Algae cellulose nanofiber aerogel material for detecting adulteration of meat products by LAMP (loop-mediated isothermal amplification) as well as preparation and application of seaweed cellulose nanofiber aerogel material

Abstract

The invention discloses a seaweed cellulose nanofiber aerogel material for LAMP (loop-mediated isothermal amplification) detection of meat product adulteration as well as preparation and application of the seaweed cellulose nanofiber aerogel material, and belongs to the technical field of food adulteration detection. The aerogel material has the characteristics of a hydrophilic outer surface, a hydrophobic inner cavity and positive charges, and can effectively adsorb and firmly bind negatively charged DNA in aerosol, so that aerosol pollution in an LAMP test is prevented, and false positive results are reduced. The preparation method is simple, the cost is low, the detection kit containing the aerogel material ensures effective control of aerosol pollution in the detection process, and the detection accuracy and reliability are improved. The detection method is simple and convenient to operate and easy to implement, can be widely applied to the field of meat product adulteration detection, and is expected to be expanded to the field of food detection of dairy products, aquatic products and the like. The method not only solves the problem that the existing LAMP technology is easily polluted by aerosol, but also improves the detection sensitivity and specificity, and has wide application prospect and important social value.

Description

Technical Field

[0001] The invention belongs to the technical field of food adulteration detection, and specifically relates to a seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration, and a preparation method and application thereof. Background Art

[0002] In the field of food safety, meat adulteration is a long-standing problem that not only harms the rights of consumers but also poses a threat to public health. In order to meet this challenge, researchers continue to explore and develop new detection technologies, among which loop-mediated isothermal amplification (LAMP) technology has attracted widespread attention due to its high efficiency, rapidity and simplicity.

[0003] Loop-mediated isothermal amplification (LAMP) technology is a nucleic acid amplification technology that amplifies target DNA under isothermal conditions. It does not require a thermal cycler, has a short reaction time, can usually be completed within one hour, and has high specificity and sensitivity. These characteristics give LAMP technology significant advantages in on-site rapid detection. In the LAMP detection process, SYBRGreen I dye is the most commonly used color developer for LAMP product analysis. If the dye is added to the LAMP reaction system in advance, the LAMP reaction will be severely inhibited. If the color developer is added after the reaction, the high concentration of amplification products is very likely to cause aerosol contamination during the open tube operation. Aerosols are dispersed systems composed of solid or liquid particles suspended in the air and biological molecules such as DNA, in which DNA itself is negatively charged. This aerosol contamination not only leads to a high false positive test result, but also may pose a potential biosafety risk to the experimental environment and personnel.

[0004] In order to solve this problem, researchers are actively exploring and improving the detection process and methods of LAMP technology, reducing the risk and impact of aerosol pollution by optimizing the method and time of adding the developer, improving the composition and stability of the reaction system, and strengthening the cleaning and disinfection of the experimental environment. At the same time, they are also actively developing and applying safer, more efficient and convenient LAMP detection technology to better serve the rapid detection needs in the field of food safety. Seaweed cellulose nanofiber is a nanoscale cellulose fiber prepared from seaweed cellulose. It is a new type of environmentally friendly material derived from marine algae and has broad application prospects. Seaweed cellulose nanofiber has excellent mechanical properties, good thermal stability, high hygroscopicity, biocompatibility and solubility. It is currently mainly used to prepare biomedical materials, such as tissue engineering scaffolds, wound dressings, etc. Because seaweed cellulose nanofiber has excellent mechanical properties and thermal stability, as well as good biodegradability, it can be used to prepare environmentally friendly food packaging materials, and can also be used to prepare high-strength textiles and reinforcement materials in building materials; there have been related Related literature prepares cationic seaweed cellulose nanofibers from seaweed cellulose through the quaternary ammonium salt method, and applies them to the removal of nanoplastics in single-pollutant and co-pollutant systems based on their excellent adsorption properties and surface charge characteristics. However, although cationic seaweed cellulose nanofibers have excellent adsorption properties, due to the more complex and stringent requirements for removing aerosol DNA in LAMP detection, their adsorption capacity is significantly reduced in actual applications due to the influence of the LAMP reaction system environment, and the stability and reusability of the material cannot be guaranteed. Therefore, there is an urgent need for a material whose adsorption capacity is not disturbed or affected by the LAMP reaction system and is stable and reusable. Summary of the invention

[0005] In view of the problem that the existing loop-mediated isothermal amplification detection method is easily contaminated by aerosols in the environment and causes false positives, cationic seaweed cellulose nanofibers are used in LAMP detection to adsorb DNA in aerosols, which is easily disturbed and affected by the LAMP reaction system, resulting in poor stability and poor adsorption capacity. The present invention aims to provide a seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration, as well as its preparation and application.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The invention provides a method for preparing a seaweed cellulose nanofiber aerogel material for detecting adulteration of meat products by LAMP, comprising the following steps: adding β-cyclodextrin to cationic seaweed cellulose nanofibers, heating and stirring to obtain a mixed suspension, and absorbing the mixed suspension for vacuum freeze drying to obtain the seaweed cellulose nanofiber aerogel material.

[0008] The cationic seaweed cellulose nanofibers are obtained by the following steps: sodium hydroxide solution, distilled water and 2,3-epoxypropyltrimethylammonium chloride are sequentially added to the seaweed cellulose to obtain a seaweed cellulose mixture, pH value is adjusted, oxidation, washing and homogenization are performed to obtain the cationic seaweed cellulose nanofibers.

[0009] Furthermore, the amount of sodium hydroxide solution added is 20% to 25% of the mass of the seaweed cellulose, the amount of distilled water added is 30% to 40% of the mass of the seaweed cellulose, and the amount of 2,3-epoxypropyltrimethylammonium chloride added is 20% to 30% of the mass of the seaweed cellulose. The seaweed cellulose mixture is obtained by stirring at 60 to 80° C. for 8 to 10 hours.

[0010] Furthermore, the pH value is adjusted to 4-5, and the oxidation is carried out by stirring a NaClO2 solution with a mass concentration of 1%-2% at 70-90°C for 3-5h.

[0011] Furthermore, the pH value is adjusted to 4.6, and the oxidation is carried out by stirring a NaClO2 solution with a mass concentration of 1% at 80°C for 4 hours.

[0012] The molar ratio of the beta-cyclodextrin to the cationic seaweed cellulose nanofibers is 1:1-2, the heating temperature is 55-65° C., and the stirring time is 4-6 hours.

[0013] Furthermore, the volume of the aspirated mixed suspension is 100-200 μL and is vacuum freeze-dried in a 96-well ELISA plate.

[0014] Furthermore, the volume of the aspirated mixed suspension is 200 μL and the mixture is vacuum freeze-dried in a 96-well ELISA plate.

[0015] The present invention provides a seaweed cellulose nanofiber aerogel material obtained by the preparation method and used for LAMP detection of adulteration of meat products.

[0016] The invention provides a LAMP detection kit, which comprises the seaweed cellulose nanofiber aerogel material.

[0017] The LAMP detection kit also includes a LAMP reaction mixture and a nucleic acid dye.

[0018] Furthermore, the LAMP reaction mixture includes a target DNA template, a target DNA primer, a buffer and BstDNA polymerase.

[0019] The present invention provides the use of the seaweed cellulose nanofiber aerogel material or the LAMP detection kit in LAMP detection of adulteration of meat products.

[0020] The present invention provides a method for detecting adulteration of meat products by LAMP, wherein the seaweed cellulose nanofiber aerogel material is placed at the PCR tube mouth to adsorb and fix aerosol particles in the environment to enter the detection system, thereby reducing the occurrence of false positive results.

[0021] The LAMP method for detecting adulteration of meat products comprises adding DNA of the meat product to be tested and a LAMP reaction mixture into a PCR tube, adding a nucleic acid dye into the inner wall of the PCR tube cover, and observing the color change of the liquid in the PCR tube after the reaction. If the color changes, the meat product to be tested is adulterated; if the color does not change, the meat product to be tested is not adulterated.

[0022] The LAMP reaction conditions are as follows: incubating at 60-70° C. for 30-50 min and heating at 80-90° C. for 5 min to terminate the reaction.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] The invention provides a method for preparing a seaweed cellulose nanofiber aerogel material for detecting adulteration of meat products by LAMP. The method successfully prepares cationic seaweed cellulose nanofibers by adding sodium hydroxide solution, distilled water and 2,3-epoxypropyltrimethylammonium chloride, adjusting pH value, oxidation and homogenization. The method not only gives the fibers the characteristic of carrying a positive charge, but also enhances their dispersibility and stability in water. The method introduces β-cyclodextrin and heats and stirs to graft hydrophobic cavities on the surfaces of the cationic seaweed cellulose nanofibers. This innovative step not only improves the adsorption capacity of the material, but also makes the adsorbed DNA more firmly bound in the hydrophobic cavity, thereby effectively preventing the release and contamination of the DNA. The seaweed cellulose nanofibers are widely available and inexpensive, which reduces the preparation cost. The preparation process is relatively simple and easy to control, and does not require complex instruments and equipment and cumbersome operating steps, further improving the cost-effectiveness.

[0025] The seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration provided by the present invention has cationic seaweed cellulose nanofibers interwoven with each other to form a stable and porous three-dimensional network structure, which provides solid support for the entire material; beta-cyclodextrin molecules are grafted on the surface of the cationic seaweed cellulose nanofibers through chemical bonds or physical effects to form a functional layer with hydrophobic cavities, which can adsorb and fix negatively charged DNA molecules in aerosols, effectively preventing them from entering the detection system and causing pollution; due to the combined effect of the cationic seaweed cellulose nanofibers and the grafted beta-cyclodextrin, the seaweed cellulose nanofiber aerogel material has a rich porous structure, which provides more space and opportunities for the adsorption and fixation of DNA, and also improves the specific surface area and adsorption efficiency of the material. Therefore, the seaweed cellulose nanofiber aerogel material of the present invention has a strong removal ability for DNA that causes LAMP test contamination in terms of structure and properties, thereby preventing them from entering the detection system, effectively solving the problem of aerosol pollution in the LAMP technology, reducing the occurrence of false positive results, and having significant advantages and application prospects in the field of meat product adulteration detection.

[0026] The detection kit provided by the present invention includes seaweed cellulose nanofiber aerogel material, which ensures the effective control of aerosol pollution during the detection process, improves the accuracy and reliability of the detection, and can more accurately identify specific gene sequences or components in meat products, thereby quickly and accurately judging whether the meat products are adulterated. The design of the kit makes the operation process simple and easy, without the need for complex instruments and equipment and cumbersome operating steps, thereby reducing the difficulty and cost of detection.

[0027] The application provided by the present invention applies seaweed cellulose nanofiber aerogel material to the detection of adulteration of meat products for the first time, and utilizes its unique physical and chemical properties to effectively solve the problem of aerosol pollution in LAMP technology; seaweed cellulose nanofiber aerogel material has excellent adsorption performance, and can efficiently adsorb and fix aerosol particles in the environment, thereby preventing them from entering the detection system and reducing the occurrence of false positive results; by introducing seaweed cellulose nanofiber aerogel material, the detection method of the present invention further improves the sensitivity and specificity of detection while maintaining the original advantages of LAMP technology; the introduction of seaweed cellulose nanofiber aerogel material can also optimize the reaction conditions of the detection system, making the reaction more stable and controllable, thereby improving the accuracy and reliability of detection. The detection method of the present invention is simple to operate and easy to implement, without complex instruments and equipment and cumbersome operating steps. Since seaweed cellulose nanofibers are widely available and inexpensive, the detection method of the present invention also has significant advantages in terms of cost-effectiveness.

[0028] The detection method of the present invention can be widely used in the field of meat product adulteration detection. By detecting specific gene sequences or components in meat products, it can quickly and accurately determine whether the meat products are adulterated. In addition to meat product adulteration detection, it can also be expanded to other food detection fields, such as dairy products, aquatic products, etc. It not only solves the problem of susceptibility to aerosol contamination in the existing LAMP technology, but also improves the sensitivity and specificity of detection. It has broad application prospects and important social value. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a microstructure comparison diagram of the seaweed cellulose nanofiber aerogel material of the present invention, wherein A is the seaweed cellulose nanofiber aerogel material, and B is the seaweed cellulose nanofiber;

[0030] Figure 2 This is a Zeta potential comparison diagram of the seaweed cellulose nanofiber aerogel material of the present invention, wherein A is the seaweed cellulose nanofiber aerogel material, and B is the seaweed cellulose nanofiber;

[0031] Figure 3 This is a comparison chart of the application of the seaweed cellulose nanofiber aerogel material of the present invention in LAMP detection of adulteration of meat products, wherein A is the detection result of the seaweed cellulose nanofiber aerogel material of the present invention, and B is the control. DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0033] The present invention is further described in detail below in conjunction with the accompanying drawings:

[0034] Example 1

[0035] This embodiment provides a seaweed cellulose nanofiber aerogel material, and the specific preparation method is as follows:

[0036] 13.75 mL of 20% NaOH and 20 g of distilled water were added to seaweed cellulose (derived from kelp cellulose, purity 99%), and stirred; 12.6 g of 2,3-epoxypropyltrimethylammonium chloride was added, and stirred at 65 ° C for 8 h to dissolve to obtain a seaweed cellulose mixture; 1.2 g of After NaOH pellets, adjust the pH to 4.6 with 0.1M CH3COOH solution, then add 1% NaClO2 of the total solution mass, and stir at 80°C for 4h; wash with deionized water until the pH of the filtrate reaches 7, then the washing is completed, and homogenize at 30,000r / min for 10min to obtain cationic seaweed cellulose nanofibers; 5.11g β-cyclodextrin is dissolved in 2% sodium hydroxide solution, mixed with 100g cationic seaweed cellulose nanofibers, stirred at 60°C for 5h to obtain a mixed suspension, and 200μL of the mixed suspension is aspirated and placed in a 96-well ELISA plate, and vacuum freeze-dried for 48h to obtain seaweed cellulose nanofiber aerogel material, named CNFs-CD.

[0037] Example 2

[0038] This embodiment provides a seaweed cellulose nanofiber aerogel material, and the specific preparation method is as follows:

[0039] 13.75 mL of 20% NaOH and 20 g of distilled water were added to seaweed cellulose (derived from kelp cellulose, purity 99%), and stirred; 12.6 g of 2,3-epoxypropyltrimethylammonium chloride was added, and stirred at 65 ° C for 8 h to dissolve to obtain a seaweed cellulose mixture; 1.2 g of After NaOH pellets, adjust the pH to 4.6 with 0.1M CH3COOH solution, then add 1% NaClO2 of the total solution mass, and stir at 80°C for 4h; wash with deionized water until the pH of the filtrate reaches 7, then the washing is completed, and homogenize at 30,000r / min for 10min to obtain cationic seaweed cellulose nanofibers; 5.11g β-cyclodextrin is dissolved in 2% sodium hydroxide solution, mixed with 100g cationic seaweed cellulose nanofibers, stirred at 60°C for 5h to obtain a mixed suspension, and 100μL of the mixed suspension is aspirated and placed in a 96-well ELISA plate, and vacuum freeze-dried for 48h to obtain seaweed cellulose nanofiber aerogel material, named CNFs-CD2.

[0040] Comparative Example 1

[0041] Weigh 13.75g NaOH and 20g distilled water and add them to seaweed cellulose while stirring; continue to add 12.6g 2,3-epoxypropyltrimethylammonium chloride, stir at 65°C for 8h to dissolve, and obtain a seaweed cellulose mixture; add 1.2g NaOH particles to the seaweed cellulose mixture, adjust the pH to 4.6 with 0.1MCH3COOH, then add 1% NaClO2 of the total solution mass, and stir at 80°C for 4h; wash with deionized water until the pH of the filtrate is consistent with the pH of water and reaches 7, then the washing is completed, homogenize at 30,000r / min for 10min to obtain cationic seaweed cellulose nanofibers, absorb 200μL of cationic seaweed cellulose nanofibers and put them in a 96-well ELISA plate, vacuum freeze-dry for 48h, and you can get an aerogel material named CNFs.

[0042] Example 3

[0043] This example tests the materials obtained in Example 1 and Comparative Example 1 on the basis of Examples 1-2.

[0044] (1) Determination of solid content of cationic seaweed cellulose nanofibers

[0045] The obtained cationic seaweed cellulose nanofibers were placed in an oven at 95-105°C, dried for 3-5 hours, and weighed to a constant weight. The mass of the cationic seaweed cellulose nanofibers before drying was recorded as m1, and the mass of the cationic seaweed cellulose nanofibers after drying was recorded as m2. The solid content was obtained by the following formula:

[0046]

[0047] The solid content of the cationic seaweed cellulose nanofibers was calculated to be 4.5 wt %.

[0048] (2) Microstructure observation

[0049] The microstructure of the materials of Example 1 and Comparative Example 1 was observed using a scanning electron microscope. First, in the middle of the sample stage, a small amount of freeze-dried sample was evenly pasted on the surface of the conductive glue, and then gold was sprayed on the sample surface using an ion sputtering coater for observation. The cross-section and surface of the two aerogel materials were observed using 15 kV. The specific results are shown in the attached Figure 1 shown.

[0050] By the attached Figure 1From the data, it can be seen that significant differences were observed in the surface structure of the microstructures of the two materials in Example 1 and Comparative Example 1. The surface of CNFs is smooth, while the surface of CNFs-CD material is porous, which is related to the structure of β-CD. β-CD is a cyclic polysaccharide composed of 7 units of glucose (α-d-glucopyranose) connected by α-(1,4) type bonds, with a hydrophilic outer surface and a hydrophobic inner cavity; both materials are composed of multiple clusters of fibers, and the size and structure of the fiber units are similar. This is because seaweed fibers are aggregated from multiple bundles of fibers, and there is no significant difference between CNFs and CNFs-CD.

[0051] (3) Zeta potential measurement

[0052] The materials obtained in Example 1 and Comparative Example 1 were dissolved in distilled water to prepare a solution of a certain concentration. A laser particle size analyzer was used to measure the potential at a temperature of 25°C, a balancing time of 90 seconds, and a cycle number of 20 times. For specific results, see the attached Figure 2 shown.

[0053] By the attached Figure 2 From the data, it can be seen that both materials in Example 1 and Comparative Example 1 are positively charged, indicating that the surface of the nanofibers prepared from seaweed cellulose by the quaternary ammonium salt method has been successfully modified to be positively charged, and the surface charge of CNFs-CD is significantly lower than that of CNFs. This is because the addition of β-CD modifies the surface of CNFs, so that the positively charged groups on the surface of CNFs are covered by β-CD, reducing their exposure.

[0054] This experiment verified the surface charge properties of CNFs and CNFs-CD through potentiometric measurement. Both materials were positively charged and the surface charge of CNFs-CD was lower than that of CNFs.

[0055] Example 4

[0056] In this embodiment, on the basis of embodiments 1 to 3, the seaweed cellulose nanofiber aerogel material obtained in embodiment 1 of the present invention is applied to LAMP detection of adulteration of meat products, and the specific steps are as follows:

[0057] The seaweed cellulose nanofiber aerogel material obtained in Example 1 was placed at the mouth of a PCR tube, and 25 μL of a standard LAMP reaction mixture was added to the tube: 2.5 μL of 10×ThermolPol buffer, 1.5 μL of 6 mM MgSO4, 1.0 μL of FIP and BIP, 0.5 μL of F3 and B3, 3.5 μL of 1.4 mM dNTPs, 1.0 μL of 8 U Bst DNA polymerase, 1 μL of DNA template (100 ng / μL) or distilled water (blank control), and distilled water was used to make up to 25 μL; the DNA template was DNA extracted from animal tissues of cattle, sheep, pigs, chickens, and ducks, and a blank control group was set up at the same time; then 1 μL of 1:1000 SYBR GreenI nucleic acid dye, carefully close the tube cover; place the PCR tube on the floating plate, put it in a water bath and incubate at 63℃ for 40min, then heat at 85℃ for 5min to terminate the reaction; observe and record the color change of the liquid in the reaction tube, green indicates positive, and orange indicates negative.

[0058] Comparative Example 2: No seaweed cellulose nanofiber aerogel material is placed at the mouth of the PCR tube. 25 μL of standard LAMP reaction mixture is added to the tube: 2.5 μL of 10×ThermolPol buffer, 1.5 μL of 6 mM MgSO4, 1.0 μL of FIP and BIP, 0.5 μL of F3 and B3, 3.5 μL of 1.4 mM dNTPs, 1.0 μL of 8 U Bst DNA polymerase, 1 μL of DNA template (100 ng / μL) or distilled water (blank control), and distilled water is added to 25 μL. The DNA template is DNA extracted from animal tissues of cattle, sheep, pigs, chickens, and ducks, respectively, and a blank control group is set up at the same time. Then carefully add 1 μL of 1:1000 SYBR Green I nucleic acid dye to the inner wall of the PCR tube cap and carefully close the tube cap. Place the PCR tube on a floating plate, incubate it in a water bath at 63°C for 40 minutes, and then heat it at 85°C for 5 minutes to terminate the reaction. Observe and record the color change of the liquid in the reaction tube, green indicates positive and orange indicates negative.

[0059] The LAMP results of Example 1 and Comparative Example 2 were analyzed. The amplification primers of pigs were added to the LAMP reaction, while the amplification results of cattle, sheep, chicken, duck and distilled water were added to the other amplification primers. The specific results are shown in the attached Figure 3 shown.

[0060] The sequence of the 5′→3′ primer of the amplification primer is

[0061] FIP:ACTGAATAGCACCTTGTTTGGATTTGTAGCTGGACTTCATGG (as shown in SEQ ID NO.1)

[0062] BIP:CGGGACATAACGTGCGTACAAGTTTAATGGGGGGTAAGG (as shown in SEQ ID NO.2)

[0063] F3:AGGCCCTAACACAGTAGTCAACAACAA (as shown in SEQ ID NO.3)

[0064] B3: GTTATAGGGTGTGTAGAGCATA (as shown in SEQ ID NO.4)

[0065] By the attached Figure 3 It can be seen that after adding pig DNA to the reaction tube in Example 1 of the present invention, the detection liquid is green, indicating that the amplification result is positive, and the liquid in the other reaction tubes adding cattle, sheep, chicken, duck DNA and distilled water is orange, indicating that the amplification result is negative, which shows that the use of seaweed cellulose nanofiber aerogel material effectively reduces the pollution in the experimental process, so that the LAMP test can accurately distinguish between samples containing pig DNA and other samples that do not contain pig DNA. Therefore, there is no false positive in the test results in Example 1; while the liquid in the reaction tube added with pig DNA in Comparative Example 1 and all the reaction tubes added with cattle, sheep, chicken, duck DNA and distilled water are bright green, which shows that all samples in Comparative Example 1 are mistakenly judged as positive. Due to the pollution of the experimental environment, the LAMP test cannot accurately distinguish between samples containing pig DNA and other samples that do not contain pig DNA, and all samples have false positive results, which reduces the accuracy and reliability of the test.

[0066] The application of seaweed cellulose nanofiber aerogel material in LAMP detection of adulterated meat products can significantly reduce experimental contamination and improve the accuracy and reliability of detection; this is because the seaweed cellulose nanofiber aerogel material has been successfully modified to be positively charged and can adsorb negatively charged DNA in aerosols, and by grafting β-cyclodextrin on the surface of CNFs, it can have a hydrophobic cavity, which can more firmly bind the adsorbed DNA in the hydrophobic cavity, so the seaweed cellulose nanofiber aerogel material prepared by the present invention has a strong ability to remove DNA that causes LAMP test contamination in terms of its structure and properties.

[0067] In summary, the aerogel material prepared from seaweed cellulose nanofibers of the present invention performs well in LAMP detection of adulteration of meat products, can significantly improve the specificity and accuracy of detection, and avoid the occurrence of false positive results, which provides strong support for the wide application of this material in the field of food safety testing.

[0068] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A method for preparing seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration, characterized in that: The method comprises the following steps: adding beta-cyclodextrin into cationic seaweed cellulose nanofibers, heating and stirring to obtain a mixed suspension, and absorbing the mixed suspension for vacuum freeze drying to obtain a seaweed cellulose nanofiber aerogel material.

2. The method for preparing the seaweed cellulose nanofiber aerogel material according to claim 1, characterized in that: The cationic seaweed cellulose nanofibers are obtained by the following steps: sodium hydroxide solution, distilled water and 2,3-epoxypropyltrimethylammonium chloride are sequentially added to the seaweed cellulose to obtain a seaweed cellulose mixture, pH value is adjusted, oxidation, washing and homogenization are performed to obtain the cationic seaweed cellulose nanofibers.

3. The method for preparing the seaweed cellulose nanofiber aerogel material according to claim 2, characterized in that: The pH value is adjusted to 4-5, and the oxidation is carried out by stirring a NaClO2 solution with a mass concentration of 1%-2% at 70-90°C for 3-5h.

4. The method for preparing the seaweed cellulose nanofiber aerogel material according to claim 1, characterized in that: The molar ratio of the beta-cyclodextrin to the cationic seaweed cellulose nanofibers is 1:1-2, the heating temperature is 55-65° C., and the stirring time is 4-6 hours.

5. The seaweed cellulose nanofiber aerogel material for LAMP detection of adulteration of meat products obtained by the preparation method according to any one of claims 1 to 4, characterized in that: The seaweed cellulose nanofiber aerogel material uses cationic seaweed cellulose nanofibers as a skeleton, and beta-cyclodextrin is grafted onto the skeleton. The solid content of the cationic seaweed cellulose nanofibers is 4-5wt%.

6. A LAMP detection kit, characterized in that: The LAMP detection kit comprises the seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration as described in claim 5.

7. The LAMP detection kit according to claim 6, characterized in that: The LAMP detection kit also includes a LAMP reaction mixture and a nucleic acid dye.

8. Use of the seaweed cellulose nanofiber aerogel material for LAMP detection of meat product adulteration according to claim 5, or the LAMP detection kit according to any one of claims 6 to 7 in LAMP detection of meat product adulteration.

9. A method for detecting adulteration of meat products using LAMP, characterized in that: The seaweed cellulose nanofiber aerogel material for LAMP detection of adulterated meat products as described in claim 5 is placed at the PCR tube mouth to adsorb and fix aerosol particles in the environment into the detection system, thereby reducing the occurrence of false positive results in LAMP detection.

10. The method for detecting adulteration of meat products by LAMP according to claim 9, characterized in that: The LAMP method for detecting adulteration of meat products comprises adding DNA of the meat product to be tested and a LAMP reaction mixture into a PCR tube, adding a nucleic acid dye into the inner wall of the PCR tube cover, and observing the color change of the liquid in the PCR tube after the reaction. If the color changes, the meat product to be tested is adulterated; if the color does not change, the meat product to be tested is not adulterated.

Images