Pseudomonas TB392 and application thereof in degradation of pectin and generation of flavor substances in tobacco leaves

Abstract

The invention discloses pseudomonas TB392 and application thereof in degradation of pectin and generation of flavor substances in tobacco leaves, and belongs to the technical field of biology. The strain is preserved in the China General Microbiological Culture Collection Center on October 16, 2024, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.32230. The strain can produce pectinase at high yield, has the capability of reducing nicotine, can degrade macromolecular compounds such as carotenoid, starch, pectin, cellulose and the like in tobacco leaves, and can remarkably improve the content of flavor substances in the tobacco leaves. After the strain or the prepared microbial agent is applied to tobacco leaves, the quality of the tobacco leaves can be improved, and the use value of the tobacco leaves is improved.

Description

Technical Field

[0001] The invention relates to a strain of Pseudomonas TB392 and application thereof in pectin degradation and flavor substance generation in tobacco leaves, belonging to the field of biotechnology. Background Art

[0002] Tobacco leaf fermentation is also called tobacco leaf aging and aging. Its essential process is a process of using the growth and metabolism of microorganisms on the surface of tobacco leaves under certain environmental conditions to degrade macromolecular compounds such as pectin, cellulose, and protein in tobacco leaves, while producing some small molecular compounds that can improve the quality rating of tobacco leaves. The current mainstream aging methods are generally divided into natural aging and artificial aging. Among them, natural aging generally involves stacking tobacco leaves in a warehouse with a certain temperature and humidity for 1 to 3 years, using the microorganisms of the tobacco leaves to ferment, which usually has a better effect, but the long cycle is easily affected by the breeding of miscellaneous bacteria or mosquitoes, and requires a large number of warehouses with stable environments to stack tobacco, which has a high stacking cost; and the commonly used strains for artificial aging are often derived from tobacco rhizosphere soil or the surface of fresh tobacco leaves, and the tobacco leaves after baking and aging The environment is not suitable for the growth of these microorganisms, so there is often a situation where the experimental effect is ideal but the application effect is poor.

[0003] Macromolecules such as cellulose, pectin, protein, starch and lignin are the main factors affecting tobacco leaf quality. If the pectin content is too high, pectin will produce methanol during the combustion process, and methanol will further oxidize to form formic acid, formaldehyde, etc., producing a strong pungent odor, which will affect the sensory quality of tobacco leaves. In addition, these pungent odor gases are not good for health. Therefore, reducing the pectin content is crucial to improving tobacco leaf quality. Using strains from the surface of tobacco leaves for artificial alcoholization can minimize the impact on the activity of other fermentation bacteria on the surface of tobacco leaves, thereby reducing the impact on tobacco leaf quality.

[0004] The aroma substances in tobacco leaves mainly come from the degradation of phenylalanine, Maillard reaction and carotenoid degradation products. Among them, phenylalanine conversion products such as benzaldehyde, phenylethanol, benzoic acid, etc. are important aroma substances. Among them, benzaldehyde and phenylethanol can be used as the main aroma to increase the nutty aroma, sweet aroma, popcorn aroma and rose aroma of tobacco leaves; the "bread aroma" or "baked aroma" intermediate products obtained by the aminocarbonyl rearrangement formed by the Maillard reaction, such as 5-methyl-2-furfural, can increase the sweetness, flower aroma and flue-cured tobacco aroma of cigarette smoke; carotenoids are important aroma precursors in tobacco leaves, and their degradation products greatly affect the aroma quality of tobacco leaves; neophytadiene is the component with the highest content in the neutral aroma substances of flue-cured tobacco, which can act as a carrier of other substances and reduce the direct irritation of smoke to the throat; β-damascenone has the characteristic aroma of roses, geranyl acetone has a green taste and can increase the smoke concentration, and megastigmatrienone can increase the flower and wood aroma in tobacco leaves.

[0005] In response to the above problems, a microbial preparation was developed that can adapt to the environment of tobacco leaves after baking and aging, accelerate the aging process of tobacco leaves with poor quality ratings, and shorten the aging cycle. This is of great practical significance for cigarette factories to improve tobacco quality and reduce costs. Summary of the invention

[0006] The object of the present invention is to provide a strain of Pseudomonas and its application. The Pseudomonas can reduce the content of macromolecular compounds such as pectin, protein, starch, cellulose, lignin and carotenoids in redried tobacco leaves, while increasing the content of aroma substances in the tobacco leaves, producing new aroma substances, and significantly improving the sensory quality and smoking grade of the redried tobacco leaves.

[0007] The technical solution of the present invention is as follows:

[0008] The first object of the present invention is to provide a strain of Pseudomonas sp. TB392, which has been deposited in the China General Microbiological Culture Collection Center on October 16, 2024, with a deposit number of CGMCC No. 32230.

[0009] In one embodiment of the present invention, the Pseudomonas TB392 is isolated from C3F-AB tobacco leaves in Baoji, Shaanxi in 2022, and its 16s rDNA nucleotide sequence is shown in SEQ ID NO.3.

[0010] In one embodiment of the present invention, Pseudomonas TB392 has the following biological characteristics:

[0011] (1) Bacterial characteristics: Gram-negative bacteria, thin rod-shaped, with flagella;

[0012] (2) Colony characteristics: round single colony, white in color, with a slightly raised center;

[0013] (3) Growth characteristics: The growth temperature range of Pseudomonas TB392 strain is 25-35°C, and the growth pH range is 6.0-8.0;

[0014] (4) It is a facultative aerobe and grows slowly under anaerobic conditions;

[0015] (5) It can produce high amounts of pectinase, which has the ability to reduce pectin in tobacco leaves and can reduce the content of formic acid and acetic acid, the degradation products of pectin;

[0016] (6) It has the ability to degrade β-carotene and lutein, with degradation rates reaching 69.704% and 51.497%, respectively;

[0017] (7) It has the ability to reduce protein, starch, lignin and cellulose in tobacco leaves;

[0018] (8) It has the ability to reduce nicotine, with a degradation rate of 70.49% for 1 g / L nicotine concentration;

[0019] (9) It has the ability to reduce carotenoids in tobacco leaves and increase the content of carotenoid degradation products in tobacco leaves, such as β-cyclocitral, megastigmatrienone, neophytadiene, β-ionone, β-damascenone, dihydroactinolactone, 6-methyl-5-hepten-2-one, geranyl acetone, and acacia acetone;

[0020] (10) increasing the content of phenylalanine metabolites in tobacco leaves, such as benzyl alcohol, phenylethanol, benzaldehyde, phenylacetaldehyde, and benzoic acid;

[0021] (11) increasing the content of Maillard reaction products in tobacco leaves, such as increasing the content of aroma substances such as indole, furanyl hydroxymethyl ketone, 5-hydroxymethyl-2(5H) furanone, furanyl hydroxymethyl ketone, 2-hydroxybutyrolactone, 6-methyl-5-heptene-2-one, 2-acetylpyrrole, furfural, furfuryl alcohol, and 5-methylfurfural;

[0022] (12) Improve the smoking quality of tobacco leaves.

[0023] The second object of the present invention is to provide a microbial agent containing the Pseudomonas TB392 of the present invention.

[0024] In one embodiment of the present invention, the microbial agent uses Pseudomonas TB392 as the main microorganism.

[0025] In one embodiment of the present invention, the cell concentration of Pseudomonas TB392 in the bacterial agent is not less than 3.0×10 8 CFU / mL.

[0026] In one embodiment of the present invention, the bacterial agent is obtained by preparing a seed solution of Pseudomonas sp. TB392 and then expanding the culture.

[0027] In one embodiment of the present invention, the microbial agent contains living cells of the Pseudomonas TB392 strain of the present invention, dry cells of the Pseudomonas TB392 of the present invention obtained by freeze-drying, immobilized cells of the Pseudomonas TB392 of the present invention, a liquid agent of the Pseudomonas TB392 of the present invention, a solid agent of the Pseudomonas TB392 of the present invention, or the Pseudomonas TB392 strain of the present invention in any other form.

[0028] In one embodiment of the present invention, the microbial agent is prepared by the following steps:

[0029] (1) inoculating Pseudomonas sp. TB392 into LB liquid medium for activation culture to prepare a seed solution;

[0030] (2) The seed liquid is further fermented and cultured; after the fermentation, the supernatant is removed by centrifugation and water is added to prepare a bacterial suspension;

[0031] (3) The fermentation broth is centrifuged, the supernatant is discarded, and then water is added to resuspend the broth, and the bacterial concentration is adjusted to obtain a microbial preparation containing Pseudomonas TB392.

[0032] In one embodiment of the present invention, the culture conditions in step (1) are: culture at 25-35° C. and 100-250 rpm for 16-24 hours.

[0033] In one embodiment of the present invention, the culture conditions in step (2) are: culturing at 25-35° C. and 100-250 rpm for 16-24 h until the OD reaches 3-5.

[0034] In one embodiment of the present invention, the centrifugation conditions in step (3) are 4° C. and 6000 rpm for 15 min.

[0035] The third object of the present invention is to provide a method for improving the quality of tobacco leaves, wherein the method improves the quality of tobacco leaves by fermenting tobacco leaves with Pseudomonas TB392 or a microbial preparation thereof.

[0036] In one embodiment of the present invention, the improving tobacco leaf quality is: reducing the nicotine in the tobacco leaves, reducing the content of macromolecular compounds in the tobacco leaves and / or increasing the content of flavor substances in the tobacco leaves.

[0037] In one embodiment of the present invention, the tobacco leaf macromolecular compounds are protein, starch, pectin, lignin, cellulose, and carotenoids.

[0038] In one embodiment of the present invention, the aroma substances in the tobacco leaves include but are not limited to β-cyclocitral, megafattyenone, neophytadiene, β-ionone, β-damascenone, dihydroactin, 6-methyl-5-heptene-2-one, geranyl acetone, acacia acetone, benzyl alcohol, phenylethyl alcohol, benzaldehyde, phenylacetaldehyde, benzoic acid, indole, furanyl hydroxymethyl ketone, 5-hydroxymethyl-2 (5H) furanone, furanyl hydroxymethyl ketone, 2-hydroxybutyrolactone, 6-methyl-5-heptene-2-one, 2-acetylpyrrole, furfural, furfuryl alcohol, and 5-methylfurfural.

[0039] In one embodiment of the present invention, the method comprises the following steps:

[0040] (1) spraying a suspension of Pseudomonas TB392 evenly onto the surface of tobacco leaves and placing the leaves in a constant temperature and humidity chamber for fermentation;

[0041] (2) Drying the fermented tobacco leaves to obtain fermented tobacco leaves.

[0042] In one embodiment of the present invention, the concentration of the bacterial suspension in step (1) is (1-5)×10 8 CFU / mL, the addition amount is 0.05-0.5mL / g tobacco leaf;

[0043] Preferably, the concentration of the bacterial suspension is 3×10 8 CFU / mL, and the added amount was 0.1mL / g tobacco leaf.

[0044] In one embodiment of the present invention, the fermentation temperature in step (1) is 25-35° C., the humidity is 60-80%, and the fermentation time is 12-48 hours;

[0045] Preferably, the fermentation time is 24 hours.

[0046] In one embodiment of the present invention, the drying temperature in step (2) is 45-55° C.; the moisture content of the fermented tobacco leaves is 1.0%-1.2%;

[0047] Preferably, the drying temperature is 50° C. and the water content is 1.2%.

[0048] The fourth object of the present invention is to provide a method for degrading carotenoids or degrading carotenoids in tobacco leaves, wherein the method utilizes Pseudomonas TB392 or a microbial preparation thereof to degrade carotenoids.

[0049] In one embodiment of the present invention, the carotenoids include β-carotene and lutein.

[0050] The fifth object of the present invention is to provide the use of Pseudomonas TB392 or its microbial preparation in increasing the content of carotenoid degradation products in tobacco leaves, increasing the content of phenylalanine metabolites in tobacco leaves, or increasing the content of Maillard reaction products in tobacco leaves.

[0051] In one embodiment of the present invention, the carotenoid degradation products include β-cyclocitral, megastigmatrienone, neophytadiene, β-ionone, β-damascenone, dihydroactinolactone, 6-methyl-5-hepten-2-one, geranyl acetone, and afarsyl acetone.

[0052] In one embodiment of the present invention, the metabolites of phenylalanine include benzyl alcohol, phenylethanol, benzaldehyde, phenylacetaldehyde, and benzoic acid.

[0053] In one embodiment of the present invention, the Maillard reaction products include indole, furanyl hydroxymethyl ketone, 5-hydroxymethyl-2(5H)furanone, furanyl hydroxymethyl ketone, 2-hydroxybutyrolactone, 6-methyl-5-heptene-2-one, 2-acetylpyrrole, furfural, furfuryl alcohol, and 5-methylfurfural.

[0054] A sixth object of the present invention is to provide a method for degrading pectin in tobacco leaves, wherein the method utilizes Pseudomonas TB392 or a microbial preparation thereof to degrade pectin.

[0055] The seventh object of the present invention is to provide the use of the Pseudomonas TB392 or a microbial agent containing the Pseudomonas TB392 in the preparation of tobacco products.

[0056] In one embodiment of the present invention, the tobacco product is tobacco flavoring, tobacco extract, flue-cured tobacco leaves or cigar tobacco leaves.

[0057] Biomaterial Deposit

[0058] Pseudomonas sp.TB392, taxonomic name: Pseudomonas sp., was deposited in the General Microbiology Center of China Culture Collection Administration on October 16, 2024, with the deposit number CGMCC No.32230, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0059] Beneficial effects:

[0060] (1) The Pseudomonas TB392 screened, obtained and preserved by the present invention can produce high amounts of pectinase and has the ability to degrade macromolecules such as pectin, protein, starch, cellulose, lignin and carotenoids in tobacco leaves. Specifically, the pectin degradation rate is 72.09%, the cellulose degradation rate is 15.78%, and the carotenoid degradation rate is 36.6%; and the content of formic acid and acetic acid, which are pectin degradation products in tobacco leaves, can be reduced;

[0061] (2) The Pseudomonas sp. TB392 provided by the present invention has the ability to degrade β-carotene and lutein, with degradation rates reaching 69.704% and 51.497%, respectively;

[0062] (3) The Pseudomonas sp. TB392 provided by the present invention has the ability to degrade nicotine, with a degradation rate of 70.49% for 1 g / L nicotine, and can grow at a nicotine concentration of up to 5 g / L, with a degradation rate of 15.4% for 5 g / L nicotine;

[0063] (4) The Pseudomonas sp. TB392 provided by the present invention has the ability to reduce carotenoids in tobacco leaves and increase the content of carotenoid degradation products in tobacco leaves, such as β-cyclocitral, megastigmatrienone, neophytadiene, β-ionone, β-damascenone, dihydroactinolactone, 6-methyl-5-hepten-2-one, geranyl acetone, and acacia acetone;

[0064] (5) The Pseudomonas sp. TB392 provided by the present invention can increase the content of phenylalanine metabolites such as benzyl alcohol, phenylethanol, benzaldehyde, phenylacetaldehyde, and benzoic acid in tobacco leaves;

[0065] (6) The Pseudomonas sp. TB392 provided by the present invention can increase the content of Maillard reaction products in tobacco leaves, such as indole, furanyl hydroxymethyl ketone, 5-hydroxymethyl-2(5H) furanone, furanyl hydroxymethyl ketone, 2-hydroxybutyrolactone, 6-methyl-5-heptene-2-one, 2-acetylpyrrole, furfural, furfuryl alcohol, 5-methylfurfural and other aroma substances;

[0066] (7) The content of aroma substances in tobacco leaves fermented by the Pseudomonas TB392 provided by the present invention is significantly increased, the aroma quality and aroma volume of tobacco leaves are significantly improved, and the impurities and irritation are reduced;

[0067] (8) When the Pseudomonas TB392 provided by the present invention is used for tobacco leaf fermentation, the fermentation time is greatly shortened, and the ideal smoking standard can be achieved in only 24 hours, greatly improving the production efficiency.

[0068] In summary, the application of this strain to tobacco leaves can effectively improve the quality of tobacco leaves, accelerate tobacco fermentation, save fermentation time, and greatly improve the availability of re-roasted tobacco leaves, especially low-grade and defective tobacco leaves. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0070] Figure 1 is a plate map of Pseudomonas TB392;

[0071] Figure 2 This is an oil microscope image of Pseudomonas TB392;

[0072] Figure 3 This is the growth curve of Pseudomonas TB392. DETAILED DESCRIPTION

[0073] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0074] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form also includes the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this description, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0075] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0076] In addition to the tobacco leaf types used in the following embodiments, the tobacco leaves in the present application may also be selected from various other known or new varieties of tobacco leaves. For other tobacco leaf varieties, those skilled in the art can use conventional technical means in the art to adjust the fermentation process.

[0077] 1. The culture medium involved in the following embodiments is as follows:

[0078] Enrichment medium: pectin 0.5 g / L, soluble starch 0.5 g / L, sterilized at 121°C for 20 min;

[0079] Screening medium: pectin 4g / L, tryptone 10g / L, yeast extract 5g / L, K2HPO4 0.1g / L, NaNO33 / L, Congo red 0.2g / L, Agar 20g / L;

[0080] LB liquid medium: tryptone 10g / L, yeast powder 10g / L, sodium chloride 5g / L, sterilized at 121℃ for 20min;

[0081] LB solid medium: 10 g / L tryptone, 10 g / L yeast powder, 5 g / L sodium chloride, 15 g / L agar, sterilize at 121°C for 20 min, and pour into the plate after cooling;

[0082] β-carotene degradation medium: peptone 10g / L, sodium chloride 5g / L, β-carotene 5g / L;

[0083] Lutein degradation medium: peptone 10g / L, sodium chloride 5g / L, lutein 5g / L;

[0084] Nicotine liquid culture medium: first prepare trace element solution (0.4g MnSO4·7H2O, 0.2g FeSO4·7H2O, 0.2g CaCl2·2H2O), and then make up to 100mL with 0.1mol / L HCl; then prepare nicotine culture medium: 13.3g K2HPO4, 4.0g KH2PO4, 1.0g yeast powder, 10mL trace element solution, add ddH2O to make up to 1000mL, pH is 7.0, sterilize at 121℃ for 20min, and add a certain amount of nicotine (filtered with 0.22μm membrane).

[0085] 2. The detection methods involved in the following embodiments are as follows:

[0086] The protein detection method was the BCA kit method (Suzhou Gres Biotechnology Co., Ltd., G0418W);

[0087] The starch detection method was the enzymatic kit method (Suzhou Grace Biotechnology Co., Ltd., G0551W);

[0088] The pectin detection method was the carbazole colorimetric kit method (Suzhou Gres Biotechnology Co., Ltd., G0717W);

[0089] The lignin detection method was the acetylation kit method (Suzhou Gres Biotechnology Co., Ltd., G0708W);

[0090] The cellulose detection method was the anthrone kit method (Suzhou Gres Biotechnology Co., Ltd., G0715W);

[0091] The carotenoid detection method was the plant carotenoid content detection kit method (Beijing Solebow Technology Co., Ltd., BC4330).

[0092] 3. The sources of materials involved in the following embodiments are as follows:

[0093] The C3F-AB tobacco leaves in Baoji, Shaanxi in 2022 come from Gansu Tobacco Industry Co., Ltd.

[0094] Example 1: Screening and identification of bacterial strains

[0095] 1. Screening of Pseudomonas

[0096] The pseudomonads of the present invention are enriched and separated from C3F-AB tobacco leaves in Baoji, Shaanxi Province in 2022. First, the redried tobacco leaves are added to a shake bottle containing an enrichment medium and cultured in a shaker at 30°C and 200rpm for 3 days to obtain an enriched cultured bacterial solution. The enriched bacterial solution is then diluted and spread on a screening medium plate and inverted at 30°C for 7 days. During this period, the formation of transparent circles is observed, and strains with larger transparent circles are selected to obtain 15 strains, which are marked as TB381 to TB395 respectively.

[0097] The above single colony was picked and inoculated into LB liquid culture medium and cultured in a shaking incubator at 30°C and 200 rpm for 24 h for expansion and seed preservation.

[0098] 2. Molecular Biology Identification

[0099] The strains screened above were inoculated into LB liquid culture medium, cultured overnight at 37°C and 200 rpm, centrifuged at 12000 r / min for 5 min, and the supernatant was discarded to obtain the bacteria; an equal amount of sterile water was added to resuspend and 3 μL was taken as a template, and PCR amplification was performed with universal primers of 16S rDNA (primer F (SEQ ID NO.1): AAGGAGGTGATCCAGCCGCA; primer R (SEQ ID NO.2): AGAGTTTGATCCTGGCTCAG), and the PCR reaction system was: 17 μL of double distilled water, 10× PCR buffer (MgSO4 / ... 2+ 15mM) 2.5μL, forward and reverse primers 1μL each, dNTP 1μL, Taq enzyme 0.5μL; PCR reaction program: 94℃3min; 30 cycles of 94℃30s, 55℃30s, 72℃2min; finally 72℃10min; the amplified product was analyzed by 0.8% agarose gel electrophoresis, and the successfully amplified DNA fragment was detected, and sequenced by Beijing Qingke Biotechnology Co., Ltd. to obtain the 16S rDNA sequence of the bacteria as shown in SEQ ID NO.3; the 16S rDNA sequence was compared and analyzed in the NCBI database by Blast, and the TB392 strain was determined to be Pseudomonas sp., and stored in a refrigerator at -80℃ for later use.

[0100] SEQ ID NO.3:

[0101] CCATGCAAGTCGAGCGGTAGCACGGAAAGATTGGTTCCCCGGGACGAGAGCGGGAGAGGGGAGAATGTGTGGGGAAAACCGCCTGGTGGGGGGGGATCTCTTGTGAAAAGGGGCGCTAATACCGCATAGTGTCGCAAGACCAAAGGGGGGGATTTTCGGGTCTTTTGCCATCATGTGTGCCCATATGGGATTATCTAGTGGGGGGGGTAAGGGCTCCCCTAGGAGACTATCCCTAGCTGGTCTGAGAGGATGACCACCCACTCTGGATCTGAGACACGGCCCACACTCCTACGGGAGGCAGCAGGGGAGAATATTGCACAGTGGGCGCACGCCTGATGCACCCGTGCCGCGTGTATGAAAAACGTCTTCGGTTTGTAAAGTACTTTCAGCGAGGAAGAAGGCGGTGGGGTTAATAACCTCAGCTATTGACGTTTCTCCCAAAAGAAGCACCGTATATCTCCGTGCCAGCACCCGCGGTAATACAGAGGGTGCAAGCGTTAATCAAAATTACTGGGCGTAAAGCACACACGGGCGGTCTGTCGAGTCATATGTAAAATCCCCGGTCTCACCCTGAAAACTGTTCTCAACACTGGCGCGCTAGACTCTTGTAGAGGGGGGTAGAATTCCGCGTGTAGCGGTGATGTGCATAGAGATCTGGAAGAATACCGGTGGAGAGTGGACCCCTCTGCACAAACACTGACGCTCGTGTGCAAAAGCGTGGAGAGCAAACAAGATTATATACTGTGATAGTCCACCCCATACAATATGTCCACTTGGGGGTGTTCTCTTGAAGAGTGTCTTCCAGATCTCACGCGTTAAGTCTACCGCCTGGAGAGTACGGCCGCGGGTTAACACTCATATGTATTGACGGGCGCCCGCACACGCTGGAGAGCGTGTGGTTATATTCTATGCACGCAGAAGACCTTCTCTACTCTTGACATCCAGAGCACTTAGCAGAGATGTTTTGGCGCCCT

[0102] The strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 16, 2024, with the deposit number CGMCC No.32230, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0103] 3. Morphological characteristics and growth characteristics of Pseudomonas TB392

[0104] The isolated Pseudomonas TB392 strain was streaked on LB solid medium and cultured at 30°C. The colony morphology was as follows Figure 1 As shown in the figure, it is a round single colony, white in color, with a slightly raised center. The bacterial smear was subjected to Gram staining, and the bacterial morphology was as follows Figure 2 As shown in the figure, the bacteria are Gram-negative, rod-shaped, and have flagella. Figure 3 shown.

[0105] The growth temperature range of Pseudomonas TB392 strain is 25-35°C, and the growth pH range is 6.0-8.0; it is a facultative aerobe and grows slowly under anaerobic conditions.

[0106] Example 2: Pectinase production capacity test

[0107] Pseudomonas TB392 was inoculated into LB liquid culture medium at a 1% inoculation rate, and cultured in a shaker at 30°C and 200 rpm for 24 h to obtain shake flask fermentation broth. The fermentation broth was centrifuged at 6000 rpm at 4°C for 15 min, and the supernatant of the fermentation broth was collected; the pectinase content was determined using the method in QB / T 4482-2013.

[0108] The remaining strains TB381-TB395 isolated in Example 1 were cultured in shake flasks in the same manner as above, and the production of pectinase in the supernatant of the fermentation broth was measured. The results are shown in Table 1.

[0109] Table 1 Pectinase detection results in the supernatant of the strain shake flask fermentation broth

[0110]

[0111] As shown in the above table, strains TB386, TB390 and TB392 have high pectinase activity, among which TB392 has the highest pectinase activity, reaching 1.5783U / mL.

[0112] Example 3: Carotenoid degradation ability test

[0113] Pseudomonas TB392 was streaked onto LB solid medium and incubated at 30°C for 24 hours until a single colony grew. A single colony was inoculated into 10 mL LB liquid medium and cultured at 30°C and 200 rpm for 16 hours. Subsequently, 5% of the inoculum was inoculated into β-carotene degradation medium and lutein degradation medium, respectively. After culturing at 30°C and 200 rpm for 24 hours, the supernatant was collected by centrifugation at 8000 rpm. The supernatant of the medium inoculated with the same amount of saline was used as a control to detect the content of β-carotene and lutein in the medium before inoculation and after fermentation. The detection method is as follows:

[0114] Take 10mL of the supernatant and add 10mL of acetone solution containing 0.1% BHT, extract repeatedly in the dark and shake for 30min, take 1mL of the organic phase and filter it with a 0.22μm filter membrane, dilute to a suitable multiple and put it into a brown bottle for HPLC detection. HPLC conditions: Zorbax SB-C18 column, 450nm, mobile phase: acetonitrile: water (88:12) and ethyl acetate gradient elution, column temperature 25℃, flow rate 1mL / min, injection volume 10μL.

[0115] The remaining strains TB381-TB395 isolated in Example 1 were tested in the same manner as above. The results are shown in Table 2.

[0116] Table 2 The ability of strains to degrade β-carotene and lutein

[0117]

[0118]

[0119] As shown in the table above, TB392 showed significant effects in the experiments of degrading β-carotene and lutein, with degradation rates reaching 69.704% and 51.497% respectively, both of which were the highest levels among all strains. In addition, TB386 ​​and TB390, which had relatively high pectinase activity, had β-carotene and lutein degradation rates of 30.531% and 43.297% and 24.314% and 33.987% respectively.

[0120] Example 4: Degradation of macromolecular compounds in tobacco leaves by strains

[0121] The strains TB386, TB390 and TB392 were cultured according to the method described in Example 2 to obtain shake flask fermentation broth, which was centrifuged at 6000 rpm for 15 min at 4°C, the supernatant was discarded, the fermentation mud was collected, and an appropriate amount of sterile physiological saline was added to fully resuspend the mud to obtain a bacterial suspension concentration of 3.0×10 8CFU / mL. The bacterial suspension was evenly sprayed on low-grade tobacco leaves, 1 mL of bacterial suspension was sprayed on every 10 g of tobacco, and fermented in a constant temperature and humidity chamber at 30°C and 70% humidity for 24 hours. At the same time, an equal amount of sterile saline was sprayed as a control group.

[0122] An appropriate amount of the tobacco leaves fermented for 24 hours was weighed and crushed into tobacco powder using a multifunctional pulverizer, and passed through a 60-mesh sieve. The sieved tobacco leaf powder was dried in an oven at 60°C for 4 hours, and then the protein, starch, pectin, lignin, cellulose and carotenoid contents were tested.

[0123] The results of the detection of macromolecular compound contents in fermented tobacco leaves are shown in Table 3.

[0124] Table 3 Degradation results of strains on macromolecular compounds in tobacco leaves

[0125]

[0126] As shown in the above table, in the tobacco leaves fermented with Pseudomonas TB392, the contents of protein, starch, pectin, lignin, cellulose and carotenoids all decreased, and starch, pectin, cellulose and carotenoids decreased significantly. Although in implementation 2, the enzyme production capacity of TB386 ​​and TB390 was not much different from TB392, when actually applied to tobacco leaf fermentation, the degradation capacity of macromolecular compounds, especially pectin, was very different, and Pseudomonas TB392 had obvious advantages. In addition, carotenoids are important fragrance prerequisite substances, and the decline in their content can show that the fragrance of tobacco leaves after fermentation by TB392 is more obvious. TB386 ​​and TB390 have certain degradation capacity in embodiment 3, but carotenoids are almost not degraded when applied to tobacco leaves, which may be due to their poor ability to decompose other macromolecules and the lack of nutrients that must be grown and metabolized.

[0127] Example 5: Ability of strains to degrade nicotine

[0128] The three strains of bacteria TB386, TB390, and TB392 stored in glycerol tubes in Example 2 were inoculated at an inoculum of 1% in a nicotine liquid medium shake flask with nicotine contents of 0.25, 0.5, 1, 2, 2.5, and 5 g / L, respectively, and cultured under the conditions of 30° C., pH 7.0, and 200 r / min. The nicotine degradation rate at different nicotine concentrations was measured after 20 hours of culture, and 1% volume of sterile water was inoculated at different concentrations as a control group.

[0129] The detection method of nicotine degradation rate is as follows:

[0130] The fermentation broth of the control group and the experimental group after culturing for 20 hours was centrifuged at 12000 rpm for 5 minutes, and the supernatant was measured with an ultraviolet spectrophotometer at 259 nm to measure the OD value. The degradation rate calculation formula under different nicotine concentrations is as follows:

[0131] Degradation rate % = (control group OD 259 - Experimental group OD 259 ) / control group OD 259 ×100%

[0132] The results are shown in Table 4.

[0133] Table 4 Degradation rate results of strains at different nicotine concentrations

[0134]

[0135] According to the results in the above table, after being cultured in nicotine liquid culture medium for 20 hours, the degradation rate of nicotine at a concentration of 1 g / L reached 70.49%, and the degradation rate of nicotine by this strain was significantly better than that of the other two strains.

[0136] Example 6: Detection of organic acids and aroma substances in tobacco leaves after fermentation with Pseudomonas TB392

[0137] Organic acid detection method:

[0138] (1) Sample pretreatment

[0139] Weigh 1.00 g of tobacco leaf powder into a 50 mL centrifuge tube, accurate to 0.0001 g, add 1.5 mL of phosphate buffer solution with a pH of 3.0, and soak for 30 min; add 50 μL of trans-dihexenoic acid (12.39 mg / mL), add 10 mL of dichloromethane, cover the bottle stopper, and vortex at 2000 r / min for 20 min; centrifuge at 6000 r / min for 6 min; take the supernatant, filter through a 0.45 μm organic phase filter membrane; transfer 1000 μL of the filtrate and add 100 μL of silanization reagent (BSTFA / 1% TMCS / 0.2% TMSI (v / v / v)), react in a 60°C water bath for 40 min, take out, place at room temperature (15-30°C), and then analyze by GC-MS and GC-MS / MS.

[0140] (2) GC-MS measurement parameters:

[0141] Chromatographic column: DB-5MS elastic quartz capillary column (60m×0.25mm×0.25μm); injection port temperature: 290℃; program temperature rise: initial temperature 35℃, hold for 2.25min, then increase to 38℃ at 0.2℃ / min, hold for 1min, then increase to 45℃ at 1℃ / min, and then increase to 130℃ at 4℃ / min; split injection, split ratio 90:1; split flow rate 135mL / min. Carrier gas: helium (purity 99.999%), constant flow mode, flow rate 1.5mL / min; injection volume: 1μL. A glass three-way backflush system was used, and the gas path flow rate parameters were: initial flow rate 1.5mL / min, hold for 1min, then increase to -0.75mL / min 2 Reduce to 0.5 mL / min, maintain for 15 min, then reduce to -5.5 mL / min 2 Reduce to -5mL / min and maintain for 30min.

[0142] Mass spectrometry ionization mode: ion source temperature: 280°C; quadrupole temperature: 150°C; transfer line temperature: 290°C; scanning mode: SIM / SCAN.

[0143] Fragrance component determination method:

[0144] (1) Sample pretreatment

[0145] Weigh 1g (accurate to 0.0001g) of tobacco leaf powder sample into a 50mL centrifuge tube and add 10mL of foaming solution (pH 3.0 phosphate buffer solution). First add 7mL of foaming solution and stir thoroughly to completely soak the sample, then rinse the stirring rod with 3mL of foaming solution. Soak for 20min. Add 45μL of internal standard solution (styrene-d8 (360ng / mL), acetophenone-d8 (360ng / mL), benzophenone-d 10 (360ng / mL), diisobutyl phthalate-d4 (360ng / mL), add 10mL acetonitrile, vortex at 2000r / min for 20min. Place the centrifuge tube at -18℃ for 30min, take it out and quickly add 4g MgSO4 and 1g NaCl and shake it vigorously, add 5mL dichloromethane, and vortex at 2000r / min for 20min. Centrifuge at 8000r / min for 3min, take the supernatant after standing, filter it with 0.22μm organic phase microporous filter membrane into 12mL sample bottle, transfer 1mL to two chromatographic bottles, add 50μL analyte protective agent to each for GC-MS / MS test. Repeat the measurement 3 times for each sample.

[0146] (2) GC-MS / MS measurement parameters

[0147] Chromatographic column: DB-5MS UI elastic quartz capillary chromatographic column (60m×0.25mm×0.25μm); injection port temperature: 290℃; injection volume: 1μL; carrier gas: helium (purity ≥99.999%), constant flow rate: 1.5mL / min; heating program: initial temperature 50℃, hold for 3min, increase to 75℃ at a rate of 5℃ / min, increase to 120℃ at a rate of 1℃ / min, increase to 160℃ at a rate of 2℃ / min, increase to 290℃ at a rate of 5℃ / min, hold for 3min, for a total of 102min.

[0148] Split mode: splitless injection;

[0149] Mass spectrometry conditions: ionization mode: electron impact source (EI); filament current: 35 μA; ionization energy: 70 eV; transfer line temperature: 280°C; ion source temperature: 280°C; quadrupole temperature: 150°C; quenching gas: helium (99.999%), flow rate 2.25 mL / min; collision gas: nitrogen (99.999%), flow rate 1.5 mL / min; determination method: multiple reaction monitoring (MRM) scanning.

[0150] A large amount of acetic acid will be produced during the degradation of pectin, and acetic acid has a pungent taste and irritation. Pectin will produce methanol during the combustion and smoking process, and methanol will be further oxidized to form formic acid, formaldehyde, etc. Not only will it bring irritation to the flue gas, but it will also be detrimental to the safety of smoking. The tobacco powder after fermentation by Pseudomonas TB392 in the above embodiment 4 and the untreated tobacco powder sample were tested for formic acid and acetic acid content according to the above organic acid detection method, and the results are shown in Table 5. Due to the decrease in pectin content, the decrease in formic acid and acetic acid content of pectin degradation products can significantly reduce the irritation of tobacco leaves.

[0151] Table 5 Detection results of phenylalanine degradation product content

[0152]

[0153] The tobacco powder fermented by Pseudomonas TB392 and the untreated tobacco powder samples in Example 4 were tested for the contents of phenylalanine degradation products, Maillard reaction products and carotenoid degradation products according to the above aroma component determination method. The results are shown in Tables 6 to 8.

[0154] The metabolites of phenylalanine in tobacco are one of the important substances that affect the flavor of tobacco, and its transformation products such as benzyl alcohol, phenylethanol, benzoic acid, etc. are important aroma substances. Benzaldehyde and phenylethanol can be used as the main aroma to increase the nutty, sweet, popcorn aroma in tobacco leaves and the rose aroma of cigarette smoke. Table 6 is a table of changes in phenylalanine degradation products after TB392 treatment. It can be seen from the table that after TB392 treatment, the content of each phenylalanine degradation product is higher than that of the untreated sample.

[0155] Table 6 Phenylalanine degradation product content detection results

[0156]

[0157] The Maillard reaction is a non-enzymatic browning reaction of amino acids and carbohydrates. It is a "bread aroma" or "baked aroma" intermediate product obtained by the static rearrangement of amino sugars formed by the condensation of free amino acids and carbonyl groups of reducing sugars. 5-Methyl-2-furfural can increase the sweetness, floral aroma and flue-cured tobacco flavor of cigarette smoke. Table 7 is an analysis table of changes in Maillard reaction products after TB392 treatment. It can be seen from the table that after TB392 treatment, the content of each Maillard reaction product is significantly increased relative to the untreated control sample.

[0158] Table 7 Maillard reaction product content detection results

[0159]

[0160]

[0161] Carotenoids are important aroma precursors in tobacco leaves, and their degradation products greatly affect the aroma quality of tobacco leaves. Neophytadiene is the component with the highest content in the neutral aroma substances of flue-cured tobacco. It can act as a carrier of other substances and reduce the direct irritation of smoke to the throat. β-Damascenone has the characteristic aroma of roses, geranyl acetone has a green aroma that can increase the concentration of smoke, and megastigmatrienone can increase the floral and woody aroma in tobacco leaves. As can be seen from the table, after spraying TB392 bacterial solution, the content of carotenoid degradation products in tobacco leaves is significantly higher than that of untreated samples.

[0162] Table 8 Detection of carotenoid degradation product content

[0163]

[0164] As shown in Tables 6, 7 and 8 above, the contents of various aroma substances in tobacco leaves fermented by Pseudomonas TB392 were significantly increased, and the contents of harmful substances such as formic acid and acetic acid were significantly reduced.

[0165] Example 7: Pseudomonas TB392 fermentation improves sensory evaluation of tobacco leaves

[0166] The smoking quality of tobacco leaves fermented with Pseudomonas TB392 of the present invention is evaluated in the following specific method:

[0167] The strain was inoculated into LB liquid culture medium and cultured according to the method of Example 2 to obtain fermentation broth. The bacterial sludge was collected by centrifugation and resuspended in sterile saline. The live bacterial concentration of the resuspended broth was 3×10 8 CFU / mL, 10mL of the resuspension was sprayed evenly on the surface of 100g of low-grade tobacco leaves, and fermented in a constant temperature and humidity chamber at 30℃ and 70% for 24h and 48h as experimental group 1 and experimental group 2, respectively. At the same time, spraying 10mL of the same amount of sterile saline was used as the control group.

[0168] The fermented tobacco leaves were cut into shreds according to industry standards and rolled into cigarettes. The cigarettes were placed in a constant humidity chamber at a temperature of 22°C and a relative humidity of 60% for 48 hours for balancing in a smoking evaluation experiment.

[0169] The results of the suction test are shown in Table 9.

[0170] Table 9 Smoking evaluation of tobacco leaves in the experimental group and the control group

[0171]

[0172] The results showed that after the redried tobacco leaves were fermented with Pseudomonas TB392 for 24 hours and 48 hours, the sensory evaluation results showed that all sensory evaluation indicators of the tobacco leaves were improved, especially in terms of aroma quality and aroma volume, impurities and irritation. The quality of the tobacco leaves was significantly improved, and the differences in various indicators between 24h and 48h were not significant, so the ideal effect of increasing flavor and improving quality can be achieved by fermenting for 24h.

[0173] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Pseudomonas sp., characterized in that: The strain has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration with the deposit number: CGMCC No.32230.

2. A microbial agent, characterized in that: Contains the Pseudomonas sp. CGMCC No. 32230 of the present invention.

3. The microbial agent according to claim 2, characterized in that: The number of cells of Pseudomonas CGMCC No. 32230 in the bacterial agent is not less than 3.0×10 8 CFU / mL.

4. The microbial agent according to claim 2, characterized in that: The microbial agent contains living cells of the pseudomonas CGMCC No. 32230 of the present invention, dry cells of the CGMCC No. 32230 strain of the present invention obtained by freeze drying, immobilized cells of the CGMCC No. 32230 strain of the present invention, a liquid agent of the CGMCC No. 32230 strain of the present invention, a solid agent of the CGMCC No. 32230 strain of the present invention, or the CGMCC No. 32230 strain of the present invention in any other form.

5. A method for improving tobacco leaf quality, characterized in that: The method comprises fermenting tobacco leaves using the Pseudomonas CGMCC No. 32230 described in claim 1 or a microbial agent containing the Pseudomonas CGMCC No. 32230 described in claim 1; wherein improving the quality of tobacco leaves comprises reducing the nicotine in the tobacco leaves, reducing the content of macromolecular compounds in the tobacco leaves and / or increasing the content of aroma substances in the tobacco leaves.

6. The method according to claim 5, characterized in that The method comprises the following steps: (1) Spray the CGMCC No.32230 bacterial suspension onto the surface of tobacco leaves and place them in a constant temperature and humidity chamber for fermentation; (2) drying the fermented tobacco leaves to obtain fermented tobacco leaves; Preferably, the bacterial suspension is (1-5)×10 8 The concentration of CFU / mL and the spraying amount of 0.1mL / g tobacco leaf are sprayed on the surface of tobacco leaves; the fermentation time is 16 to 50 hours.

7. A method for degrading carotenoids or degrading carotenoids in tobacco leaves, characterized in that: The method utilizes the Pseudomonas CGMCC No. 32230 described in claim 1 or a microbial agent containing the CGMCC No. 32230 described in claim 1 to degrade carotenoids.

8. Use of the Pseudomonas sp. CGMCC No. 32230 of claim 1 or a microbial agent containing the CGMCC No. 32230 of claim 1 in increasing the content of carotenoid degradation products in tobacco leaves, increasing the content of phenylalanine metabolites in tobacco leaves, or increasing the content of Maillard reaction products in tobacco leaves.

9. A method for degrading pectin in tobacco leaves, characterized in that: The method utilizes the Pseudomonas CGMCC No. 32230 described in claim 1 or a microbial agent containing the CGMCC No. 32230 described in claim 1 to degrade pectin in tobacco leaves.

10. Use of the Pseudomonas CGMCC No. 32230 of claim 1 or a microbial agent containing the CGMCC No. 32230 of claim 1 in the preparation of tobacco products.

Images