after the reaction, and the mixture was stirred at 0°C for 30 minutes, and then stirred at room temperature for 30 minutes, and a dichloromethane solution of phenylselenyl chloride was added to the mixture twice, and the reaction was reacted for 30 minutes each time, and finally the reaction mixture was warmed to room temperature and stirred for 1 hour. After the reaction was completed, a saturated aqueous ammonium chloride solution was added to quench the reaction, and the mixture was extracted with ethyl acetate to obtain a crude oily product; the product was purified by flash column chromatography to obtain a light yellow oily phenylselenide intermediate; Step 2, oxidative dephenylization The intermediate was dissolved in tetrahydrofuran, and glacial acetic acid was added. After reacting at 0°C for 10 minutes, 30% hydrogen peroxide was added, and the reaction was continued at 0°C for 40 minutes. A saturated sodium chloride solution was added to the mixture, and the mixture was extracted with ethyl acetate. Finally, the ethyl acetate extract was washed with a saturated sodium bicarbonate solution to obtain a crude crystalline product, which was purified by flash column chromatography (to obtain yellow crystal Dhp; Step 3, Synthesis of DhpB 2-(Methylamino)ethanol was added to a stirred methanol solution of Dhp and triethylamine, and the reaction mixture was stirred at room temperature for 12 hours. After the reaction was completed, the reaction mixture was concentrated under reduced pressure to obtain a crude product. Water was added to the crude product, and the product was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain a yellow compound DhpB.

3. The natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: In step 1, the molar ratio of trimethylsilyl trifluoromethanesulfonate to Peperomin B is 1:10 to 1:20; the molar ratio of the first added phenylselenyl chloride to Peperomin B is 1:1-5; the molar ratio of the second added phenylselenyl chloride to Peperomin B is 1:1-2; in step 2, the molar ratio of glacial acetic acid to the intermediate is 1:2 to 1:10; the molar ratio of hydrogen peroxide to the intermediate is 1:2 to 1:10; and in step 3, the molar ratio of 2-(methylamino)ethanol to Dhp is 1:1 to 1:

2.

4. A pharmaceutical composition, characterized in that The invention comprises the natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof as claimed in claim 1.

5. The pharmaceutical composition according to claim 4, characterized in that The carrier of the pharmaceutical composition is an excipient, a filler, a binder, a lubricant, a disintegrant, an absorption promoter, an adsorption carrier or a surfactant; the dosage form of the pharmaceutical composition is an injection, a tablet, a soft capsule, a pill or a granule.

6. Use of the natural schizolone derivative DhpB or a pharmaceutically acceptable salt thereof according to claim 1 or the pharmaceutical composition according to claim 2 in the preparation of a drug for treating KRAS mutant lung cancer.

7. The use according to claim 6, characterized in that: The effective concentration of the natural schizoliganin derivative DhpB against lung cancer cells in vitro is 2.7-10 μM.

8. The use according to claim 6, characterized in that: The effective dose of the natural schizolone derivative DhpB in KRAS mutant lung cancer model animals is 10 mg / kg.

9. The use according to claim 6, characterized in that: The target of the drug is MKRN2.

10. The use according to claim 6, characterized in that: The drugs include drugs for inhibiting lung cancer cell proliferation, drugs for inducing lung cancer cell apoptosis, drugs for covalently targeting MKRN2 protein, drugs for promoting ubiquitination of small ribosomal protein RPS7, or drugs for causing ribosome stress in cells.

Images